• Tidak ada hasil yang ditemukan

Klaning gen xylA dari lactobacillus pebtosus untuk produksi sirup fruktosa (HFCS) dan rare sugar

N/A
N/A
Protected

Academic year: 2017

Membagikan "Klaning gen xylA dari lactobacillus pebtosus untuk produksi sirup fruktosa (HFCS) dan rare sugar"

Copied!
44
0
0

Teks penuh

(1)

BAB I PENDAHULUAN

1.1. Latar Belakang

Suatu fakta teramat penting tentang gula belakangan ini adalah harganya yang melambung terus. Indonesia merupakan pengimpor gula nomor dua terbesar di dunia (Richana, 2005). Namun, dibalik itu semua, peningkatan jumlah penggunaan gula pada skala industri seperti industri makanan, pemanis dan minuman ringan telah meningkatkan pula perhatian manusia pada dampak kesehatannya. Jumlah penduduk yang terkena penyakit diabetes, obesitas, kanker, dan jantung meningkat dari tahun ke tahun. Dengan fenomena tersebut, adanya sirup fruktosa dan rare sugar diharapkan sebagai pemanis berkalori rendah dan sangat toleransi terhadap penyakit diabetes juga sebagai alternatif antitumor dan antikanker (Saksono, 2006).

Keuntungan lain yang dapat diraih yaitu pasokan gula tidak hanya dari gula sukrosa (gula pasir) tapi juga dari gula fruktosa dan rare sugar lainnya. Hal tersebut secara langsung akan memanfaatkan sumber bahan berpati di Indonesia yang sangat melimpah. Dengan produksi yang meningkat maka akan dapat menekan harga, sehingga harga dapat bersaing dengan gula pasir dan tentu saja semua itu akan mengurangi kebutuhan gula pasir, sehingga tidak perlu impor gula lagi.

International Society of Rare Sugar (ISRS) telah mendefinisikan rare

sugar sebagai monosakarida dan derivatifnya yang terbilang langka di alam

(Granstrom et al. 2005). Metode produksi berbagai rare sugar membutuhkan

(2)

pendekatan multidisiplin yang meliputi teknologi fermentasi, biologi molekular, teknologi enzim dan kimia organik (Granstrom et al. 2004).

Pembuatan sirup fruktosa dapat dilakukan dengan tersediaanya substrat pati jagung, gandum, beras, kentang, dan umbi-umbian serta enzim isomerase yang mampu merubah glukosa menjadi fruktosa. Oleh karena itu, DNA rekombinan dengan teknik insersi gen xylA ke dalam suatu vektor diharapkan dapat digunakan sebagai teknologi alternatif dalam produksi sirup fruktosa dengan memanfaatkan sumber pati yang melimpah dan keanekaragaman mikroorganisme sumber gen xylA (Saksono, 2006).

Gen xylA yang menyandikan enzim xilosa isomerase diketahui mampu merubah glukosa menjadi fruktosa melalui proses isomerasi. Penelitian ini akan menggunakan bakteri Lactobacillus pentosus sebagai sumber gen xylA. Teknik DNA rekombinan dilakukan dengan mengkloning gen xylA yang diinsersikan ke dalam plasmid kloning pGEM-T Easy dan ditransformasikan ke dalam bakteri inang Escherichia coli DH5 . Selanjutnya, dilakukan sekuensing untuk memeriksa urutan basa xylA dari E.coli DH5 yang kemudian akan dibandingkan dengan sekuens basa gen xylA yang telah dipublikasikan oleh Genebank.

O OH

H OH O

HO H HO H

H OH

H OH

OH

Xilosa isomerase

H OH H OH

OH

[image:2.612.207.496.520.668.2]

D-Glukosa D-Fruktosa

Gambar 1. Proses isomerasi untuk produksi sirup fruktosa

(3)

O

H

OH

OH

O

Xilosa isomerase

HO

H

H

OH

OH

HO

H

H

OH

OH

[image:3.612.115.505.97.533.2]

D-Xilosa D-Xilulosa

Gambar 2. proses isomerasi untuk produksi rare sugar

Reaksi tersebut merupakan reaksi “reversible” artinya dapat mengkatalis ke aksi bolak-balik (Rahmawati, 2003).

1.2. Perumusan Masalah

Berdasarkan latar belakang tersebut maka dapat dirumuskan permasalahan sebagai berikut:

1. Apakah gen xylA dapat diisolasi dari genom L.pentosus ? 2. Apakah gen xylA dapat dikloning pada E.coli DH5 ?

1.3. Tujuan Penelitian

Penelitian ini bertujuan untuk:

1. Mengisolasi gen xylA dari genom L.pentosus. 2. Mendapatkan klon gen xylA pada E.coli DH5 .

(4)

1.4. Manfaat Penelitian

Hasil dari penelitian ini diharapkan dapat:

a. Mengembangkan teknologi alternatif dalam proses produksi gula yang aman bagi penderita diabetes dan yang berpotensi sebagai obat antitumor dan terapi kanker secara masal dengan memanfaatkan metabolisme mikroba dan proses enzimatik.

b. Memberikan cakrawala pengetahuan baru yang lebih luas mengenai peranan studi bioinformatika dalam mencari sumber gen yang akan digunakan dalam suatu proses penelitian.

c. Memberikan gambaran nyata mengenai implementasi bioteknologi dengan pengetahuan genetika dan kloning DNA yang bermanfaat untuk skala industri, khususnya industri gula dan pemanis buatan.

(5)

BAB II

TINJAUAN PUSTAKA

2.1. Bioinformatika

Bioinformatika merupakan satu area ilmu pengetahuan baru yang sedang tumbuh dan berkembang, dengan memakai pendekatan perhitungan dan teknilogi informasi melalui pemanfaatkan komputer (computational biology) untuk menjawab pertanyaan-pertanyaan seputar ilmu biologi (Nugroho, 2006). Bidang ini memadukan disiplin biologi molekuler, matematika, dan teknik informasi (Wibowo, 2003), terutama dengan menggunakan sekuens DNA dan asam amino serta informasi yang berkaitan dengannya. Keberadaan data-data tersebut secara otomatis akan mendukung upaya untuk mempelajari fungsi gen-gen secara global melalui pendekatan-pendekatan functional genomics. Perkembangan internet juga mendukung berkembangnya bioinformatika. Basis data bioinformatika yang terhubung melalui internet memudahkan untuk mengumpulkan hasil sekuensing ke dalam basis data tersebut maupun memperoleh sekuens biologis sebagai bahan analisis. Selain itu, penyebaran program-program aplikasi bioinformatika melalui internet memudahkan untuk mengakses program-program tersebut dan kemudian memudahkan pengembangannya.

Selain menyediakan database seperti urutan DNA genom, urutan asam amino berbagai organisme, urutan basa DNA atau cDNA, bioinformatika juga memberikan alat-alat untuk menganalisa secara biologi molekuler seperti kemampuan untuk mencari urutan basa yang sama (similarity search), melakukan

sequence allignment,. Salah satu sisi bioinformatika yang mempunyai fasilitas

(6)

terlengkap dalam memfasilitasi penelitian functional genomics adalah yang dibangun dan dikelola oleh NCBI (National Center for Biotechnology

Information) yang merupakan bagian dari National Institute of Health di Amerika

Serikat (www.ncbi.nlm.nih.gov). NCBI berkolaborasi dengan organisasi- organisasi lain seperti DNA Databank of Japan (DDBJ) dan European Molecular

biology Laboratory (EMBL) database milik European Bioinformatics Institute

dalam hal pertukaran informasi sehingga data-data baru yang diperoleh secara terpisah akan dapat dikumpulkan untuk dimanfaatkan oleh publik semaksimal mungkin (Nugroho, 2006). Sementara itu, contoh beberapa basis data penting yang menyimpan sekuens primer protein adalah PIR (Protein Information

Resource, Amerika Serikat), Swiss-Prot (Eropa), dan TrEMBL (Eropa). Ketiga

basis data tersebut telah digabungkan dalam UniProt (yang didanai terutama oleh Amerika Serikat) (Nugroho, 2006) .

BLAST (Basic Local Alignment Search Tool) merupakan perkakas bioinformatika yang berkaitan erat dengan penggunaan basis data sekuens biologis. Penelusuran BLAST (BLAST search) pada basis data sekuens memungkinkan ilmuwan untuk mencari sekuens asam nukleat maupun protein yang mirip dengan sekuens tertentu yang dimilikinya. Hal ini berguna misalnya untuk menemukan gen sejenis pada beberapa organisme atau untuk memeriksa keabsahan hasil sekuensing maupun untuk memeriksa fungsi gen hasil sekuensing. Algoritma yang mendasari kerja BLAST adalah penyejajaran sekuens. Sekuen DNA tersedia pada Genebank yang dapat diakses secara bebas dari website NCBI pada situs http://www.ncbi.nlm.nih.gov/ BLAST (Triastanto et

(7)

al. 2006). Website ini juga memiliki link dengan web database DNA lainnya. Beberapa pusat riset di dunia telah melakukan upaya genome sequencing yang datanya dapat diakses secara bebas. Manipulasi dan analisis DNA dapat dilakukan secara on line atau off line internet (Purwantomo, 2006)

2.2. Kloning Gen (DNA)

Kloning DNA umumnya adalah perbanyakan DNA rekombinan, yaitu DNA yang sudah direkayasa dengan teknik penggabungan atau penyisipan gen (DNA) dari organisme satu ke dalam genom organisme lain (transplantasi gen/teknologi plasmid). Contohnya : kloning gen penghasil insulin dari kelenjar pankreas manusia, disisipkan ke dalam plasmid bakteri E.coli, sehingga bakteri dapat mengekspresikan gen tersebut dan menghasilkan insulin manusia dalam jumlah yang banyak, mengingat bakteri sangat cepat membelah diri dan bertambah banyak dengan cepat.

Bioteknologi telah lebih banyak menggunakan sumber genetik (DNA) organisme yang telah dimanipulasi dan disebut dengan rekayasa genetika. Rekayasa genetika telah memungkinkan para ilmuwan untuk memodifikasi gen- gen spesifik dan memindahkannya di antara organisme yang berbeda. Menurut Ratnasari (2007) mekanisme penyisipan gen (DNA) adalah sebagai berikut :

1. DNA yang ingin disisipkan, diisolasi dan dipotong oleh enzim restriksi endonuklease, di tempat yang urutan nukleotidanya spesifik.

2. Plasmid bakteri E.coli, diisolasi dan dipotong pula oleh enzim yang sama. Plasmid ini biasanya disebut sebagai vektor pengklon.

(8)

3. Fragmen DNA kemudian disisipkan ke dalam vektor dan disatukan oleh enzim ligase.

4. Plasmid yang telah disisipi, dimasukkan kembali ke dalam bakteri, kemudian bakteri tersebut dikembangbiakan menjadi banyak, sehingga rekombinan pun ikut bertambah banyak, demikian pula hasil ekspresi gennya.

2.2.1. Plasmid

Plasmid adalah molekul DNA sirkular ynag terdapat bebas dalam sel bakteri. Plasmid hampir selalu membawa satu gen atau lebih dan sering kali gen tersebut menyebabkan adanya ciri-ciri penting yang ditunjukkan oleh bakteri tuan rumah. Sebagai contoh, kemampuan hidup di dalam antibiotik dengan konsentrasi yang biasanya toksik seperti kloramfenikol dan ampisilin sering digunakan sebagai suatu selectable marker untuk memastikan bahwa bakteri dalam kultur mengandung gen tertentu (Brown, 1991).

Semua plasmid memiliki paling sedikit satu urutan (rangkaian) DNA yang dapat bertindak sebagai asal replikasi, sehingga plasmid-plasmid itu mampu memperbanyak diri di dalam sel (Brown, 1991).

2.2.2. Ligasi dan Penyisipan Gen

Untuk membuat DNA rekombinan, setidaknya digunakan dua macam enzim yaitu enzim endonuklease yang berfungsi sebagai pemotong DNA. Karena fungsinya, enzim ini sering disebut sebagai enzim pemotong (restriction enzyme). Enzim lainnya adalah enzim ligase yang berfungsi menggabungkan molekul DNA

(9)

yang sudah terpotong ke molekul DNA lain. DNA vektor dipotong pada bagian yang dikehendaki untuk disisipi DNA asing, Adapun DNA asing yang akan disisipkan juga dipotong sesuai yang dikehendaki. Pemotongan dan penggabungan molekul DNA dilakukan secara in vitro (Muladno, 2002).

2.2.3. Transformasi

Transformasi merupakan proses pemasukan molekul DNA ke dalam sel. Sel yang digunakan dalam proses transformasi ini biasanya disebut dengan sel kompeten. Dalam proses transformasi, sel kompeten yang dicampur dengan molekul DNA hasil penggabungan akan mengalami tiga kemungkinan, yaitu :

1. Sel kompeten tidak kemasukan molekul DNA apapun,

2. Sel kompeten kemasukan DNA vektor yang tidak membawa gen asing, 3. Sel kompeten kemasukan molekul DNA vektor yang membawa gen

rekombinan.

Untuk mengetahui ketiga kemungkinan yang terjadi pada sel kompeten, tiga cawan yang berisi media padat disiapkan, yang masing-masing dilabel A, B,C. Cawan A hanya berisi media padat, cawan B berisi media padat yang mengandung antibiotik, cawan C berisi media padat yang mengandung antibiotik, X-Gal, dan IPTG. Masing-masing cawan digunakan untuk menumbuhkan sel kompeten hasil transformasi. Ketika sel ditumbuhkan pada ketiga cawan tersebut, jumlah koloni terbanyak didapat pada cawan A, karena semua sel kompeten dapat hidup semua. Pada cawan B, jumlah koloni jauh lebih sedikit daripada jumlah koloni pada cawan A karena semua sel kompeten kosong

(10)

akan mati. Hanya koloni sel pembawa DNA plasmid yang dapat hidup karena pada plasmid mengandung gen tahan terhadap antibiotik. Pada cawan C jumlah koloni relatif sama dengan jumlah koloni pada cawan B tetapi ada dua macam warna koloni, yaitu putih dan biru. Adanya perbedaan warna koloni ini terjadi akibat adanyazat kimia X-Gal dan IPTG yang bereaksi dengan produk gen LacZ pada plasmid. Warana putih pada koloni diakibatkan adanya kerusakan pada gen

LacZ yang disisipi oleh gen asing. Dengan kata lain, koloni berwarna putih

berarti sel kompeten membawa DNA rekombinan (DNA plasmid+gen asing). Adapun koloni berwarna biru berarti sel kompeten yang tumbuh di cawan hanya membawa DNA plasmid saja (tidak tersisipi gen asing) (Muladno, 2002).

Menurut Mizawarti (2003), setelah proses transformasi berlangsung di dalam bakteri inang, vektor menggandakan replikasi menghasilkan banyak salinan atau turunan yang identik, baik vektornya maupun gen yang dibawanya.

2.3. Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (Reaksi Rantai Polimerase, PCR) merupakan

teknik yang sangat berguna dalam membuat salinan DNA. PCR memungkinkan sejumlah kecil sekuens DNA tertentu disalin jutaan kali untuk diperbanyak sehingga dapat dianalisis, atau dimodifikasi secara tertentu. PCR memanfaatkan enzim DNA polimerase yang secara alami memang berperan dalam perbanyakan DNA pada proses replikasi. Namun demikian, tidak seperti pada organisme hidup, proses PCR hanya dapat menyalin fragmen pendek DNA, biasanya sampai dengan 10 kb (kb = kilo base pairs = 1.000 pasang basa). Fragmen tersebut dapat berupa suatu gen tunggal, atau hanya bagian dari suatu gen.

(11)

Empat komponen utama pada proses PCR adalah (1) DNA cetakan, yaitu fragmen DNA yang akan dilipatgandakan, (2) oligonukleotida primer, yaitu suatu sekuen oligonukleotida pendek (15 – 25 basa nukleotida) yang digunakan untuk mengawali sintesis rantai DNA, (3) deoksiribonukleotida trifosfat (dNTP), terdiri atas ATP, CTP, GTP, TTP, dan (4) enzim DNA polimerase, yaitu enzim yang melakukan katalis reaksi sintesis rantai DNA. Komponen lain yang juga penting adalah senyawa buffer (Yuwono, 2006).

Menurut Muladno (2002), ada beberapa hal yang harus diperhatikan dalam pembuatan primer, antara lain:

a. GC content mendekati 50%, minimal 47%.

b. Tm (primer forward dan primer reverse) relatif sama ( 5 °C). c. Basa G dan C letaknya menyebar.

d. Menghindari pengulangan GG-CC di depan dan di belakang primer. e. Panjang primer 22-25 basa.

Proses PCR untuk memperbanyak DNA melibatkan serangkaian siklus temperatur yang berulang dan masing-masing siklus terdiri atas tiga tahapan. Tahapan yang pertama adalah denaturasi cetakan DNA (DNA template) pada temperatur 94-96°C, yaitu pemisahan utas ganda DNA menjadi dua utas tunggal. Sesudah itu, dilakukan penurunan temperatur pada tahap kedua sampai 45-60°C yang memungkinkan terjadinya penempelan (annealing) atau hibridisasi antara oligonukleotida primer dengan utas tunggal cetakan DNA. Primer merupakan oligonukelotida utas tunggal yang sekuens-nya dirancang komplementer dengan ujung fragmen DNA yang ingin disalin, primer menentukan awal dan akhir daerah yang hendak disalin. Tahap yang terakhir adalah tahap ekstensi atau

(12)

elongasi (elongation), yaitu pemanjangan primer menjadi suatu utas DNA baru oleh enzim DNA polimerase. Temperatur pada tahap ini bergantung pada jenis DNA polimerase yang digunakan. Pada akhirnya, satu siklus PCR akan menggandakan jumlah molekul cetakan DNA atau DNA target, sebab setiap utas baru yang disintesis akan berperan sebagai cetakan pada siklus selanjutnya (Muladno, 2002).

Sejak tahun 1985, PCR telah banyak digunakan dalam penelitian biologis kedokteran, sosial, dan hukum. PCR digunakan untuk mendeteksi pelaku kejahatan dari sampel DNA air mani, darah atau jaringan tubuh pelaku lainnya, atau PCR ini digunakan untuk mendeteksi patogen yang sulit terdeteksi, seperti DNA virus HIV (Ratnasari, 2007).

2.4. Elektroforesis Agarosa

Pada prinsipnya, DNA dapat bermigrasi di dalam gel dalam bentuk padat yang diletakkan dalam larutan penyangga yang dialiri arus listrik. Secara fisik, agarosa tampak seperti bubuk putih yang sangat halus. Agarosa yang dijual, secara komersial terkontaminasi dengan polisakarida, garam dan protein. Besarnya kontaminasi dalam gel dapat mempengaruhi migrasi DNA di dalam gel dapat mempengaruhi migrasi DNA di dalam gel dan kemampuan mengambil DNA dari dalam gel untuk digunakan sebagai substrat dalam reaksi enzimatis. Gel agarosa dapat dicetak dengan memanaskan agarosa yang dilarutkan dalam larutan buffer hingga didapatkan larutan yang jernih. Larutan yang masih cair (dengan suhu 60 oC) dituangkan ke dalam pencetak gel. Segera setelah itu, sisir ditempatkan di dekat tepian gel dan gel dibiarkan mengeras. Kepadatan gel

(13)

bergantung dari persentase agarosa di dalam larutan tadi. Apabila gel telah mengeras, sisir dicabut sehingga akan terbentuk sumur-sumur yang digunakan untuk menempatkan larutan DNA (Muladno, 2002).

Elektroforesis agarosa digunakan untuk memisahkan DNA berdasarkan ukurannya. DNA bermuatan negatif, maka DNA akan bergerak ke kutub positif pada daerah yang dipengaruhi oleh arus listrik. DNA yang ukurannya lebih kecil akan bergerak lebih cepat dibandingkan DNA yang ukurannya lebih besar. Hasil dari elektroforesis gel agarosa ini adalah berupa pita-pita. Gel agarosa pada elektroforesis ini merupakan polimer dari D-galaktosa dan 3,6 Anhidro-L- galaktosa yang dalam keadaan gel akan berikatan silang satu sama lain, sehingga seakan-akan membentuk jaring yang akan menyeleksi DNA yang melewati gel agarosa. DNA merupakan molekul yang sulit dilihat dengan mata, sehingga membutuhkan molekul yang dapat membantu untuk melihat DNA. Etidium bromida (Et-Br) adalah salah satu molekul yang dapat membantu visualisasi DNA. Et-Br dalam DNA mampu menghasilkan fluoresensi bila disinari dengan ultra violet. Karena Et-Br menyisip pada DNA maka posisi DNA dapat diketahui. Kompleks Et-Br dan DNA memiliki spektrum fluoresensi dengan panjang gelombang maksimum 302 nm. Fluoresensi kompleks DNA-Et-Br 10 kali lipat lebih besar dibandingkan DNA tanpa Et-Br. Diperkirakan sinar ultra violet yang diserap oleh DNA ditransfer ke ikatan Et-Br dan diemisikan kembali pada panjang gelombang yang lebih tinggi. Kompleks Et-Br DNA pada gel juga memberikan latar fluoresensi. Kecepatan migrasi DNA ditentukan oleh beberapa faktor di antaranya adalah,

(14)

1. Ukuran molekul DNA. Migrasi molekul DNA yang berukuran besar, akan lebih lambat bermigrasi dibandingkan molekul DNA yang berukuran kecil. 2. Konsentrasi agarosa. Migrasi molekul DNA pada gel berkosentrasi rendah

lebih cepat daripada migrasi molekul DNA yang sama pada gel berkonsentrasi tinggi. Oleh karena itu, penentuan konsentrasi agarosa dalam membuat gel harus memperhatikan ukuran molekul DNA yang akan dianalisis.

3. Voltase yang digunakan. Pemisahan molekul DNA di dalam gel akan menurun jika pada waktu pengukuran menggunakan voltase yang terlalu tinggi.

4. Adanya etidium bromida di dalam gel. Ini mengakibatkan pengurangan tingkat kecepatan migrasi molekul DNA sebesar 15%. Larutan ini sangat berbahaya dan bersifat karsinogenik.

5. Komposisi larutan buffer. Apabila tidak ada kekuatan ion di dalam larutan, maka aliran listrik akan sangat minimal dan migrasi DNA sangat lambat, sedangkan larutan buffer berkekuatan ion tinggi akan meningkatkan panas sehingga aliran listrik menjadi sangat maksimal. Ada kemungkinan gel akan meleleh dan DNA dapat mengalami denaturasi.

2.5. Enzim Xilosa Isomerase (XI)

Xilosa isomerase merupakan kelompok enzim isomerase (golongan V), yang termasuk kelas ini adalah semua enzim yang mengkatalisis interkonversi isomer-isomer optik, geometrik, atau posisi. Enzim ini bekerja pada reaksi intramolekuler (Poedjiadi, 1994).

Enzim xilosa isomerase disandikan oleh gen xylA dan berperan dalam mengkatalisis isomerisasi D-xilosa menjadi D-xilulosa atau sebaliknya. Enzim ini

(15)

juga dapat mengkatalisa glukosa menjadi fruktosa, sehingga dikenal juga sebagai enzim glukosa isomerase.

Setiap enzim mempunyai nomor kode sistemik (Enzyme Commission, EC). Xilosa isomerase mempunyai kode EC 5.3.1.5. Nomor ini menunjukan jenis reaksi sebagai kelas (digit pertama), sub-kelas (digit kedua), sub-kelas (digit ketiga), dan digit keempat adalah untuk nama enzim tertentu. Di samping menggunakan xilosa dan glukosa, enzim ini juga dapat menggunakan L- rhamnosa, L-arabinosa, D-ribosa, atau D-allosa sebagai substrat (Rahmawati, 2003).

Enzim ini merupakan homotetramer dengan berat molekul 200,000 kDa dan bersifat sangat termostabil dengan aktivitas optimal hingga diatas 95°C (Vieille et al, 1995). Xilosa isomerase menunjukkan aktivitas maksimum pada pH 7.1 dan menggunakan ion Mg2+ sebagai kofaktornya. Enzim ini dapat diisolasi dari bakteri hipertermofilik, yaitu mikroba yang dapat tumbuh optimum pada temperatur di atas 80°C (Vieille et al, 1995).

Enzim xilosa isomerase secara umum dikenal aman dan telah digunakan secara luas pada industri tepung dan proses makanan tertentu. Pada industri pemanis buatan, xylosa isomerase digunakan sebagai katalis dalam proses pembuatan sirup fruktosa (High Fructose Corn Syrup, HFCS) karena sifatnya yang termostabil, enzim ini akan sangat membantu dalam proses pemecahan pati

(starch) menjadi oligomer lalu menjadi glukosa atau fruktosa.Dalam skala

industri, sirup fruktosa dibuat dari glukosa yang diperoleh dari pati jagung, gandum, beras, kentang, dan umbi–umbian melalui proses isomerasi menggunakan enzim tersebut. Sirup fruktosa memiliki tingkat kemanisan 2,5 kali

(16)

lebih besar dibandingkan dengan sirup glukosa dan 1,4–1,8 kali lebih tinggi dibandingkan dengan gula sukrosa. Sirup fruktosa mempunyai kelebihan dibanding gula pasir (sukrosa) yaitu sebagai pemanis rendah kalori, indek glutemik jauh lebih rendah yaitu tidak meningkatkan gula darah dalam tubuh dan di metabolisme tanpa membutuhkan insulin, sehingga sangat baik untuk penderita diabetes, Oleh sebab itu sirup fruktosa dapat digunakan untuk pemanis penderita diabetes. Berdasarkan keunggulan sirup fruktosa ini maka pemanfaatan fruktosa tidak hanya untuk penderita diabetes tetapi juga digunakan untuk produk minuman ringan (soft drink), sirup, jelly, jam, coctail, dan sebagainya (Richana, 2005).

Selain manfaat di atas, baik D- xilulosa yang dihasilkan dari D-xilosa juga dapat dikonversi menjadi xilitol dengan bantuan enzim xilitol dehidrogenase. Gula xilitol merupakan gula poliol dengan 5 rantai karbon, yang sangat baik untuk kesehatan. Xilitol dapat digunakan sendiri atau dikombinasikan dengan pemanis nonkariogenik untuk membuat produk-produk seperti permen karet, chewing gum, dan lain-lain. Di samping itu xilitol saat ini banyak digunakan untuk pasta gigi karena dapat menguatkan gusi. Selain xilitol, contoh lain dari rare sugar adalah D-lixosa, yang diketahui berpotensi sebagai bahan produksi obat antitumor dan agen imunostimulatori untuk terapi kanker (Morita et al, 1996).

2.6. Mikrobiologi Industri

Penentuan produk industri menggunakan jasa mikroorganisme sangat tergantung dari sifat-sifat mikroorganisme yang dipilih. Mikroorganisme yang dipilih harus memenuhi kriteria-kriteria: memiliki sifat-sifat yang stabil, mampu

(17)

tumbuh pesat, tidak patogenik, memiliki sifat potensial menjamin proses biotransformasi berlangsung sesuai dengan tujuan yang diharapkan. Mikroorganisme yang terpilih ini berupa galur-galur unggul. Sedangkan penentuan media dan bagian pengendali proses lainnya disesuaikan dengan spesifikasi sifat mikroorganisme serta enzim-enzimnya. Macam-macam tipe produk industri dari mikroorganisme antara lain : sel-sel mikroorganisme itu sendiri sebagai produk yang dikehendaki, enzim-enzim yang dihasilkan mikroorganisme, metabolit dari mikroorganisme.

Selanjutnya pembahasan mikrobiologi industri meliputi beberapa contoh proses pembuatan produk industri menggunakan jasa mikroorganisme antara lain industri minuman beralkohol, industri sirup fruktosa tinggi, produksi asam amino, produksi asam sitrat, produksi asam glutamat, produksi obat pengendali hama, produksi antibiotika, produksi vaksin rekombinan.

Mikroorganisme yang akan digunakan dalam penelitian ini adalah L.pentosus sebagai bakteri sumber gen xylA dan E.coli sebagai bakteri inang dalam proses kloning gen xylA.

1. Lactobacillus pentosus

Taksonomi

Filum : Firmicutes Kelas : Bacilli

Ordo : Lactobacillales Familia : Lactobacillaceae Genus : Lactobacillus

(18)

Spesies : Lactobacillus pentosus

Genus Lactobacillus merupakan bakteri yang mampu memproduksi sejumlah asam laktat dari karbohidrat sederhana. Secara morfologik bakteri ini berbentuk batang positif Gram dan tidak bergerak. Lactobacillus memerlukan zat makanan yang cukup kompleks, dan kebanyakan strain tidak dapat tumbuh pada perbenihan biasa kecuali ada penambahan glukosa atau whey (Syahrurachman et al, 1994).

L.pentosus merupakan bakteri fakultatif heterofermentatif yang digunakan

dalam fermentasi sayur–sayuran seperti mentimun dan kubis. Tidak seperti kebanyakan jenis Lactobacillus lainnya, L.pentosus dapat menggunakan xilosa sebagai sumber energi. L.pentosus adalah bakteri asam laktat yang memiliki perangkat gen terkait dengan metabolisme gula heksosa maupun pentosa. Pada organisme ini, tiga jenis gen terlibat dalam katabolisme D-xilosa, menyandikan enzim D-xilosa isomerase (xylA), D-xilosa kinase (xylB), dan protein regulator (xylR) (Lokman et al, 1994).

2. Escherichia coli

Taksonomi

Filum : Proteobacteria

Kelas : Gammaproteobacteria Ordo : Enterobacteriales Familia : Enterobacteriaceae Genus : Escherichia Spesies : Escherichia coli

(19)

E.coli adalah salah satu jenis spesies utama bakteri gram negatif yang banyak ditemukan di dalam usus besar manusia sebagai flora normal (Syahrurachman et al, 1994). Pada umumnya, bakteri yang ditemukan oleh Theodor Escherich ini hidup pada tinja, dan dapat menyebabkan masalah kesehatan pada manusia, seperti diare, muntaber dan masalah pencernaan lainnya (Wikipedia, 2007). E.coli banyak digunakan dalam teknologi rekayasa genetika. Biasa digunakan sebagai vektor untuk menyisipkan gen-gen tertentu yang diinginkan untuk dikembangkan. E.coli dipilih karena pertumbuhannya sangat cepat dan mudah dalam penanganannya. Selain itu E.coli merupakan organisme yang paling dipahami pada taraf molekular dan organisme pilihan bagi banyak ahli genetika karena lebih mudah untuk mempelajarinya (Pelczar, 1986).

(20)

BAB III

METODE PENELITIAN

3.1. Waktu dan Tempat Penelitian

Penelitian dilaksanakan dari bulan Februari-Desember 2008 di Laboratorium CBRG (Carbohydrate and Bioengineering Research Group) Pusat Penelitian Bioteknologi Lembaga Ilmu Pengetahuan Indonesia (LIPI), Cibinong, Bogor, Jawa Barat.

3.2. Bahan dan Alat 3.2.1. Bahan

Media MRS Broth (oxoid) sebagai media tumbuh L.pentosus, Media LB (Luria Bertani) sebagai media tumbuh E.coli DH5 , L.pentosus sebagai bakteri sumber gen xylA (wild type, National Institute of Technology and Evaluation Biological Resource Center, NITE-BRC, Jepang) . E.coli DH5 sebagai bakteri inang dalam kloning, Lisozim, Buffer TE (Tris-EDTA), Genomic DNA

Purification Kit (Fermentas), EtOH 70% dan 100%, Enzim RNAse, Kertas

Parafilm, Agarose Gel 1%, Buffer TBE 1x, buffer loading dye, EtBr (Ethidium

Bromide), Primer forward

(5’GGATCCTATGACGAATGAGTATTGGCAAGG3’) dan primer reverse (5’TCTCGAGCTTGCTTAACGTCTC3’) (Eurogentec AIT), PCR Kits (Fermentas), Gene Ruler 1kb DNA Ladder (Fermentas), EZ-10 Spin Column

Products Purification Kit (BIO BASIC INC), T4 DNA ligase (Fermentas),

Larutan B (50 mM CaCl2 dan 10 mM Tris-HCl pH 8), Ampisilin 50µ g/ml,

(21)

IPTG (Isopropyl- -D-thiogalactopyranoside) 100mM (Fermentas), X-Gal (5 bromo-4 kloro-3 indolil- -D-galaktopiranosid) Solution 50µ g/µ l (Fermentas), Larutan I (1 M Tris-HCl pH 8; 0,5 M EDTA pH 8;1 M glukosa), Larutuan II (NaOH 10 N; SDS 10%; dalam aquades), dan Larutan III (5 M kalium asetat; asam asetat glasial dalam aquades) yang akan digunakan dalam proses isolasi plasmid, Enzim Restriksi EcoRI (Fermentas) yang akan digunakan dalam proses digesti, Plasmid pGEM-T Easy vector system (Promega) yang akan digunakan dalam kloning.

3.2.2. Alat

Software Bioinformatika (Genamics Expression, DNA Calculator, BioEdit

versi 7.04 dan Software FastPCR in silico), Genebank NCBI (National Center for

Biotechnology Information), Erlenmeyer 100ml dan 250ml (Pyrex), Gelas Ukur

50ml dan 100ml (Pyrex), Spatula, Timbangan Analitik (Precisa 310M), Hot Plate (Thermolyne), Cawan Petri, Tabung Reaksi (Pyrex), Autoklaf (All American), Jarum Ose, Spreader, Bunsen Burner, Laminar Air Flow (ESCO), Mikropipet ukuran 10 l, 100 l, 200 l, 1000 l dan 5000 l (Gilson Pipetman), Tip Mikropipet ukuran 10 l, 200 l, dan 1000 l (Axygen), Tabung eppendorf ukuran 250 l dan 1500 l (Axygen), Waterbath, Sentrifuge (Biofuge Fresco), Vortex (Fisons), Timer (Force), Oven 37ºC dan 150ºC (Heraeus Instrument), Perkin Elmer GeneAmp®

PCR System, Magnetic Stirer, Inkubator Shaker (New Brunswick Scientific),

Vacum Dry (Savant), Lemari Es 4ºC (Hitachi) dan -20ºC (Jouan), Perangkat

Elektroforesis (Mupid eXu), kamera digital (Canon PowerShot A470), Ruang asam.

(22)

3.3. Prosedur Kerja 3.3.1. Studi Bioinformatika

Studi Bioinformatika dimulai dengan pencarian sekuens basa nukleotida dan rangkaian asam amino dari bakteri sumber gen xylA L.pentosus melalui

Genebank online NCBI (National Center for Biotechnology Information). Selain

itu dengan menggunakan program BLAST (Basic Local Allignment Search Tool) pada Genebank tersebut, maka akan diketahui beberapa bakteri yang memiliki gen

xylA (selain L.pentosus) lengkap dengan sekuens basa nuklotida dan rangkaian

asam aminonya, sehingga dapat diketahui tingkat homologi antar bakteri yang memiliki gen xylA.

3.3.2. Desain Primer

Desain primer dibuat dari sekuens gen xylA L.pentosus dengan menggunakan program Genamics Expression (Lampiran 6) dan dikalkulasi dengan DNA calculator online (Lampiran 9) untuk mengetahui potensial pembentukan hairpin dan self-annealing primer. Software FastPCR in silico (Lampiran 8) digunakan untuk memprediksi produk PCR berdasarkan primer yang telah didesain dan untuk mengetahui spesifikasi primer.

3.3.3. Preparasi a. Sterilisasi

Bahan dan alat yang akan digunakan dalam penelitian dicuci bersih dan disterilisasi. Cara sterilisasi yang digunakan yaitu metode sterilisasi kering dengan menggunakan oven pada suhu 150°C selama 2 jam dan metode sterilisasi basah dengan menggunakan autoklaf dengan suhu 121°C pada tekanan 1 atm selama 30 menit.

(23)

b. Pembiakan Bakteri

Biakan L.pentosus dikultur dalam media MRS (Oxoid) dan diinkubasi

pada suhu 37 C selama 24 jam secara anaerobik. Biakan E.coli dikultur dalam media LB (Luria Bertani) dan diinkubasi dalam inkubator shaker 150 rpm pada

suhu 37°C selama 16 jam. 3.3.4. Isolasi Genom

Proses isolasi genom akan dilakukan dengan menggunakan Genomic DNA

Purification Kit dari Fermentas. Kultur L.pentosus sebanyak 1,5 ml dalam media

cair dipindahkan ke dalam tabung steril dan disentrifugasi dengan kecepatan 12.000 rpm selama 5 menit pada suhu ruang. Pelet yang didapatkan dari perlakuan tersebut ditambahkan dengan 200µl buffer TE, divorteks dan dibolak-balik hingga homogen. Larutan ditambah 400µl lysis solution dan diinkubasi dalam waterbath 65oC selama 10 menit. Setelah itu ditambahkan 600µl kloroform, dibolak-balik 3- 5 kali dan disentrifugasi dengan kecepatan 12000 rpm selama 5 menit pada suhu ruang.

Fase paling atas (Upper Aqueus Layer) diambil, dipindahkan ke tabung 1,5ml baru, ditambah 800µl larutan presipitasi, dibolak-balik selama 2 menit dan disentifugasi dengan kecepatan 12000 rpm selama 5 menit pada suhu ruang. Larutan kemudian ditambahkan 100µl larutan NaCl, divorteks dan ditambahkan 300µl EtOH 100%.

Larutan diinkubasi selama 2 jam pada suhu -20oC. Setelah itu disentrifugasi dengan kecepatan 12000 rpm selama 5 menit pada suhu ruang, supernatan dibuang dan pelet dikeringkan dengan pengering vakum. Pelet ditambah 30 µ l larutan RNAse dalam buffer TE dan diinkubasi pada suhu 37oC

(24)

selama 1 jam. Hasil isolasi genom dicek dengan elektroforesis menggunakan agarosa 1% dalam buffer TBE dan Gene Ruler 1kb DNA Ladder sebagai penanda (marker) dan divisualisasi di bawah sinar UV.

3.3.5. Kloning Gen xylA

a. Amplifikasi Sekuens DNA Target dengan Metode PCR

Amplifikasi sekuens xylA dilakukan dengan menggunakan DNA Cloning

Kit dari fermentas. Campuran reaksi PCR dibuat dalam volume 50µl dan

[image:24.612.114.503.223.510.2]

disesuaikan dengan rekomendasi dari produsen untuk tujuan optimasi. Komposisinya adalah sebagai berikut:

Tabel 1. Komposisi Reaksi PCR

Komposisi dalam Reaksi PCR Konsentrasi Akhir

Volume yang Ditambahkan

Larutan dNTPmix 10mM 0,2 mM 5 µl

Larutan MgCl2 25mM 2 mM 4 µl

Primer forward 100 µM 2 µ M 1 µl

Primer reverse 100 µM 2 µ M 1 µl

10 x buffer Taq DNA polymerase 1 x 5 µl

Taq DNA Polymerase 1,25 u/50µ l 0,25 µl

DNA template 1 ng 1 µl

dH2O - 32,75 µ l

Volume Total 50 µl

Semua komponen PCR tersebut disiapkan di atas es dalam sebuah tabung PCR ukuran 250µl dan komponen larutan dalam tabung PCR dicampur hingga homogen, lalu disentrifugasi hingga seluruh larutan terbawa ke dasar tabung. Tabung PCR kemudian diletakkan ke dalam thermocycler otomatis (Perkin Elmer

GeneAmp® PCR System).

Proses PCR akan dilakukan dengan kondisi sebagai berikut:

(25)
[image:25.612.115.507.76.561.2]

Tabel 2. Kondisi Reaksi PCR

Kondisi reaksi PCR Suhu (°C) Waktu

Denaturasi awal (Initial Denaturation) 94 2 menit

Denaturasi (Denaturation) 94 30 detik

Penempelan primer (Primer Annealing) 52 30 detik

Pemanjangan (Extending) 72 1 menit

Akhir pemanjangan (Final extending) 72 7 menit Sebanyak 35 siklus

Cek hasil PCR dilakukan dengan elektroforesis menggunakan gel agarosa 1% dalam buffer TBE dan Gene Ruler 1kb DNA Ladder.

b. Purifikasi Produk PCR

Proses purifikasi akan dilakukan dengan menggunakan Gel Extraction Kit dari Bio Basic Inc. Produk PCR sebanyak 40µl ditambah dengan 120 µl Binding

buffer II dibolak-balik dan dimasukkan dalam EZ-10 Column+Collection tube

lalu didiamkan selama 2 menit pada suhu ruang. Proses sentifugasi dilakukan dengan kecepatan 10.000 rpm selama 1 menit pada suhu ruang. Supernatan dipindahkan dari Collection tube dan ditambahkan 500µl Wash solution kemudian dilakukan sentrifugasi dengan kecepatan 10.000 rpm selama 1 menit pada suhu ruang. Supernatan dipindahkan dari Collection tube dan dilakukan sentrifugasi dengan kondisi yang sama. EZ-10 Column dipindahkan dari Collection tube ke tabung steril dan ditambahkan dengan 30µl Elution buffer tepat di tengah-tengah kolom. Campuran di dalam tabung diinkubasi pada suhu ruang selama 2 menit dan dilakukan sentrifugasi dengan kecepatan 10.000 rpm selama 2 menit pada suhu ruang.

c. Ligasi Produk PCR ke dalam Plasmid pGEM-T Easy

Proses ligasi dilakukan dengan menggunakan T4 DNA Ligase dari Fermentas. Komposisi reaksi ligasi sebagai berikut:

(26)
[image:26.612.119.508.82.517.2]

Tabel 3. Komposisi Reaksi Ligasi

Komposisi dalam Reaksi Ligasi Volume yang Ditambahkan

Produk PCR (50 ng/ L) 7 L

Plasmid pGEM-T Easy (50 ng/ L) 1 L

2x Rapid Ligation Buffer 9 µ L

Enzim T4 DNA Ligase (3 weiss units/ L) 1 µ L

Volume total 18 µ L

Masing-masing komposisi dimasukkan dalam tabung 1,5 ml. Proses pencampuran dilakukan di atas es. Setelah semua larutan berada dalam kondisi homogen, maka akan dilakukan inkubasi pada suhu 4°C selama 24 jam.

d. Sel Kompeten E.coli DH5 dan Transformasi Plasmid Rekombinan ke dalam Bakteri Inang E.coli DH5

Persiapan sel kompeten E.coli DH5 dilakukan dengan metode CaCl2. Hasil kultur E.coli DH5 sebanyak 3 mL yang telah diinkubasi 37°C , 200 rpm

Overnight, diambil 500µl kemudian dimasukkan ke dalam media LB 50 mL, lalu

diinkubasi kembali pada 37°C, 200 rpm selama 3 jam hingga nilai OD 0,6-1.

Selanjutnya kultur E.coli DH5 tersebut dipindahkan ke dalam tabung sorval dan diinkubasi 10 menit di atas es. Kemudian disentrifugasi dengan kecepatan 3500 rpm selama 15 menit pada suhu 4°C. Pelet yang didapat ditambahkan dengan 20 mL larutan B dan dicampurkan hingga pelet lepas. Kemudian diinkubasi selama 30 menit di atas es lalu disentrifugasi kembali dengan kecepatan 3500 rpm selama 15 menit pada suhu 4°C. Pelet diambil dan dicampurkan dengan 2 mL larutan B, divorteks dan diinkubasi kembali diatas es selama 15 menit sebelum digunakan untuk proses tranformasi selanjutnya. Proses transformasi akan dilakukan dengan metode Heat Shock menurut Sambrook et al (1989). Prosedur kerjanya sebagai berikut:

(27)

Ligation mix (baik untuk produk PCR maupun kontrol) sebanyak 4µ l ditambah dengan sel kompeten E.coli DH5 sebanyak 50µl dimasukkan dalam tabung steril 1,5 ml dan dilakukan proses inkubasi selama 30 menit dalam es.

Heat Shock dilakukan pada suhu 42°C dalam waterbath selama 100 detik dan

secara cepat langsung diinkubasi dalam es selama 2 menit. Media LB sebanyak 950µl ditambahkan ke dalam campuran dan dilakukan inkubasi dalam inkubator

shaker dengan kecepatan 150 rpm selama 2 jam pada suhu 37°C. Hasil

transformasi sebanyak 40µl dipindah ke dalam media LB padat yang telah diberi antibiotik ampisilin, IPTG dan X-Gal solution. Proses inkubasi akan dilakukan selama 16 jam pada suhu 37°C.

e. Isolasi Plasmid pGxylA dari Bakteri Rekombinan E.coli DH5

Persiapan dilakukan dengan mengisolasi koloni tunggal yang berwarna putih dari bakteri rekombinan E.coli DH5 pada medium LB padat yang telah ditambahkan ampisilin menggunakan tip steril. Koloni tunggal diambil dengan menggunakan tip steril dan dipindahkan ke dalam tabung reaksi yang berisi 3 ml medium LB cair yang telah ditambahkan ampisilin. Inkubasi dilakukan dengan menggunakan inkubator shaker kecepatan 250 rpm selama 16 jam pada suhu 37oC.

Proses isolasi plasmid dimulai dengan melakukan sentrifugasi kecepatan 10.000 rpm pada suhu 4oC selama 10 menit terhadap kultur bakteri yang telah dipindahkan ke dalam tabung 1,5ml steril hingga didapatkan pelet pada dasar tabung. Pelet ditambah dengan larutan I sebanyak 100µl, divorteks hingga homogen dan diinkubasi dalam es selama 5 menit. Larutan ditambah dengan larutan II sebanyak 200µ l, dibolak-balik hingga keruh dan diinkubasi dalam es

(28)

selama 5 menit. Larutan ditambah dengan larutan III sebanyak 150µl, dibolak- balik hingga terbentuk endapan putih dan diinkubasi dalam es selama 5 menit. Sentrifugasi dilakukan dengan kecepatan 10.000 rpm selama 10 menit pada suhu 4oC.

Supernatan yang diperoleh dipindahkan ke tabung steril 1,5 ml dan ditambah etanol 100% sebanyak 900µl. Larutan divorteks hingga homogen dan diinkubasi pada suhu ruang selama 2 menit. Larutan disentrifugasi dengan kecepatan 12.000 rpm selama 10 menit pada suhu 4oC. Supernatan dibuang, pelet dikeringkan dan ditambah dengan etanol 70% (dingin) sebanyak 1ml. Larutan divorteks hingga endapan lepas dan disentrifugasi dengan kecepatan 12.000 rpm

selama 5 menit pada suhu 4oC. Supernatan dibuang, pelet yang diperoleh dikeringkan dengan pengering vakum dan dilarutkan dengan 30µl larutan RNAse dalam buffer TE serta diinkubasi pada suhu 37oC selama 1 jam.

f. Pemotongan (Digesti) Plasmid pGxylA dengan Enzim Restriksi

[image:28.612.115.507.188.650.2]

Proses ini dilakukan dengan menggunakan enzim restriksi EcoRI dari Fermentas. Komposisi reaksi dalam volume 5µl adalah sebagai berikut:

Tabel 4. Komposisi Reaksi Enzim Restriksi EcoRI

Komposisi dalam Reaksi Volume yang Ditambahkan Enzim 10 x EcoRI 0,5 µ L Buffer 10 x EcoRI 0,5 µ L

Plasmid pGxylA 4 µ L

Volume total 5 µ L

Campuran dimasukkan dalam tabung steril 250µl dan diinkubasi pada

waterbath 37°C selama 2 jam. Cek hasil digesti plasmid pGxylA dilakukan

(29)

dengan elektroforesis menggunakan agarose 1% dalam buffer TBE dan Gene

Ruler 1kb DNA Ladder Marker.

g. Elektroforesis dengan Gel Agarosa

Dilarutkan 5 gr bubuk agarosa ke dalam tabung erlenmeyer yang telah berisi 50ml larutan buffer TBE, kemudian dipanaskan campuran hingga semua agarosa larut dan larutan menjadi bening. Didinginkan larutan hingga mencapai suhu 60°C, selanjutnya dipasang sisir pembentuk sumur di atas tempat pencetak gel, lalu secepatnya larutan agarosa yang hangat dituang ke dalam cetakan. Dipastikan jangan sampai ada gelembung udara di bawah atau diantara ruas-ruas dari tempat pencetak gel. Dibiarkan gel mengeras (sekitar 30-40 menit pada suhu ruang), lalu diangkat sisir pembentuk sumur dan diletakan gel pada tangki elektroforesis dan ditambahkan larutan buffer TBE sampai larutan buffer menutupi seluruh permukaan gel. Dicampur 5µ l DNA dengan 1µl buffer loading dye, lalu dibuat campuran untuk penanda (1µl buffer loading dye, 4µl akuades, 1µl Gene Ruler 1kb DNA Ladder Marker). Dimasukkan campuran-campuran tersebut ke dalam sumur pada gel secara perlahan dengan menggunakan mikropipet ukuran 10µ l. Selanjutnya ditutup tangki elektroforesis dengan penutupnya kemudian dihubungkan dengan arus listrik pada tegangan 135 volt selama 20 menit. Setelah itu, dilakukan pewarnaan gel dengan Et-Br.

h. Pewarnaan Gel dengan Ethidium Bromida (Et-Br) dan Pemotretan dengan Sinar Ultra

Violet (UV).

Direndam gel dalam air yang mengandung Et-Br (0,1µl/ml) selama 30-45 menit pada suhu ruang. Selanjutnya dilakukan pemotretan gel dengan

(30)

menggunakan sinar ultra violet, yang perlu diperhatikan pada tahap ini adalah

digunakan pelindung mata untuk menahan sinar UV karena radiasi sinar UV

sangat berbahaya. Lalu hasil floresensi pita-pita difoto dengan menggunakan

(31)

30

BAB IV

HASIL DAN PEMBAHASAN

4.1. Bakteri Sumber Gen

Bakteri yang dipilih sebagai bakteri sumber gen adalah L

.pentosus

yang diperoleh

dalam bentuk

wild type

(NITE-BRC, Jepang). Bakteri tersebut merupakan kelompok

Bakteri Asam Laktat (BAL) yang memiliki perangkat gen terkait dengan metabolisme

gula heksosa maupun pentosa. Pada organisme ini, tiga jenis gen terlibat dalam

katabolisme D-xilosa, menyandikan enzim D-xilosa isomerase (

xylA)

, D-xilosa kinase

(xylB)

, dan protein regulator

(xylR).

Untuk mengetahui sekuens DNA dan asam amino

dari bakteri sumber gen maka dilakukan penelusuran melalui pendekatan bioinformatika

yang dilengkapi dengan perangkat internet

online

, yaitu dengan menggunakan data

Genebank

yang diakses secara bebas dari

website

NCBI (

National Center for

[image:31.612.90.524.249.713.2]

Biotechnology Information

) pada situs http://www.ncbi.nlm.nih.gov/ BLAST.

(32)
(33)
[image:33.612.113.512.64.318.2]

Gambar 4. Sekuens asam amino yang disandikan oleh gen

xylA

Pemilihan bakteri L

.pentosus

sebagai bakteri sumber gen juga karena bakteri ini

tidak bersifat patogen dan telah direkomendasikan secara umum memiliki status GRAS

Bacteria

(

Generally Recognized As Save Bacteria

) artinya suatu bakteri yang aman untuk

digunakan. Berdasarkan data yang diberikan dari

Genebank

dapat diketahui gen

xylA

mempunyai panjang 1350 pasangan basa (Gambar 3) dan menyandikan 450 asam amino

(Gambar 4).

4.2. Isolasi Genom

Isolasi genom menggunakan bahan-bahan

Genomic DNA Purification Kit

dari

Fermentas. Isolasi genom diawali dengan penghancuran dinding sel, pemusnahan protein,

dan juga RNA sehingga hanya tertinggal DNA dalam bentuk murni. L

.pentosus

merupakan bakteri gram positif, yang memiliki kandungan peptidoglikan yang lebih tebal

pada dinding selnya dan untuk menghancurkannya maka dilakukan secara kimiawi yaitu

dengan memanfaatkan lisozim yang berasal dari putih telur, karena lisozim dapat

mendigesti senyawa polimerik yang menyebabkan kekakuan dinding sel, kemudian lisis

disempurnakan dengan penambahan larutan

lysis solution

(Kits Fermentas) berfungsi

(34)

untuk menghilangkan ion magnesium yang penting dalam mempertahankan keseluruhan

struktur selubung sel serta untuk menghambat kerja enzim selular yang dapat merusak

DNA, dan untuk membantu menghilangkan molekul lipid.

lysis solution

mengakibatkan

sel mengalami lisis. Pecahan (debris) sel yang timbul dibersihkan dengan cara

sentrifugasi, sehingga yang tertinggal hanya molekul nukleotida (DNA dan RNA).

Untuk mendapatkan kemurnian yang tinggi dari DNA yang dihasilkan, tahap yang paling

penting adalah penghilangan molekul pengotor yang tidak diinginkan. Protein yang

merupakan pengotor utama dalam ekstraksi DNA dari bakteri dihilangkan dengan

penambahan kloroform yang dapat menyebabkan presipitasi protein, namun DNA dan

RNA tetap masih ada. Selanjutnya untuk mendapatkan DNA yang murni, maka harus

menghilangkan RNA dengan menggunakan enzim RNAse yang dapat memecah molekul

RNA menjadi subunit ribonukleotida.

Berdasarkan data yang diperoleh dari

Genebank

, ukuran genom L

.pentosus

belum

diketahui secara keseluruhan. Perkiraan kasar ukuran genom dilakukan dengan

elektroforesis menggunakan gel agarosa yang divisualisasi di bawah sinar UV setelah

pewarnaan Et-Br. Posisi pita isolat genom L

.pentosus

berada pada ukuran di atas 10.000

pb ukuran marker. Genom ini membentuk konformasi superkoil, sehingga molekul-

molekul DNA pada genom mudah dipisahkan dengan elektroforesis gel agarosa karena

mempunyai mobilitas yang tinggi (Watson,

et al

. 1992).

(35)
[image:35.612.91.527.46.511.2]

Gambar 5. Hasil isolasi genom, (M)

GeneRuler

1 Kb

DNA Ladder Marker

;

(S1&S2) Isolat genom L

.pentosus

Terlihat pada gambar 5, isolat genom S2 memiliki intensitas lebih tebal

dibandingkan dengan isolat genom S1, maka isolat genom S2 yang selanjutnya

digunakan sebagai DNA cetakan pada proses amplifikasi DNA target dengan metode

PCR.

4.3. Ampilifikasi DNA Target (

xylA

) dengan PCR

Proses PCR menggunakan DNA cetakan hasil dari isolasi genom dan

menggunakan komponen

PCR Kits Fermentas.

Primer yang digunakan dalam PCR ada

dua macam yaitu primer

forward

dan primer

reverse.

Agar memperoleh produk PCR

yang spesifik maka dilakukan analisa pada kedua primer tersebut dengan menggunakan

Software

Bioinformatika (

Genamics Expression

,

BioEdit

versi 7.04 dan

DNA Calculator

)

dengan parameter – parameter tertentu (Lampiran 6, 7 dan 9) dan penambahan situs

enzim restriksi yang akan digunakan, maka dipilih pasangan primer terbaik yaitu :

1. Primer

forward

: 5’ GGATCCTATGACGAATGAGTATTGGCAAGG 3’

2. Primer

Reverse

: 5’ TCTCGAGCTTGCTTAACGTCTC 3’

(36)

Pada primer

forward

ditambahkan situs pemotongan enzim restriksi

BamHI

(G GATCC), sedangkan pada primer

reverse

ditambahkan situs pemotongan enzim

restriksi

XhoI

(CTC GAG). Kedua enzim tersebut dipilih karena diketahui tidak

memotong sekuens gen

xylA

dari L.

pentosus

(Lampiran 7)

.

Hasil uji

in silico

kedua

primer tersebut dengan

software

FastPCR menunjukkan hasil produk PCR dengan

panjang 1361 pb (Lampiran 8).

Pada penelitian ini satu siklus PCR terdiri atas tiga tahapan, yaitu denaturasi,

annealing

dan ekstensi. Pradenaturasi dilakukan selama 2 menit dan pada suhu 94

o

C

sebanyak satu kali. Untuk tahap denaturasi dilakukan selama 30 detik pada suhu 94

o

C,

tahap

annealing

dilakukan selama 30 detik pada suhu 52

o

C , dan tahap ekstensi dilakukan

selama 1 menit pada 72

o

C. Jumlah siklus yang dilakukan adalah 35 siklus. Pada siklus

terakhir dilakukan pemanjangan waktu ekstensi selama 7 menit. Penentuan utama

keberhasilan proses amplifikasi gen biasanya adalah suhu

annealing

, yaitu suhu saat

primer melekat pada DNA cetakan, sedangkan suhu denaturasi dan ekstensi pada

umumnya tetap. Penetapan suhu

annealing

secara teoritis biasanya 5-10

o

C dibawah nilai

[image:36.612.249.355.528.675.2]

suhu leleh

(Temperatur Melting

, Tm) dari kedua primer. Produk PCR ditunjukkan pada

gambar berikut :

Gambar 6. Hasil amplifikasi gen

xylA

dengan reaksi PCR

(37)

Dari gambar 6 terlihat bahwa amplifikasi gen

xylA

dengan reaksi PCR telah

berhasil dilakukan dan ditunjukkan dengan adanya pita spesifik yang terletak pada

ukuran di antara 1000 pb dan 1500 pb. Pita yang tampak pada gambar 6 merupakan

produk PCR, hasil ini diprediksi merupakan pita gen

xylA

dari L.

pentosus

. Hasil PCR ini

sesuai dengan prediksi menggunakan

software

FastPCR

in silico

(Lampiran 8) yaitu

dengan panjang 1361 pb, kemudian selanjutnya dilakukan purifikasi dengan

menggunakan

Gel Extraction Kit

dari Bio Basic Inc.

4.4. Ligasi dan Transformasi

Produk PCR

xylA

diligasikan dengan plasmid pGEM-T

Easy

yang mengandung

gen

lacZ

membentuk plasmid rekombinan pGxylA, kemudian ditransformasikan ke

dalam bakteri inang E

.coli

DH5 . Ligasi dilakukan dengan mencampurkan sekuen gen

yang akan disisipkan dengan plasmid dengan perbandingan molar 3:1 (Lampiran 3).

Untuk mengetahui efisiensi transformasi digunakan kontrol transforman berupa plasmid

sirkular utuh yang tidak terpotong. Sel kompeten E

.coli

DH5 disisipkan dengan

menggunakan metode CaCl

2

. Transformasi dilakukan dengan metode

Heat Shock

(kejut

panas), yaitu dengan melakukan perubahan suhu secara ekstrim. Metode ini dipilih

karena prosesnya lebih mudah dan efisien, ketika kejut panas dilakukan, membran sel

yang pada awalnya dalam keadaan dingin akan menjadi tidak selektif ketika terjadi

lonjakan panas sehingga menyebabkan plasmid dapat masuk ke dalam bakteri.

(38)

A

B

C

Gambar 7. (A) kontrol positif terhadap E.

coli

DH5 yang terinsersikan plasmid kosong,

(B) kontrol negatif terhadap E

.coli

DH5 , (C) Transforman bakteri rekombinan

Proses transformasi kali ini menggunakan kontrol transformasi yaitu kontrol

positif terhadap E.

coli

DH5 yang tersisipkan plasmid kosong dan kontrol negatif

terhadap E.

coli

DH5 yang tidak tersisipkan plasmid. Keberhasilan transforman dapat

dilihat pada gambar 7(A) dan 7(C) dengan tumbuhnya koloni pada media LB padat yang

telah mengandung ampisilin. Hal ini dikarenakan, plasmid yang digunakan memiliki gen

resistensi terhadap ampisilin, sehingga yang dapat tumbuh adalah hanya sel yang tersisipi

plasmid. Sedangkan E.

coli

DH5 yang tidak tersisipkan plasmid ditunjukkan pada

gambar 7(B), tidak dapat tumbuh pada media LB yang telah mengandung ampisilin.

Bakteri rekombinan yang mengandung plasmid pGxylA yang tumbuh, kemudian

ditumbuhkan pada media seleksi, yaitu media LB padat dengan penambahan antibiotik

ampisilin, IPTG dan X-Gal. Adanya X-Gal dan IPTG akan menghasilkan koloni biru dan

putih. Koloni bakteri yang putih diisolasi karena mengandung pGEM-T

Easy

rekombinan. Bakteri yang mengandung pGEM-T

Easy

rekombinan tidak mampu

menghasilkan –galaktosidase karena gen

lacZ

telah rusak akibat tersisipi oleh fragmen

gen

xylA

, sehingga X-Gal tidak dapat diuraikan dan koloni tetap berwarna putih,

sedangkan koloni yang mengandung pGEM-T

Easy

non rekombinan akan berwarna biru

[image:38.612.99.523.53.205.2]
(39)

karena gen

lacZ

yang menyandikan -galaktosidase masih aktif dan mengubah substrat

X-Gal yang tidak berwarna menjadi biru.

4.5. Isolasi Plasmid

DNA plasmid pGEM-T

Easy

rekombinan yang telah dikloning ke E.

coli

DH5

diisolasi menggunakan lisis dengan metode lisis alkali. Dari hasil transformasi, sebanyak

70 koloni bakteri putih dikultur dalam media cair LB yang telah ditambahkan ampisilin

[image:39.612.101.505.265.496.2]

dan terbagi atas 14 tabung, dengan hasil isolasi plasmid pGxylA sebagai berikut :

Gambar 8. Hasil isolasi plasmid pGxylA

Dari hasil isolasi plasmid pGxylA menggunakan elektroforesis dapat diketahui

bahwa semua sampel yang berjumlah 14, secara kasar terlihat ada beberapa pita pada

ukuran sekitar 2500 pb, 3000 pb, dan diatas 1 Kb (Gambar 8). Hal ini menunjukkan

bahwa plasmid pGxylA berhasil diisolasi, selanjutnya hasil isolasi plasmid pGxylA

tersebut dipotong dengan menggunakan enzim restriksi

EcoRI

untuk mengetahui

keberhasilan ligasi fragmen gen

xylA

ke dalam plasmid pGEM-T

Easy

.

(40)
[image:40.612.141.471.72.231.2]

Gambar 9. Peta ORF

xylA

yang di potong dengan enzim restriksi

EcoRI

Panjang produk PCR gen

xylA

adalah 1361 pb (Lampiran 8). Diketahui pada peta

situs pemotongan enzim restriksi gen

xylA

L.

pentosus

enzim restriksi

EcoRI

dapat

memotong gen

xylA

pada 2 tempat, yaitu pada posisi 269 pb dan 935 pb (Lampiran 7).

Maka bila hasil isolasi plamid pGxylA tersebut dipotong dengan enzim restriksi

EcoRI

akan terbagi menjadi 4 fragmen pita, yaitu pada ukuran 3018 pb (pGEM-T

Easy

), 666 pb,

419 pb, dan 276 pb (Gambar 10).

Gambar 10. Hasil plasmid pGxylA yang dipotong dengan enzim restriksi

EcoRI

[image:40.612.88.520.310.611.2]
(41)

Pada Gambar 10 terlihat bahwa dari 14 sampel hasil pemotongan

dengan enzim restriksi

EcoRI

, hanya pada sampel 3A yang positif

menghasilkan 4 fragmen pita pada ukuran-ukuran yang sesuai tersebut.

Hal ini menunjukkan proses ligasi fragmen gen

xylA

ke dalam plasmid pGEM-T

Easy

telah berhasil seperti yang diharapkan.

Fragmen pita- pita yang terbentuk pada sampel 3A dapat diprediksikan

bahwa fragmen pita-pita tersebut merupakan fragmen plasmid pGxylA

yaitu plasmid rekombinan antara plasmid pGEM-T

Easy

dan gen

xylA

.

Hingga tahap ini proses kloning gen

xylA

dari L.

pentosus

yang

ditranformasikan ke dalam bakteri inang E.

coli

DH5 berhasil

dilakukan. Dengan demikian, telah didapatkan kandidat klon positif yang

mengandung gen

xylA

. Penelitian

ini akan dilanjutkan ke arah pemurnian transforman dan

sequencing

urutan basa nukleotidanya untuk memastikan ketepatan sekuens gen

xylA

(42)

4

0

BAB V

KESIMPULAN DAN SARAN

5.1. Kesimpulan

Data yang diperoleh dari penelitian ini berupa data

kualitatif sehingga analisa data dilakukan secara deskriptif

berdasarkan hasil elektroforesis dari proses isolasi genom, produk

PCR, isolasi plasmid, dan digesti plasmid dengan menggunakan

enzim restriksi. Berdasarkan hasil analisa, dapat disimpulkan :

1. Isolasi gen

xylA

dari genom L.

pentosus

telah berhasil

dilakukan dengan teknik amplifikasi PCR menggunakan

sepasang primer (primer

forward

dan

primer reverse

) yang

telah didesain dengan perangkat bioinformatika.

2. Gen

xylA

berhasil diklon pada bakteri inang E.

coli

DH5

dengan menggunakan plasmid vektor pGEM-T

Easy

sebagai

vektor kloning. Kandidat klon positif yang mengandung gen

(43)

pasang basa yang telah dibuktikan sementara dengan

perlakuan enzim restriksi

EcoRI

yang menghasilkan 4

fragmen pita pada ukuran 3018 pb (pGEM-T

Easy

), 666 pb,

419 pb, dan 276 pb.

(44)

5.2. Saran

1. Perlu dilakukan pemurnian bakteri E.coli DH5 klon positif yang mengandung plasmid pGxylA hingga diperoleh fragmen gen xylA yang lebih spesifik dari bakteri klon E.coli DH5 dan selanjutnya dilakukan pengecekan dengan menggunakan enzim restriksi XhoI dan BamHI. 2. Perlu dilakukan sekuensing gen xylA untuk mengetahui sekuen gen

xylA dari E.coli DH5 yang kemudian

dibandingkan dengan sekuen gen xylA yang telah

dipublikasikan, dan untuk memastikan bahwa tidak adanya mutasi selain mutasi basa yang dilakukan secara sengaja sebelumnya.

Gambar

Gambar 1. Proses isomerasi untuk produksi sirup fruktosa
Gambar 2. proses isomerasi untuk produksi rare sugar
Tabel 1. Komposisi Reaksi PCR
Tabel 2. Kondisi Reaksi PCR
+7

Referensi

Dokumen terkait

Akibatnya makanan yang dikonsumsi sedikit atau asupan zat gizi berkurang (Lisdiana, 1998). Mengkombinasikan berbagai rasa sangat diperlukan dalam menciptakan keunikan sebuah

Objek yang digunakan dalam penelitian ini adalah penerapan e-faktur dan tingkat kepatuhan wajib pajak pada Kantor Pelayanan Pajak Pratama Palembang Seberang

[r]

 Area publik, yaitu area yang mempunyai akses langsung dengan lingkungan luar rumah sakit, misalkan ruang rawat jalan, gawat darurat, apotek.  Area semi publik, yaitu area

10.00 – 22.00 Festival Kuliner Pasar Seni Menyajikan menu dan jajak khas Kutai.. South Korea 09.00 - 17.00 Workshop

data pada data warehouse sesuai kebutuhan atau tujuan instansi/ perusahan. Selanjutnya dengan aplikasi data mining dapat diadapat data sesuai dengan

Berdasarkan uraian tentang partsipasi dari berbagai sumber data pustaka tersebut, maka prinsip yang dapat dirumuskan berkaitan dengan variabel partisipasi adalah: pelibatan

Pendidikan seks dipandang perlu untuk menjembatani rasa ingin tahu remaja tentang kematangan seksual mereka dengan informasi dan pengetahuan yang benar sehingga tidak mengarah