IDENTIFIKASI GEN CALPASTATIN (CAST RsaI) MENGGUNAKAN METODE PCR RFLP PADA SAPI PASUNDAN DI BPPT SAPI POTONG CIAMIS, JAWA BARAT AINA NADILA

60 

Teks penuh

(1)

IDENTIFIKASI GEN CALPASTATIN (CAST|RsaI)

MENGGUNAKAN METODE PCR – RFLP PADA SAPI

PASUNDAN DI BPPT SAPI POTONG CIAMIS, JAWA BARAT

AINA NADILA

PROGRAM STUDI BIOLOGI

FAKULTAS SAINS DAN TEKNOLOGI

UNIVERSITAS ISLAM NEGERI SYARIF HIDAYATULLAH

JAKARTA

(2)

IDENTIFIKASI GEN CALPASTATIN (CAST|RsaI)

MENGGUNAKAN METODE PCR – RFLP PADA SAPI

PASUNDAN DI BPPT SAPI POTONG CIAMIS, JAWA BARAT

SKRIPSI

Sebagai Salah Satu Syarat Memperoleh Gelar Sarjana Sains pada Program Studi Biologi Fakultas Sains dan Teknologi

Universitas Islam Negeri Syarif Hidayatullah Jakarta

AINA NADILA NIM 11140950000042

PROGRAM STUDI BIOLOGI FAKULTAS SAINS DAN TEKNOLOGI

UNIVERSITAS ISLAM NEGERI SYARIF HIDAYATULLAH JAKARTA

(3)
(4)
(5)
(6)
(7)

i

ABSTRAK

Aina Nadila. Identifikasi Gen Calpastatin (CAST|RsaI) Menggunakan Metode

PCR – RFLP pada Sapi Pasundan di Balai Pengembangan dan Perbibitan Ternak (BPPT) Sapi Potong Ciamis, Jawa Barat. Skripsi. Program Studi Biologi. Fakultas Sains dan Teknologi. Universitas Islam Negeri Syarif Hidayatullah. Jakarta. 2019. Dibimbing oleh Slamet Diah Volkandari dan Nani Radiastuti.

Sapi Pasundan merupakan salah satu sumber daya genetik lokal Indonesia yang dapat dimanfaatkan untuk pengembangan produk ternak berkualitas. Polimorfisme dalam gen CAST diketahui berperan dalam proses proteolisis dan keempukan daging. Penelitian ini bertujuan untuk mendeteksi keragaman gen

CAST pada populasi sapi Pasundan. Sampel yang digunakan adalah 30 sampel

darah sapi Pasundan yang berasal dari UPTD – BPPT Sapi Potong Ciamis, Jawa Barat. Deoxyribonucleotid Acid (DNA) sapi Pasundan diisolasi menggunakan metode garam pekat (high salt method) dan diamplifikasi menggunakan metode

Polymerase Chain Reaction (PCR) dengan suhu annealing 600C. Analisis gen

CAST dilakukan dengan metode PCR – RFLP menggunakan enzim restriksi RsaI,

yang memotong pada posisi 257 bp (substitusi G>C). Parameter yang diamati adalah frekuensi alel dan genotip, keseimbangan genetik Hardy – Weinberg, heterozigositas dan nilai Polymorphic Information Content (PIC). Hasil penelitian ini menunjukkan bahwa sebanyak 30 sampel DNA sapi Pasundan telah berhasil teramplifikasi pada gen CAST dengan ukuran 523 pb. Gen CAST bersifat polimorfik dengan tiga genotip (CC 3%, GC 50%, dan GG 47%), dan dua alel (C dan G). Frekuensi alel G (72%) lebih tinggi dibandingkan alel C (28%). Populasi sapi Pasundan berada dalam keseimbangan Hardy-Weinberg, heterozigositas teramati (Ho) lebih besar dibanding heterozigositas harapan (He) dan nilai PIC termasuk ke dalam kategori sedang. Marker gen CAST dapat digunakan sebagai marker genetik yang direkomendasikan untuk diasosiasikan dengan sifat keempukan daging pada sapi Pasundan.

Kata kunci: Gen Calpastatin, Keragaman Genetik, Metode PCR – RFLP, Polimorfik, Sapi Pasundan.

(8)

ii

ABSTRACT

Aina Nadila. Identification of Calpastatin Gene (CAST) Using Polymerase Chain Reaction – Restriction Fragment Length Polymorphism (PCR – RFLP) Method on

Pasundan Cattle in Bereau Seedstock and Development Beef Cattle (BSD-BC) of Ciamis, West Java. Undergraduate Thesis. Department of Biology. Faculty of Science and Technology. UIN Syarif Hidayatullah Jakarta. 2019. Advised by Slamet Diah Volkandari and Nani Radiastuti.

Pasundan breed cattle are one of Indonesian indigenous cattle that can be used for the development of qualified livestock. The polymorphism of CAST gene is known play a role in proteolysis and meat tenderness. The aim of this study was to detect the genetic variation of CAST gene in Pasundan cattle using PCR – RFLP method. Total of 30 Pasundan blood sample collected from BSD-BC of Ciamis, West Java. Deoxyribunucleic acid (DNA) of Pasundan cattle was extracted using high salt method and amplified using PCR method with annealing temperature at 600C. Genetic variants of CAST gene analyzed by using PCR – RFLP method and

RsaI restriction enzyme, that restricted at the position 257 bp (G>C substitution).

The observed parameters were genotypic and allelic frequency, Hardy – Weinberg equilibrium (HWE), heterozygosity and Polymorphic Information Content (PIC) value. Result showed that, total of 30 Pasundan cattle sample succcessfully amplified at CAST gene in length 523 base-pair (bp). The CAST gene in Pasundan cattle were polymorphic with three genotype (CC 3%, GC 50%, and GG 47%) and two allele (C and G). The Allelic frecuency of G (72%) higher than C (28%). The population of Pasundan cattle was in the Hardy – Weinberg equilibrium (HWE), observed heterozigosity (Ho) higher than expected heterozigosity (He) and PIC value was moderate. The CAST gene can be used as genetic marker that recommend to associate with meat tenderness in Pasundan cattle.

Key word: Calpastatin (CAST) gene, genetic diversity, PCR – RFLP method, polimorphic, Pasundan cattle.

(9)

iii

KATA PENGANTAR

Alhamdulillah, segala puji bagi Allah SWT., Tuhan penguasa alam dan Maha pemberi rahmat sehingga penulis diberikan kemudahan dalam menulis serta menyusun Skripsi ini Tidak lupa juga, penulis curahkan shalawat serta salam kepada Sang pemimpin umat Muhammad SAW, yang telah memimpin manusia menuju jalan yang diridhoi Allah SWT. Atas berkat rahmat Allah SWT yang Maha Esa. Skripsi dibuat untuk memenuhi syarat perkuliahan di Jurusan Biologi Fakultas Sains dan Teknologi Universitas Islam Negeri (UIN) Syarif Hidayatullah Jakarta.

Skripsi yang penulis buat berjudul “IDENTIFIKASI GEN

CALPASTATIN (CAST|RsaI) MENGGUNAKAN METODE PCR – RFLP

PADA SAPI PASUNDAN DI BPPT SAPI POTONG CIAMIS, JAWA BARAT”.

Penyelesaian Skripsi ini dibantu oleh berbagai pihak baik moriil maupun materiil, untuk itu dalam kesempatan ini penulis berterimakasih sebesar-besarnya kepada :

1. Dr. Agus Salim, M.Si. selaku Dekan Fakultas Sains dan Teknologi UIN Syarif Hidayatullah Jakarta.

2. Dr. Dasumiati, M.Si. selaku ketua Jurusan Biologi UIN Syarif Hidayatullah Jakarta, sekaligus dosen penguji pada seminar proposal dan seminar hasil.

3. Slamet Diah Volkandari, S. Pt, M. Sc dan Dr. Nani Radiastuti, M. Si selaku pembimbing I dan II, yang telah meluangkan waktu dan tenaganya

(10)

iv

untuk memberikan bimbingan dan saran yang sangat bermanfaat kepada penulis.

4. Dr. Megga Ratnasari Pikoli, M. Si selaku dosen Pembimbing Akademik sekaligus penguji seminar proposal dan seminar hasil.

5. Ibu Dr. Priyanti, M. Si serta Ibu Etyn Yunita, M. Si selaku dosen penguji sidang munaqosah.

6. Prof. Endang Tri Margawati, M. Agr. Sc selaku kepala Laboratorium Genetika Molekuler Hewan, Puslit Bioteknologi, LIPI yang telah memberikan kesempatan bagi penulis untuk melaksanakan penelitian di Laboratorium tersebut.

7. Seluruh dosen dan staf Pusat Laboratorium Terpadu (PLT) yang telah mendidik penulis selama menuntut ilmu di Program Studi Biologi UIN Syarif Hidayatullah Jakarta

8. Ayah dan Ibu, Kakek, Nenek serta saudara – saudara yang telah memberikan doa dan dukungan yang tiada hentinya kepada penulis

9. Teman – teman Biologi angkatan 2014 yang setia membantu, mendukung, memberikan doa dan berjuang bersama selama berkuliah di kampus UIN Syarif Hidayatullah Jakarta.

Demikianlah Skripsi ini disusun, semoga bermanfaat bagi para pembaca untuk menambah bekal ilmu pengetahuan dan wawasan. Aamiin.

(11)

v

DAFTAR ISI

ABSTRAK ... i

ABSTRACT ... ii

KATA PENGANTAR ... iii

DAFTAR ISI ... v

DAFTAR TABEL... vii

DAFTAR GAMBAR ... viii

Bab I. PENDAHULUAN ... 1 1.1. Latar Belakang ... 1 1.2. Rumusan Masalah ... 4 1.3. Hipotesis ... 4 1.4. Tujuan ... 4 1.5. Manfaat ... 5

Bab II. TINJAUAN PUSTAKA ... 6

2.1. Sapi Pasundan ... 6

2.1.1 Persebaran Sapi Pasundan ... 7

2.1.2 Sifat Kualitatif Sapi Pasundan ... 8

2.1.3 Sifat Kuantitatif Sapi Pasundan ... 9

2.2. Keempukan Daging dan Gen Calpastatin (CAST) ... 10

2.3. Analisis DNA ... 15

2.3.1 Isolasi DNA... 15

2.3.2 Polymerase Chain Reaction (PCR)... 16

2.3.3 Polymerase Chain Reaction – Restriction Fragment Length Polymorphism (PCR – RFLP) ... 17

Bab III. METODE PENELITIAN ... 19

3.1. Lokasi dan Waktu Penelitian ... 19

3.2. Alat dan Bahan ... 19

3.2.1 Alat ... 19

(12)

vi

3.3. Prosedur Kerja ... 20

3.3.1 Isolasi DNA... 20

3.3.2.1 Pelisisan Sel Darah Merah ... 20

3.3.2.2 Pemanenan Sel Darah Putih ... 21

3.3.2.3 Penghilangan Protein ... 21

3.3.2.4 Presipitasi DNA ... 22

3.3.2 Uji Kuantifikasi DNA ... 22

3.3.3 Polymerase Chain Reaction (PCR) gen CAST ... 23

3.3.4 Genotyping ... 23

3.4. Analisis Data ... 24

Bab IV. HASIL DAN PEMBAHASAN ... 27

4.1 Isolasi DNA ... 27

4.2 Amplifikasi Gen Calpastatin (CAST) ... 29

4.3 Penentuan Genotip Gen CAST ... 30

4.4 Keragaman Gen Calpastatin pada Sapi Pasundan ... 32

4.4.1 Frekuensi Genotip, Alel dan Keseimbangan Populasi ... 32

4.4.2 Nilai Heterozigositas dan PIC Sapi Pasundan ... 37

Bab V. PENUTUP ... 40

5.1 Kesimpulan ... 40

5.2 Saran ... 40

(13)

vii

DAFTAR TABEL

Tabel 1. Hasil kuantifikasi DNA sampel sapi Pasundan... 28 Tabel 2. Frekuensi Alel dan Frekuensi Genotip Sapi Pasundan ... 33 Tabel 3. Perbandingan Keragaman Gen CAST pada Beberapa Bangsa Sapi ... 36 Tabel 4. Nilai Heterozigositas dan PIC Sapi Pasundan ... 38

(14)

viii

DAFTAR GAMBAR

Gambar 1. Sapi Pasundan ... 7

Gambar 2. Strukur Domain Gen CAST Sapi ... 12

Gambar 3. Penentuan Genotipe Gen CAST... 24

Gambar 4. Visualisasi Hasil Isolasi DNA Sapi Pasundan ... 27

Gambar 5. Visualisasi Hasil PCR Gen CAST Sapi Pasundan ... 30

Gambar 6. Posisi Penempelan Primer forward dan reverse Sekuen Gen CAST (nomor akses AY008267) ... 30

Gambar 7. Hasil Visualisasi PCR – RFLP Gen CAST|RsaI Sapi Pasundan ... 31

(15)

1

BAB I PENDAHULUAN

1.1. Latar Belakang

Sapi Pasundan adalah salah satu sapi lokal Indonesia. Sapi ini tersebar luas di wilayah Jawa Barat meliputi Ciamis, Majalengka, Tasikmalaya, Pangandaran, Sumedang, Purwakarta, Indramayu dan Garut. Sapi Pasundan merupakan hasil persilangan secara turun-temurun antara sapi Bali (Bos javanicus) dan sapi Zebu (Bos indicus). Total populasi sapi Pasundan di wilayah Jawa Barat mencapai 40.000 - 50.000 individu, tetapi di sisi lain jumlah populasi tersebut terus mengalami penurunan (Arifin et al., 2015; Sutarno & Setyawan, 2015). Bobot hidup sapi Pasundan dewasa dapat mencapai 300 – 350 kg. Persentase karkas sapi Pasundan mencapai 53%, tidak kalah dengan sapi lokal Indonesia lainnya meskipun memiliki performa atau bentuk tubuh kecil (Sutarno & Setyawan, 2015).

Sapi Pasundan dianggap perlu dilestarikan karena merupakan sumberdaya genetik lokal yang khas dan asli Jawa Barat, serta memiliki potensi yang cukup baik (Arifin et al., 2015). Said et al. (2017) melaporkan bahwa sapi Pasundan memiliki tinggi badan, panjang badan, dan lebar dada lebih besar (122,56 cm; 115,56 cm; 140,13 cm berturut-turut) dibanding beberapa sapi jenis lainnya seperti sapi Aceh, sapi Kantingan, sapi Madura, sapi Pesisir, dan sapi Bali. Selain itu, Said & Putra, (2018) menambahkan bahwa sapi Pasundan memiliki sifat yang toleran terhadap panas dan penyakit tropis, sehingga mampu hidup dengan baik khususnya di wilayah Ciamis. Salah satu balai yang saat ini menjadi tempat

(16)

2

pengelolaan dan pengembangan sapi Pasundan adalah Balai Pengembangan dan Perbibitan Ternak (BPPT) Sapi Potong Ciamis, Jawa Barat.

Kualitas daging merupakan hal yang penting bagi kepuasan konsumen. Penilaian daging berkualitas didasari atas rasa (taste), keempukan (tenderness), rasa bergajih (juiceness), kesegaran (freshness), kandungan lemak (leanness), kesehatan (healthiness) dan nutrisi (nutrition) (Grunert et al., 2004). Menurut Koohmaraie & Geesink (2006), dari keseluruhan sifat kualitas daging, keempukan merupakan sifat yang paling penting. Dinas Peternakan Jawa Barat (2013) menyebutkan bahwa kualitas daging sapi Pasundan diantaranya memiliki kapasitas simpan air 20 – 30%, daya susut masak/cooking loss 25 – 45%, dan keempukan sebesar 35 – 96 mm/10s/g.

Killefer & Koohmaraie, (1994) melaporkan bahwa secara genetik keempukan dalam daging dipengaruhi oleh enzim calpastatin. Enzim calpastatin merupakan bagian dari kelompok sistem proteolitik dalam otot yang diketahui berperan dalam proses proteolisis dan keempukan daging setelah kematian (postmortem) (Casas et al., 2006). Enzim calpastatin menjadi inhibitor endogenus bagi calpain, yang bertanggung jawab dalam proses proteolisis myofibril yang menyebabkan struktur myofibril melemah, sehingga daging menjadi lunak. Enzim calpastatin dikode oleh gen calpastatin (CAST) (Killefer & Koohmaraie, 1994). Bishop et al. (1993) menetapkan lokus gen CAST bangsa sapi pada kromosom nomor 7 menggunakan teknik RFLP. Schenkel et al. (2006) melaporkan adanya hubungan antara variasi genetik gen (CAST) dengan peningkatan keempukan daging sapi (B. taurus) menggunakan metode Polymerase Chain Reaction –

(17)

3

Teknik PCR – RFLP adalah salah satu metode yang dapat digunakan untuk menganalisis keragaman genetik dalam suatu populasi. PCR – RFLP telah secara luas digunakan untuk mendeteksi polimorfisme gen dalam suatu populasi ternak. Teknik PCR – RFLP dianggap sebagai salah satu metode analisis penanda molekuler paling mudah, memiliki sensitivitas yang tinggi dan cepat dibandingkan menggunakan metode hibridisasi dan standard blotting (Sutarno, 2003). Keragaman genetik atau polimorfisme dapat diketahui dengan menghitung nilai frekuensi genotip, frekuensi alel, nilai keseimbangan Hardy – Weinberg, nilai heterozigositas, dan nilai Polymorphic Information Content (PIC) (Nei & Kumar, 2000). Polimorfisme gen CAST pada ternak sapi menunjukkan adanya hubungan dengan persentase keempukan daging. Identifikasi gen CAST menggunakan enzim RsaI menunjukkan nilai yang signifikan antara keempukan daging dengan setiap genotip individu pada populasi sapi B. taurus (Schenkel et

al., 2006).

Beberapa penelitian lain mengenai keragaman genetik gen CAST diantaranya, Kubiak et al. (2004) menggunakan teknik PCR-RFLP dan enzim restriksi AluI untuk mengetahui polimorfisme gen CAST pada area ekson 1C. Hasil menunjukkan adanya polimorfisme gen CAST ditunjukkan dengan ditemukannya tiga genotip (GG, GC, dan CC). Putri et al. (2015), menemukan dua variasi genotip (GG dan AG) pada gen CAST sapi Bali dengan menggunakan enzim AluI. Penelitian tersebut menunjukkan bahwa ditemukan adanya hubungan antara gen CAST dan beberapa karakteristik karkas, seperti ketebalan lemak punggung (GG) dan longissimus dorsi (AG).

(18)

4

Hingga saat ini informasi mengenai keragaman genetik pada sapi Pasundan masih terbatas, sehingga studi mengenai keragaman gen terutama gen CAST sangat penting untuk diketahui. Identifikasi keragaman gen CAST pada sapi Pasundan sangat penting dilakukan karena dapat menjadi salah satu informasi dasar yang dapat digunakan untuk melengkapi kerangka kerja genetika molekuler dalam memperbaiki mutu genetik ternak di Indonesia.

1.2. Rumusan Masalah

Rumusan masalah dalam penelitian ini adalah :

- Bagaimana keragaman genotip gen CAST pada sapi Pasundan di UPTD – BPPT Ciamis, Jawa Barat setelah dianalisis menggunakan metode PCR – RFLP?

- Apakah terdapat polimorfisme pada populasi sapi Pasundan di UPTD – BPPT Ciamis, Jawa Barat?

1.3. Hipotesis

Hipotesis dalam penelitian ini, yaitu :

- Terdapat keragaman genotip gen CAST pada sapi Pasundan di UPTD – BPPT Ciamis, Jawa Barat setelah dianalisis menggunakan metode PCR – RFLP.

- Terdapat polimorfisme pada populasi sapi Pasundan di UPTD – BPPT Ciamis, Jawa Barat

1.4. Tujuan

Tujuan dari penelitian ini adalah :

- Mengetahui profil genotip dan alel pada gen CAST|RsaI sapi Pasundan menggunakan metode PCR – RFLP.

(19)

5

- Memperoleh informasi mengenai keragaman genetik gen CAST pada populasi sapi Pasundan di UPTD – BPPT Ciamis, Jawa Barat.

1.5. Manfaat

Adapun manfaat dari penelitian ini adalah :

- Sebagai langkah awal dalam mengeksplorasi potensi genetik pada sapi Pasundan

- Mengetahui dan menambah informasi mengenai keragaman gen CAST pada sapi Pasundan, sehingga informasi tersebut diharapkan dapat digunakan untuk mendukung seleksi dan peningkatan kualitas daging sapi di Indonesia

(20)

6

BAB II

TINJAUAN PUSTAKA

2.1. Sapi Pasundan

Allah SWT., berfirman dalam Al-Quran surah An-Nahl (16:5-6):

Artinya: “Dan hewan ternak telah diciptakan-Nya untuk kamu, padanya ada

(bulu) yang menghangatkan dan berbagai manfaat, dan sebagiannya kamu makan. Dan kamu memperoleh keindahan padanya, ketika kamu membawanya kembali ke kandang dan ketika kamu melepaskannya (ke tempat penggembalaan).”

Ayat dalam surah di atas menjelaskan mengenai anugerah yang Allah SWT berikan kepada hamba-Nya berupa binatang-binatang ternak serta manfaatnya bagi manusia.

Salah satu hewan ternak yang telah dimanfaatkan dan dikembangbiakan di seluruh dunia hingga saat ini adalah sapi. Sapi menjadi komoditas penting bagi sumber penyedia susu, daging dan bulu (Sutarno & Setiawan, 2015). Ternak sapi dunia diklasifikasikan menjadi dua, yaitu sapi Eropa/ Taurine (Bos taurus) yang berasal dari wilayah subtropis, dan sapi Zebu (Bos indicus) yang tersebar di daerah tropis (Hahn, 1985). Selain itu juga ada sapi Bali (Bos javanicus) yang telah terdomestikasi dari spesies Banteng di Indonesia. Di sisi lain, Indonesia juga memiliki beberapa ternak lokal yang merupakan hasil persilangan secara

(21)

turun-7

menurun dari sapi B. indicus dan B. javanicus seperti sapi Madura, sapi Rambon, sapi Jabres, sapi Pasundan, dan sapi Galekan.

Sapi Pasundan (Gambar 1) merupakan salah satu sapi lokal Indonesia yang banyak tersebar di wilayah Jawa terutama Jawa Barat. Said et al. (2017) menyebutkan bahwa sapi Pasundan merupakan kombinasi dari B. indicus dan B.

javanicus. Secara turun-temurun beradaptasi lebih dari sepuluh generasi, sapi

Pasundan ditetapkan sebagai sumberdaya genetik sapi lokal oleh Menteri Pertanian melalui SK No. 1051/Ktsp/SR.120/10/2014 sebagai rumpun ternak sapi Pasundan. Sapi Pasundan merupakan hasil persilangan antara Bos sundaicus/ banteng/ sapi Bali, dengan sapi Jawa, sapi Madura, dan sapi Sumba Ongole (Kementan, 2014).

Gambar 1. Sapi Pasundan Jantan (kiri) dan sapi Pasundan betina (kanan) di BPPT Sapi Potong Ciamis, Jawa Barat (Margawati et al., 2016)

2.1.1 Persebaran Sapi Pasundan

Menurut Dinas Peternakan Jawa Barat (2015) keberadaan sapi Pasundan di Jawa Barat tersebar di beberapa wilayah antara lain di Cianjur, Sukabumi, Tasikmalaya, Pangandaran, dan Ciamis. Sulasmi (2016) menyebutkan dua wilayah penting bagi persebaran sapi Pasundan yakni wilayah sepanjang pesisir selatan Jawa Barat dan wilayah buffer zone hutan lindung sepanjang wilayah

(22)

8

Priangan Utara. Wilayah pesisir selatan Jawa Barat meliputi Kabupaten Pangandaran, Tasikmalaya, Garut, Cianjur, dan Sukabumi, sedangkan wilayah

buffer zone meliputi Kabupaten Kuningan, Majalengka, Sumedang, Indramayu,

Purwakarta, dan Ciamis.

Arifin et al. (2015) melaporkan Kabupaten Majalengka merupakan salah satu basis populasi sapi Pasundan yang memiliki populasi cukup tinggi, yakni 1.500 ekor pada tahun 2013. Keberadaannya menyebar di Kecamatan Kertajati sebagai wilayah buffer zone hutan lindung, antara lain di Desa Mekarjaya, Palasah, Mekarmulya, Sukamulya, Sukakerta dan Sahbandar.

2.1.2 Sifat Kualitatif Sapi Pasundan

Sifat kualitatif sapi dilihat dari warna tubuh dan bentuk tubuh. Sapi Pasundan memiliki ciri-ciri tubuh dominan berwarna merah atau merah bata, terdapat garis beulut berwarna merah tua atau hitam, memiliki warna kaki putih dengan batas yang tidak kontras pada bagian carpus sampai metacarpus dan

tarsus sampai metatarsus, hidung dan ujung ekor berwarna hitam. Pada ternak

jantan dapat terjadi perubahan warna dari merah menjadi hitam seiring dengan perkembangan kelenjar-kelenjar produksi hormon androgen. Bentuk tubuh sapi Pasundan segi empat dengan kaki yang panjang dan kecil, memiliki tanduk pendek, serta ada yang berpunuk dan tidak berpunuk (Baharun, 2015).

Sutarno & Setyawan (2015) menyebutkan bahwa sapi Pasundan memiliki karakteristik yang cukup sama dengan sapi Madura dan sapi Bali. Sapi Pasundan betina tidak memiliki punuk, ukuran tubuh relatif kecil, umumnya bagian pelvis berwarna merah bata dan putih, serta pada bagian kaki terendah (tarsus dan

(23)

9

betina, tetapi dengan warna tubuh yang lebih gelap. Beberapa sapi Pasundan jantan mengalami perubahan warna tubuh dari merah bata menjadi hitam sebagai tanda kematangan seksual.

Said et al. (2017) menyebutkan bahwa warna kuku, ujung ekor, kelopak mata, tanduk, dan moncong sapi Pasundan jantan dan betina adalah hitam. Pola warna putih terletak disekitar mocong, kaki bawah dan bagian belakang/ pelvis. Persentase warna putih di sekitar kaki dan pelvis sapi Pasundan jantan kira-kira 60%, sedangkan sapi Pasundan betina kira-kira 90%.

2.1.3 Sifat Kuantitatif Sapi Pasundan

Sifat kuantitatif pada sapi dapat dilihat dari ukuran tubuh, persentase karkas, umur dewasa kelamin, umur beranak pertama, lama berahi dan siklus berahi. Ukuran tinggi pundak tubuh sapi Pasundan jantan mencapai 115,74 + 8,40 cm, sedangkan betinanya 109,74 + 6,30 cm. Panjang badan sapi jantan 120,09 + 9,80 cm, sedangkan betinanya 110,09 + 9,68 cm. Lingkar dada sapi jantan mencapai 150,22 + 11,76 cm, sedangkan lingkar dada sapi betina 138,22 + 11,85 cm, serta bobot badan sapi jantan 240,40 + 34,00 kg, sedangkan betina 220,30 + 22,00 kg (Baharun, 2015).

Said et al. (2017) menyebutkan bahwa tinggi badan sapi Pasundan lebih besar dibanding jenis sapi dewasa asal Indonesia lainnya seperti sapi Aceh, sapi Kantingan, sapi Madura, sapi Pesisir, dan sapi Bali. Panjang tubuh sapi Pasundan sama dengan sapi Kantingan, sedangkan sapi jantan dewasa Pasundan memiliki panjang badan yang lebih besar dibandingkan sapi jantan dewasa Aceh, Pesisir, dan Bali. Tetapi panjang tubuh sapi Pasundan lebih kecil dibandingkan sapi Madura. Lebar dada sapi Pasundan lebih besar dibandingkan sapi Aceh,

(24)

10

Kantingan, Madura, Pesisir, dan Bali, tetapi sama dengan sapi Bali. Di sisi lain, tinggi badan, panjang tubuh dan lebar dada sapi Pasundan lebih kecil dibandingkan dengan sapi Ongole.

Umur dewasa kelamin sapi Pasundan adalah saat berusia 25 – 30 bulan, dengan umur beranak pertama saat berusia 30 – 40 bulan. Siklus berahi sapi yaitu 18 – 24 hari, dengan lama berahi 12 – 17 jam (Baharun, 2015). Sulasmi et al. (2017) menyebutkan bahwa secara umum bobot dan ukuran tubuh antara sapi Pasundan dengan sapi Aceh, sapi Katingan dan sapi Pesisir hampir sama. Bobot hidup sapi Pasundan dewasa mencapai 200 – 250 kg dengan persentase karkas 53%.

Sutarno & Setyawan (2015) menyebutkan bahwa sapi Pasundan memiliki persentase karkas yang unggul mencapai 50% dari bobot hidup. Sapi Pasundan mengandung kandungan lemak rendah, daging yang kasar, tidak mengandung banyak air, warna daging lebih cerah karena mengandung pigmen yang tinggi, dan hal ini menyebabkan sapi Pasundan memiliki harga yang lebih mahal dibanding jenis sapi lainnya.

Menurut Department of Animal Husbandry (2013) dalam Said et al. (2017) meyebutkan bahwa persentase/kandungan dalam sifat karkas dari sapi Pasundan yaitu kapasitas simpan air (20 – 30%), daya susut masak/cooking loss (25 – 45%), keempukan (35 – 96 mm/10s/g).

2.2. Keempukan Daging dan Gen Calpastatin (CAST)

Keempukan daging secara genetik diatur oleh kelompok enzim Calpain (sistem calpain), yang terdiri dari m– calpain, μ- calpain, dan calpastatin (Goll et

(25)

11

– Bratzler shear force (WBSF) dan penilaian konsumen (Wright et al., 2018). Dengan metode WBSF, daging dikatakan sebagai empuk (tender) dalam skala 1,62 – 2,29 kg, empuk sedang (intermediate tenderness) dalam skala 3,92 – 4,50 kg, dan keras dalam skala 5,42 – 7,42 kg (Miller et al., 1998).

Enzim protease (Calpain dan Calpastatin) aktif saat berada di dalam otot hewan hidup dan juga setelah penyembelihan, sehingga menyebabkan pelunakan daging. Calpastatin merupakan inhibitor bagi calpain (Ekerljung, 2012). Morgan

et al. (1993) mengatakan calpastatin diduga merupakan pengatur utama µ-calpain

dalam otot postmortem. Aktivitas calpastatin yang meningkat diikuti dengan menurunnya aktivitas calpain, sehingga laju degradasi protein menurun (Goll et

al., 1998). Gen CAST terletak pada bovine chromose (BTA) 7, dan beberapa

polimorfisme telah ditemukan pada gen tersebut. Penelitian menunjukkan SNP dalam gen CAST berasosiasi kuat dengan keempukan daging (Ekerljung, 2012). Calpastatin ada pada seluruh sel hewan yang mengandung proteinase, dan dicirikan dengan struktur monomerik dengan massa molekul 105 – 110 kD (Melloni & Pontremoli, 1991).

Peneliti mengidentifikasi bahwa sebuah gen CAST memiliki empat pengulangan domain penghambat yang paling sedikit terdiri dari 140 asam amino. Empat domain tersebut adalah domain I, II, III, dan IV, ditambah domain N-terminal atau domain L (leader) yang tidak memiliki aktivitas penghambatan. Selain empat domain tersebut, terdapat domain XL (extended leader) yang berfungsi dalam proses dimulainya pemanjangan selama proses transkripsi, serta domain C-terminal (Gambar 2). Setiap domain penghambat mampu menghambat satu molekul calpain (Wendt et al., 2004). Calpastatin memerlukan kalsium untuk

(26)

12

mengikat dan menghambat calpain. Calpastatin juga merupakan substrat bagi calpain dan dapat terpecah oleh keberadaan kalsium. Pemecahan calpastatin tidak menyebabkan hilangnya keseluruhan aktivitas penghambatan (Koohmaraie & Geesink, 2006).

Gambar 2. Strukur domain dari gen CAST sapi (Wendt et al., 2004)

Domain penghambat dalam gen CAST terdiri dari tiga subdomain. Sekuens genom menunjukkan bahwa setiap subdomain dikode oleh satu ekson tunggal dan setiap domain dikode oleh empat ekson, tiga ekson mengkode subdomain A, B, dan C, dan setiap empat ekson mengkode sekuens dari subdomain C ke akhir domain (Wendt et al., 2004). Setiap gen CAST tunggal mengandung beragam promoters yang menghasilkan beberapa transkripsi berbeda. Calpastatin merupakan protein tidak berbentuk, tetapi saat mengikat calpain, calpastatin akan membentuk sebuah struktur yang menyebabkan penghambatan berlangsung (Kemp et al., 2010). Penelitian menunjukkan bahwa adanya kemampuan berbeda pada setiap domain gen CAST dalam menghambat µ- atau m-calpain, yaitu domain I > domain IV > domain III > domain II, dari yang paling besar hingga paling kecil (Goll et al., 2003).

Telah diketahui bahwa pengikatan calpain ke calpastatin memerlukan Ca2+, yang mengikat secara bolak-balik, secara aktif calpain dapat diperoleh kembali dengan penambahan chelator Ca2+ seperti EDTA pada kompleks calpastatin/calpain. Konsentrasi Ca2+ yang diperlukan untuk pengikatan

(27)

13

calpastatin dan m-calpain lebih sedikit dibandingkan Ca2+ yang diperlukan untuk maksimal setengah aktivitas proteolitik m-calpain (Wendt et al., 2004). B. indicus memiliki aktivitas calpastatin paling tinggi dibandingkan dengan B. taurus (Wright et al., 2018).

Pada prosesnya, ikatan kalsium ke calpain menyebabkan perubahan dalam molekul calpain yang memungkinkannya menjadi aktif, tetapi juga memungkinkan calpastatin berinteraksi dengan calpain. Rantai heliks peptida ditemukan dalam bagian A dan bagian C, dalam domain penghambat, berinteraksi dengan calpain pada dua laman terpisah yang menyebabkan domain penghambat membungkus calpain. Bagian antara A dan C dengan bagian B, kemudian menghalangi laman aktif calpain. Berdasarkan urutannya, peneliti ahli berpendapat bahwa bagian B tidak secara langsung mengikat ke laman aktif sehingga mencegahnya menjadi substrat untuk enzim. Ekspresi gen CAST diatur melalui beberapa promoter, dimana setiap promoter diduga bertanggung jawab untuk ekspresi mRNA CAST yang berbeda yang dapat terpotong sehingga membentuk beragam variasi isoform protein. Penelitian mengungkapkan bahwa diduga setiap spesies memiliki aktivitas promoter yang berbeda (Kemp et al., 2010).

Di dalam proses kematian (postmortem), enzim cathepsin mendegradasi miosin, aktin, troponin dan kolagen. Cathepsin kemudian tidak aktif dalam kondisi pH rendah, sedangkan disaat itu calpain berada dalam nilai pH yang tinggi. Peran enzim calpain lebih signifikan dibandingkan enzim cathepsin dalam proses pengempukan daging. Saat nilai pH 6,3 calpain aktif untuk mendegrasasi

(28)

14

myofibril. Di sisi lain, enzim calpastatin aktif dan perlahan-lahan menghentikan proses degradasi (Goll et al., 2003; Wendt et al., 2004).

Aktivitas calpastatin 81% lebih besar pada otot longissimus pada sapi jantan (bulls) pada 24 jam postmortem. Calpastatin diduga merupakan pengatur utama dari µ-calpain pada otot postmortem. Aktivitas calpastatin postmortem cukup tinggi pada proses proteolisis dan keempukan daging B. indicus, daging hewan yang diberi makan β-adrenergic, dan pada daging beberapa spesies hewan lainnya (Morgan et al., 1993). Metode PCR-RFLP telah digunakan untuk mengetahui lokus calpastatin pada kelompok sapi (Lonergan et al., 1995). Produk PCR gen

CAST sapi Bali teramplifikasi pada panjang basa 624 pb. Diperoleh dua genotip

(GG dan AG) hasil dari proses genotyping gen CAST sapi Bali dengan menggunakan enzim restriksi AluI (Putri et al., 2015).

Barendse et al. (2007) menemukan 12 SNP dalam 91 sekuens cDNA dari 10 hewan, dan menunjukkan bahwa salah satunya, yaitu SNP CAST :c.155C>T memiliki hubungan yang kuat dengan keempukan daging dibandingkan dengan SNP gen CAST lainnya. Li et al. (2010) menemukan lima SNP pada setiap kelompok pemeliharaan, dengan tiga variasi genotip (GG, AG dan AA). Dalam penelitian tersebut, hubungan SNP 2959 menunjukkan individu dengan genotip GG memiliki WBSF (Warner-Bratzler shear force) lebih besar dibandingkan genotip GA atau AA. Selain itu, pada SNP 2870 memiliki nilai WBSF lebih besar pada genotip AA dibandingkan genotip lainnya. Penelitian juga menunjukkan bahwa SNP 2959 dan SNP 2870 diketahui berpengaruh pada proses keempukkan daging. Schenkel et al. (2006) menunjukkan bahwa SNP CAST dengan alel C berhubungan dengan peningkatan keempukan area LM (longissimus muscle).

(29)

15

2.3. Analisis DNA 2.3.1 Isolasi DNA

Tahap awal dalam proses identifikasi molekuler adalah isolasi DNA. Isolasi DNA darah dapat dilakukan dengan menggunakan metode garam pekat (Montgomery & Sise, 1990). Proses isolasi DNA dengan menggunakan metode garam pekat dilakukan melalui empat tahapan, yaitu pelisisan sel darah merah, pemanenan sel darah putih, penghilangan protein, dan presipitasi DNA. Cara lain untuk pelisisan sel juga dapat dilakukan dengan penambahan larutan ekstraksi seperti Tris-HCl, NaCl (natrium klorida), EDTA (etilendiamin tetra asetat), SDS (sodium dodesil sulfat), dan air terdestilasi. Proses ekstraksi DNA lainnya dilakukan dengan penambahan zat seperti etanol absolut yang berfungsi untuk membersihkan pelet DNA, dan buffer TE yang berfungsi untuk menjaga DNA agar tetap utuh (Filho & Almeida, 2013).

Isolasi DNA menggunakan metode garam pekat dinilai lebih cepat, dapat diandalkan, dan hasil DNA lebih baik dengan berat molekul DNA tinggi, dibandingkan metode lainnya. Metode lain yang dapat digunakan untuk isolasi DNA dari sampel darah adalah metode fenol. Kekurangan metode fenol antara lain memakan waktu lebih lama, dan seluruh sampel tidak dapat diselesaikan dalam satu hari. Selain itu penggunaan fenol juga dapat menyebabkan keracunan dan karat (Montgomery & Sise, 1990).

Kontaminan yang umum ditemukan dalam produk isolasi DNA diantaranya adalah polisakarida yang dapat mengganggu proses lanjutan seperti PCR, dimana terjadi hambatan aktivitas Taq polimerase, atau kontaminan lainnya yaitu polifenol yang dalam bentuk teroksidasi akan mengikat DNA secara

(30)

16

kovalen. Untuk menghindari terjadinya hal ini, maka jaringan yang digunakan dijaga tetap dingin sebelum dan selama proses ekstraksi.

Kemurnian DNA hasil isolasi dilihat menggunakan Spektrofotometri UV – Vis (Fatchiyah et al., 2011). Kemurnian DNA merupakan rasio dari nilai serapan panjang gelombang 260 nm dan 280 nm, sedangkan konsentrasi DNA diukur pada panjang gelombang 260 nm. Dengan koefisien absorpsi untuk DNA untai ganda adalah 50 μg/mL (Å260 = 50 μg/mL DNA). Kisaran konsentrasi DNA terbaik hasil pengukuran UV adalah 5 – 50 μg/mL DNA, dan kemurnian DNA yang berkisar antara 1,7 – 2 dinilai murni (Holden et al., 2009).

2.3.2 Polymerase Chain Reaction (PCR)

Proses yang dilakukan setelah isolasi DNA yaitu amplifikasi DNA melalui teknik PCR. Teknik PCR merupakan suatu proses enzimatik untuk mengamplifikasi nukleotida secara in vitro (Sulandari & Zein, 2003). Metode PCR dapat meningkatkan jumlah urutan DNA sebanyak ribuan bahkan jutaan kali dari jumlah semula. Proses PCR merupakan proses siklus yang berulang meliputi denaturasi, annealing dan ekstensi. Sepasang primer oligonukleotida yang spesifik digunakan untuk membuat hibrid dengan ujung -5’ menuju ujung -3’ untai DNA target dan mengamplifikasi urutan yang diinginkan (Fatchiyah et al., 2011). Komponen yang ada dalam suatu reaksi PCR adalah enzim polimerase yang termostabil (Taq polymerase), cetakan DNA (template DNA), primer, dNTPs, buffer PCR (TAE/TBE), ion MgCl2 dan mesin PCR (Singh et al., 2014).

Enzim polimerase yang diperlukan dalam suatu campuran reaksi PCR 50 μL berkisar antara 1 – 3 U, sedangkan 0,1 – 1 μg cetakan genom DNA diperlukan untuk 50 μL campuran reaksi PCR. Beberapa hal yang perlu diperhatikan saat

(31)

17

merancang primer adalah panjang primer, komposisi GC, dan suhu leleh primer /

melting temperature (Tm). Panjang primer umumnya berkisar antara 18 – 24 basa,

dengan nilai Tm antara 56 – 620C. Konsentrasi dNTP dalam campuran reaksi akhir adalah 200 μM, dan konsentrasi setiap dNTP (dATP, dCTP, dGTP, dTTP) haruslah seimbang (Singh et al., 2014).

Suatu reaksi PCR yang tidak berjalan sesuai dengan yang diharapkan mungkin terjadi karena beberapa hal, diantaranya primer yang tidak tepat, waktu dan temperatur yang tidak tepat, kualitas enzim polimerase, dan konsentrasi ion Mg2+ yang salah (Wilson, 1997). Sejumlah enzim polimerase merupakan berasal dari beberapa jenis organisme termofilik ekstrim yang bersifat termostabil. Keberadaan enzim tersebut membantu aktivitas polimerisasi DNA dari ujung -5’ ke ujung -3’. Waktu dan suhu yang dimiliki enzim untuk beraktivitas secara optimal adalah 45 menit dan 950C (Fatchiyah et al., 2011).

2.3.3 Polymerase Chain Reaction – Restriction Fragment Length Polymorphism (PCR – RFLP)

Polymerase Chain Reaction – Restriction Fragment Length Polymorphism

(PCR – RFLP) merupakan salah satu teknik yang telah secara luas digunakan untuk mendeteksi keberadaan laman potong enzim restriksi endonuklease pada suatu lokus dalam DNA yang teramplifikasi dari target cetakan (Sutarno, 2003). Deteksi RFLP dilakukan berdasarkan adanya kemungkinan untuk membandingkan profil pita-pita yang dihasilkan setelah dilakukan pemotongan oleh enzim restriksi terhadap DNA target atau dari individu yang berbeda. Berbagai mutasi yang terjadi pada suatu organisme mempengaruhi molekul DNA dengan berbagai cara serta menghasilkan fragmen-fragmen dengan panjang yang berbeda (Fatchiyah et al., 2011).

(32)

18

Perubahan basa akibat insersi atau delesi pada laman restriksi dapat dianalisis dengan bantuan sinar UV ketika potongan yang telah terdigesti dijalankan pada gel agarose yang telah diwarnai etidium bromida (EtBr). Teknik ini menghasilkan gambaran polimorfisme yang sama seperti teknik RFLP, tetapi tanpa memerlukan proses Southern Blotting (Sutarno, 2003). Selain untuk mendeteksi polimorfisme gen, teknik RFLP dapat digunakan untuk mendeteksi diversitas genetik, hubungan kekerabatan, sejarah domestikasi, asal dan evolusi suatu spesies, aliran gen dan seleksi, pemetaan keseluruhan genom, dan pengamanan gen-gen yang berguna dari spesies liar (Fatchiyah et al., 2011).

Menurut Russell (2009), Single Nucleotide Polymorphism (SNP) dapat dideteksi melalui teknik RFLP. Teknik RFLP menyebabkan adanya laman restriksi dalam suatu gen atau genom melalui proses pemotongan dengan enzim restriksi. Enzim restriksi menghasilkan fragmen DNA dengan panjang yang berbeda. Beberapa contoh enzim restriksi antara lain BamHI, RsaI, SmaI, AluI,

MspI dan sebagainya. Menurut Scheffer et al. (2001) analisa dengan

menggunakan metode PCR – RFLP dinilai memiliki lebih banyak keuntungan dibandingkan metode lain, seperti sekuensing DNA. Penggunaan PCR – RFLP cukup mudah dan lebih cepat. Secara umum, metode ini dapat dilakukan oleh siapa saja yang memiliki kesempatan menggunakan laboratorium yang memiliki alat PCR thermocycler.

(33)

19

BAB III

METODE PENELITIAN

3.1. Lokasi dan Waktu Penelitian

Penelitian dilaksanakan pada bulan Februari sampai Maret 2018, di Laboratorium Genetika Molekuler Hewan, Pusat Penelitian Bioteknologi, Lembaga Ilmu Pengetahuan Indonesia (LIPI), Cibinong, Kabupaten Bogor.

3.2. Alat dan Bahan 3.2.1 Alat

Alat yang digunakan pada penelitian ini adalah mikropipet (10 µL, 200 µL dan 1000 µL) (Biorad, USA), vortex (Maxi Mix II Barnstead, Thermolyne), sentrifugator (Hermle, Z300K, Jerman), mesin thermocycler (TC Plus, Techne, UK), perangkat elektroforesis (tangki elektroforesis dan power supply) (BioRad, Wide Mini Sub Cell GT, California, USA), spektrofotometer UV-Vis (GeneQuant Pro, Amersham BioScience, UK), Shaker Aging Incubator (Trade Raypa), UV Transiluminator (MajorScience, California, USA), timbangan analitik (Precisa XT 120 A, Swiss), magnetic stirrer hotplate (Cimarec® 2, USA), dan Laminar Air

Flow (LAF) (Teslar BH – 100, Spanyol). 3.2.2 Bahan

Bahan yang digunakan pada penelitian ini adalah sampel darah sapi Pasundan, larutan Red Cell Lysis Buffer (NH4Cl, KHCO3, EDTA, destilled water) pH 7,2, larutan Tris Buffer Saline (NaCl, KCl, Tris, destilled water) pH 7,4, larutan Tris EDTA (TE) pH 8,0, larutan Tris Boric EDTA (TBE) 5x, larutan TBE 1x, proteinase –K solution (Proteinase –K, destilled water, EDTA, SDS 40%), larutan NaCl 5M, alkohol absolut dingin, destilled water (DW), Double Destilled

(34)

20

Water (DDW), PCR Master Mix (My TaqTM Mix Bioline – UK), primer gen

CAST, agarose powder (Vivantis, Malaysia), pewarna EtBr (Ethidium bromide)

(Applicem – Jerman), DNA ladder 100 pb (Vivantis, Malaysia) microtube 1,5 mL, blue tips, yellow tips, dan white tips.

Sampel darah yang digunakan dalam penelitian ini adalah darah sapi Pasundan betina (+3 tahun) yang telah dikoleksi oleh Laboratorium Genetika Molekuler Hewan sebanyak 30 sampel. Sampel darah berasal dari UPTD-BPPT (Balai Pengembangan Pembibitan Ternak) Sapi Potong Ciamis Jawa Barat. Darah diambil melalui vena jugularis sebanyak 3 mL. Sampel darah dimasukkan ke dalam tabung vacutainer yang mengandung antikoagulan K3EDTA (Vacuette, Thailand).

3.3. Prosedur Kerja 3.3.1. Isolasi DNA

3.3.1.1. Pelisisan Sel Darah Merah

Sumber DNA yang digunakan dalam penelitian ini adalah sampel darah sapi Pasundan. Sebanyak 300 μL sampel darah dipindahkan ke tabung mikro 1,5 mL, dan ditambahkan dengan larutan Red Cell Lysis Buffer (RCLB) pH 7,2 sebanyak 200 μL. Sampel darah selanjutnya dihomogenkan dengan vorteks dan didiamkan selama 10 menit. Sampel kemudian disentrifugasi selama 10 menit dengan suhu 10oC dengan kecepatan 3.500 rpm, dan supernatan yang didapatkan kemudian dibuang. Pelet yang tersisa ditambahkan RCLB pH 7,2 sebanyak 300 μL, kemudian divorteks hingga pelet hancur atau homogen. Sampel selanjutnya disentrifugasi selama 10 menit dengan suhu 10oC dengan kecepatan 3.500 rpm, dan supernatan dibuang. Pelet kembali ditambahkan RCLB pH 7,2 sebanyak 300

(35)

21

μL, kemudian divorteks sampai pelet hancur atau homogen, dan didiamkan selama 10 menit.

3.3.1.2. Pemanenan Sel Darah Putih

Pelet selanjutnya ditambahkan Tris Buffer Saline (TBS) pH 7,4 sebanyak 300 μL dan dikocok sebentar. Sampel kemudian disentrifugasi selama 10 menit dengan suhu 100C dengan kecepatan 3.500 rpm, dan selanjutnya supernatan dibuang. Pelet sampel ditambahkan TBS pH 7,4 sebanyak 300 μL, kemudian dikocok pelan. Sampel selanjutnya disentrifugasi selama 10 menit dengan suhu 100C dengan kecepatan 3.500 rpm. Supernatan yang didapatkan kemudian dibuang, sehingga hanya pelet yang tersisa. Sampel pelet kemudian ditambahkan TBS pH 7,4 sebanyak 300 μL, dan dikocok pelan. Sampel selanjutnya disentrifugasi selama 10 menit dengan suhu 10oC dengan kecepatan 3.500 rpm. Supernatan yang didapatkan kemudian dibuang, sehingga hanya pelet yang tersisa.

Sampel pelet kemudian ditambahkan TBS pH 7,4 sebanyak 200 μL, dan dikocok pelan. Sampel selanjutnya disentrifugasi selama 10 menit dengan suhu 10oC dengan kecepatan 3.500 rpm. Supernatan yang didapatkan kemudian dibuang, sehingga hanya pelet yang tersisa. Terakhir, pelet ditambahkan TBS pH 7,4 sebanyak 200 μL. Sampel disentrifugasi selama 10 menit dengan suhu 10oC dengan kecepatan 3.500 rpm. Pelet selanjutnya dikeringkan, setelah kering ditambahkan TE pH 8,0 sebanyak 2 mL, kemudian dikocok pelan.

3.3.1.3. Penghilangan Protein

Proses selanjutnya yaitu penghancuran protein dengan menggunakan proteinase –K solution. Sampel yang sudah homogen dengan larutan TE pH 8.0,

(36)

22

selanjutnya ditambahkan dengan larutan proteinase –K solution sebanyak 200 µL tanpa divorteks atau dikocok. Tabung mikro 1,5 mL yang berisi sampel selanjutnya disegel menggunakan parafilm. Sampel diinkubasi menggunakan

incubator shaker selama semalam dengan suhu 37oC dan kecepatan 150 rpm.

3.3.1.4. Presipitasi DNA

Sampel yang telah diinkubasi selama semalam, selanjutnya ditambahakan NaCl 5 M pekat sebanyak 200 μL. Sampel digoyang dengan membentuk angka 8 dengan sangat perlahan, setelah itu dikocok kuat sebanyak 2 kali. Sampel disentrifugasi selama 10 menit dengan suhu 10oC dengan kecepatan 3.500 rpm. Sebanyak 400 μL supernatan diambil dan dimasukkan ke dalam tabung mikro baru yang steril menggunakan tip yang telah dipotong ujungnya. Supernatan lalu ditambahkan 800 μL alkohol absolut dingin. Tabung dibolak-balik secara perlahan, sampai terbentuk gelembung-gelembung yang melayang. Sampel selanjutnya di sentrifugasi selama 10 menit dengan suhu 10oC dengan kecepatan 12.000 rpm, kemudian buang supernatan. Pelet ditambahkan 1 mL alkohol 70%, kemudian disentrifugasi selama 5 menit dengan suhu 10oC dengan kecepatan 12.000 rpm. Pelet selanjutnya dikering anginkan dan ditambahkan 100 μL DW (free nuclease dan RNAse).

3.3.2. Uji Kuantifikasi DNA

Konsentrasi dan kemurnian sampel DNA diukur dengan menggunakan spektromotometer UV-Vis (GeneQuant Pro, Amersham, UK). Konsentrasi DNA dihitung pada panjang gelombang 260 nm. Dengan koefisien absorpsi untuk DNA untai ganda adalah 50 μg/mL (Å260 = 50 μg/mL DNA). Kemurnian DNA dihitung dari perbandingan serapan panjang gelombang 260 nm dan 280 nm.

(37)

23

3.3.3. Polymerase Chain Reaction (PCR) gen CAST

Amplifikasi atau perbanyakan gen CAST dilakukan dengan menggunakan metode PCR. Sekuens primer yang digunakan berdasarkan Schenkel et al (2006), yaitu primer forward: 5’-CCT CGA CTG CGT ACC AAT TCC GAA GTA AAG CCA AAG GAA CA-3’ dan Reverse: 5’-ATT TCT CTG ATG GTG GCT GCT CAC T-3’.

Total volume PCR sebanyak 10 µL yang terdiri dari 5 µL PCR Master

Mix (My TaqTM Mix, Bioline – UK), 1 µL primer pada masing-masing forward dan reverse (10 pmol/µL), 2 µL DDW, dan 1 µL DNA template. Program PCR terdiri dari pre-denaturasi 94oC selama 2 menit satu kali, denaturasi 94oC selama 30 detik, anneling 60oC selama 45 detik, extension 72oC selama 30 detik dengan siklus pengulangan sebanyak 40 kali, kemudian final extension 72oC selama 5 menit satu kali, dan suhu end hold 100C.

Hasil PCR gen CAST divisualisasi menggunakan gel agarose 1% dengan program elektroforesis 100 V selama 1 jam. Pewarnaan fragmen menggunakan

Ethidium bromide (EtBr). Potongan DNA hasil amplifikasi dicek dibawah sinar

UV menggunakan UV Transiluminator (MajorScience, California, USA), dan didokumentasikan dengan kamera digital.

3.3.4. Genotyping

Sampel gen CAST didigesti menggunakan enzim restriksi RsaI yang memiliki laman restriksi 5’-GT^AC-3’ (Schenkel et al., 2006). Reaksi digesti dilakukan dalam 10 µL campuran yang mengandung 10U/ µL enzim restriksi

RsaI, 5 µL produk PCR, 1 µL larutan 10x buffer, dan 3,7 µL DW. Campuran

(38)

24

dielektroforesis pada gel agarose 2% selama 1 jam dengan tegangan 100 V. Gel agarose diwarnai menggunakan Ethidium bromide (EtBr), dan divisualisasi dengan UV Transiluminator (MajorScience, California, USA). Hasil selanjutnya didokumentasikan menggunakan kamera digital.

Pita DNA yang muncul merupakan genotipe gen CAST, yang kemudian dibandingkan dengan marker (Vivantis, 100 pb DNA Ladder). Penentuan genotipe mengacu pada penelitian Schenkel et al. (2006) yang menghasilkan tiga genotipe yaitu CC (523 pb), GC (523 pb, 266 pb, dan 257 pb), dan GG (266 pb dan 257 pb) (Gambar 3).

Gambar 3. Penentuan Genotipe Gen CAST. M = Marker (Schenkel et al., 2010)

3.4. Analisis Data

Keragaman genotipe pada masing-masing sampel dapat diketahui dari pita-pita yang tampak pada visualisasi gel agarose. Analisis data meliputi frekuensi genotip, frekuensi alel, nilai keseimbangan genetik (chi square/ X2), nilai heterozigositas harapan (He), heterozigositas observasi (Ho), dan polymorphic

information content (PIC).

Frekuensi genotip dihitung dengan rumus dibawah ini:

Frekuensi genotip = Jumlah individu dengan genotip tertentu x 100% Jumlah seluruh individu

(39)

25

Frekuensi alel dihitung dengan rumus dibawah ini (Dario et al., 2008):

pC =

qG =

dimana pC dan qG = frekuensi alel C dan G; CAST CC, CAST CG, dan

CAST GG = jumlah individu sapi dengan genotip yang berbeda, N = jumlah

individu.

Keseimbangan genetik dihitung dengan rumus chi-square (X2) (Noor, 2008; Ishak et al., 2011) sebagai berikut:

X

2

= 

X2 = Chi – square

Oi = Jumlah pengamatan genotip ke – i Ei = Jumlah harapan genotip ke – i

Pendugaan nilai heterozigositas pengamatan (Ho) dan heterozigositas harapan (He) dihitung menggunakan rumus (Weir, 1996):

Ho =

i j

He = 1 -

qi=1

P1i

2

Ho = Heterozigositas pengamatan/ observed Nij = Jumlah individu heterozigot

N = Jumlah individu yang diamati

He = Nilai heterozigositas harapan/ expected P1i = Frekuensi alel ke-i pada lokus I

n = Jumlah alel pada lokus ke-I

2 CAST CC + CAST CG

2N

2 CAST GG + CAST CG

2N

(Oi – Ei)

2

Ei

nij

N

(40)

26

Nilai Polymorphism information content (PIC) dihitung berdasarkan rumus dibawah ini (Botstein et al., 1980; Mateescu et al., 2005):

Pi Pj

= Frekuensi alel ke-i = Frekuensi alel ke-j n = Jumlah alel

(41)

27

BAB IV

HASIL DAN PEMBAHASAN 4.1 Isolasi DNA

Genom sapi Pasundan diperoleh dari darah yang telah disimpan dalam tabung vaccutainer berisi antikoagulan (K3EDTA). Sebanyak 30 sampel genom DNA sapi Pasundan berhasil diisolasi dan dikonfirmasi secara kualitatif menggunakan elektroforesis gel agarose. Hasil elektroforesis menunjukkan bahwa seluruh sampel memiliki ukuran genom DNA yang terbaca pada panjang lebih dari 1 kb, ditunjukkan dengan pita DNA yang berada di atas pita marker (Gambar 4).

Gambar 4. Visualisasi hasil isolasi DNA sapi Pasundan

Selain menggunakan elektroforesis gel agarose, hasil isolasi DNA juga diketahui secara kuantitatif dengan spektrofotometer. Kualitas dan kuantitas DNA yang baik diperlukan untuk keberhasilan pengujian genetika molekuler lainnya, seperti proses PCR, digesti enzim, sekuensing, dan kloning (Holden et al., 2009; Qamar et al., 2017). Hasil pengukuran konsentrasi dan kemurnian DNA 30 sampel sapi Pasundan disajikan pada Tabel 1.

1 kb

(42)

28

Tabel 1. Hasil kuantifikasi DNA sampel sapi Pasundan

No Nomor Sampel Konsentrasi (ng/µL) Kemurnian

1 601 86,70 1,73 2 602 103,50 1,94 3 614 72,20 1,81 4 616 180,50 1,65 5 619 108,30 1,76 6 624 169,10 1,69 7 625 154,70 1,89 8 626 105,50 1,99 9 631 207,60 1,67 10 632 39,50 1,83 11 640 52,30 1,66 12 644 159,30 1,71 13 606 124,70 1,74 14 610 61,60 1,70 15 612 136,50 1,71 16 615 81,60 1,86 17 622 71,60 1,78 18 627 159,80 1,67 19 629 33,90 1,74 20 630 41,30 1,71 21 641 93,70 1,82 22 642 82,30 1,82 23 643 54,30 2,00 24 603 54,20 1,66 25 604 66,80 1,72 26 633 59,70 1,81 27 636 50,00 2,02 28 609 13,00 1,61 29 620 47,00 1,67 30 605 9,30 1,82 Rata – rata + STD. 89,35 + 51,61 1,77 + 0,11

Hasil perhitungan konsentrasi DNA pada seluruh sampel sapi Pasundan dengan menggunakan mesin spektromotometer UV-Vis (GeneQuant) berkisar antara 9,30 – 207,60 ng/μL (Tabel 1). Hasil tersebut menunjukkan bahwa analisis PCR dan analisis menggunakan PCR – RFLP mungkin dapat dilakukan, karena DNA berada dalam jumlah yang cukup. Konsentrasi DNA untuk dapat digunakan

(43)

29

dalam proses PCR, genotyping, maupun pengujian genetika lainnya berkisar antara 5 – 500 ng/μL untuk genom DNA eukariotik (Bioline, UK).

Hasil kemurnian DNA sapi Pasundan berkisar antara 1,61 – 2,02 (Tabel 1). Nilai DNA yang murni berkisar antara 1,70 – 2,00 (Olson & Morrow, 2012; Abed, 2013). Sebanyak 22 sampel DNA berkisar antara 1,70 – 2,00, sedangkan sebanyak 8 sampel DNA yang diisolasi memiliki kemurnian kurang dari 1,70 (Tabel 1). Nilai kemurnian DNA kurang dari 1,80 dapat menunjukkan bahwa sampel DNA terkontaminasi protein (Olson & Morrow, 2012). Keberadaan kontaminan dalam sampel DNA dapat menyebabkan rusaknya DNA atau menghambat reaksi enzim polimerase dalam proses PCR (Pereira et al., 2011). Kontaminan protein dalam sampel selama proses isolasi DNA dipisahkan melalui penambahan larutan proteinase –K solution, garam pekat (NaCl 5M) serta proses sentrifugasi. Hal ini belum memaksimalkan kemurnian hasil isolasi beberapa sampel DNA, karena dimungkinkan saat pengambilan DNA dalam bentuk supernatan, pelet yang mengandung kontaminan protein ikut terbawa.

4.2 Amplifikasi Gen Calpastatin (CAST)

Amplifikasi gen CAST pada 30 sampel sapi Pasundan berhasil dilakukan dengan menggunakan teknik PCR pada suhu annealing 600C selama 45 detik. Hasil visualisasi menunjukkan bahwa produk PCR gen CAST sapi Pasundan seluruhnya teramplifikasi pada panjang 523 pb, setelah divisualisasi menggunakan gel agarose 1% (Gambar 5). Berdasarkan penelitian sebelumnya dalam Schenkel et al. (2006), primer berhasil mengamplifikasi DNA dari sapi B.

taurus pada panjang 523 pb, dan dalam penelitian ini hasil yang sama diperoleh

(44)

30

CAST terletak pada ekson 5 dan 6 berdasarkan GenBank Accesion No AY008267

(Gambar 6).

Gambar 5. Visualisasi hasil PCR gen CAST pada sapi Pasundan. Keterangan: M = Marker, 1-30 = Gen CAST sapi Pasundan

Gambar 6. Posisi penempelan primer forward dan reverse (blok kuning) pada sekuen gen CAST (nomor akses AY008267)

4.3 Penentuan Genotip Gen CAST

Genotip dari gen CAST sapi Pasundan ditentukan dengan metode

Polymerase Chain Reaction – Restriction Fragment Length Polymorphism (PCR

– RFLP) menggunakan enzim restriksi RsaI (GT^AC). Tiga variasi genotip gen

CAST ditemukan pada 30 sampel sapi Pasundan yang telah didigesti

menggunakan enzim RsaI. Tiga variasi genotip tersebut adalah genotip CC, GC dan GG (Gambar 7). Berdasarkan Schenkel et al. (2006); Schenkel et al. (2010), genotip GG ditentukan jika potongan DNA pada gel agarose menunjukkan

ORIGIN

Forward

1 atgagaaaaa aacccaagaa gtaaagccaa aggaacacac agaggtaagt aatcattatt 61 aggacttgat atcataagat gaagcctttt tttttttccc ttatttttgt gaaggataaa 121 attttgaact ctcatctttc aacacttaag tcctacctag aatggcagtt atttgttttt 181 ctgttaaaac ggcacctctg tgtggcatca gcaggtattg caatttgctt gtgtgattct 241 tgctgaattt ggaaggaagg aattgcattg tttcaaattt tctacccaaa gtgaaatttg 301 tcacatgtaa atcatactaa tttaaattct cacaattgac tacataaaac acaagtgtta 361 tgaattgctt tctactcctc agagaaaagt agcaatatgt gtcatattat taaccccatg 421 gggtgtatgc gtgttttcag ccaaaaagcc tacccaagca ctcatcagat acaggaagca 481 agcatgctcc taaggaaaaa gccgtttcca aatcaagtga gcagccacca tcagagaaat

541 caacaaaacc aaag Reverse

//

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 1718 19 M 20 21 22 23 24 25 26 27 28 29 30

523 pb 500 pb

(45)

31

panjang 266 pb dan 257 pb, sedangkan genotip GC terlihat pada panjang 523 pb, 266 pb, serta 257 pb, dan genotip CC pada panjang DNA hanya 523 pb.

Gambar 7. Hasil Visualisasi PCR – RFLP Gen CAST|RsaI sapi Pasundan.

Keterangan: M = Marker

Produk PCR gen CAST Sapi Pasundan terdigesti setelah diinkubasi menggunakan enzim RsaI selama 16 jam pada suhu 370C. Menurut Schenkel et al. (2006), variasi pada gen CAST sapi Pasundan terjadi saat enzim RsaI mengenali situs potong individu dengan alel G, tetapi gagal mengenali situs potong pada individu dengan alel C dikarenakan adanya mutasi pada situs potong 257 pb.

GC GC GC GC GC GC GG GCGG GC CC GC GC GG GC GG GG M 1 2 3 4 5 6 7 8 9 10 M 11 12 13 14 15 16 17 Produk PCR gen CAST/ 523 bp 500 bp 200 bp 300 bp M 18 19 20 21 22 23 M 24 25 26 27 28 29 30 GG GG GG GG GC GC GG GG GC GG GG GG GG Produk PCR/ 523 bp 500 bp 200 bp 300 bp

(46)

32

Transversi G (Guanine) menjadi C (Cytosine) menyebabkan tidak adanya laman pemotongan oleh enzim restriksi RsaI pada posisi 257 pb yang seharusnya mengenali urutan basa gt/ac (Gambar 8). Enzim RsaI merupakan enzim endonuclease yang diperoleh dari bakteri Rhodopseudomonas sphaeroides, dan dapat mengenali urutan tetranucleotida 5’-GTAC-3’ dan membelah antara T dan A (Lynn et al, 1980).

Restriction Enzyme Map:

1 GAAGTAAAGCCAAAGGAACACACAGAGGTAAGTAATCATTATTAGGACTTGATATCATAAGATGAAGCCTTTTTTTTTTT 80 1 CTTCATTTCGGTTTCCTTGTGTGTCTCCATTCATTAGTAATAATCCTGAACTATAGTATTCTACTTCGGAAAAAAAAAAA 80 81 CCCTTATTTTTGTGAAGGATAAAATTTTGAACTCTCATCTTTCAACACTTAAGTCCTACCTAGAATGGCAGTTATTTGTT 160 81 GGGAATAAAAACACTTCCTATTTTAAAACTTGAGAGTAGAAAGTTGTGAATTCAGGATGGATCTTACCGTCAATAAACAA 160 161 TTTCTGTTAAAACGGCACCTCTGTGTGGCATCAGCAGGTATTGCAATTTGCTTGTGTGATTCTTGCTGAATTTGGAAGGA 240 161 AAAGACAATTTTGCCGTGGAGACACACCGTAGTCGTCCATAACGTTAAACGAACACACTAAGAACGACTTAAACCTTCCT 240 241 AGGAATTGCATTGTTTCAAATTTTGTACCCAAAGTGAAATTTGTCACATGTAAATCATACTAATTTAAATTCTCACAATT 320 241 TCCTTAACGTAACAAAGTTTAAAACATGGGTTTCACTTTAAACAGTGTACATTTAGTATGATTAAATTTAAGAGTGTTAA 320 RsaI 321 GACTACATAAAACACAAGTGTTATGAATTGCTTTCTACTCCTCAGAGAAAAGTAGCAATATGTGTCATATTATTAACCCC 400 321 CTGATGTATTTTGTGTTCACAATACTTAACGAAAGATGAGGAGTCTCTTTTCATCGTTATACACAGTATAATAATTGGGG 400 401 ATGGGGTGTATGCGTGTTTTCAGCCAAAAAGCCTACCCAAGCACTCATCAGATACAGGAAGCAAGCATGCTCCTAAGGAA 480 401 TACCCCACATACGCACAAAAGTCGGTTTTTCGGATGGGTTCGTGAGTAGTCTATGTCCTTCGTTCGTACGAGGATTCCTT 480 481 AAAGCCGTTTCCAAATCAAGTGAGCAGCCACCATCAGAGAAAT 523 481 TTTCGGCAAAGGTTTAGTTCACTCGTCGGTGGTAGTCTCTTTA 523

Gambar 8. Letak situs pemotongan enzim restriksi RsaI pada posisi basa 257 (GT|AC) gen CAST antara ekson 5 sampai ekson 6 (Hall, 1990)

4.4 Keragaman Gen Calpastatin pada Sapi Pasundan

4.4.1 Frekuensi Genotip, Alel dan Keseimbangan Genetik Populasi

Identifikasi keragaman genetik dilakukan dengan menghitung frekuensi genotip dan frekuensi alel gen CAST pada populasi sapi Pasundan. Frekuensi genotip diartikan sebagai jumlah suatu genotip terhadap keseluruhan genotip dalam populasi, sedangkan frekuensi alel adalah frekuensi relatif atau jumlah suatu alel terhadap jumlah total alel yang terdapat dalam suatu populasi (Nei & Kumar, 2000; Sumantri et al., 2008). Hasil analisis frekuensi genotip dan frekuensi alel gen CAST pada populasi sapi Pasundan disajikan pada Tabel 2.

(47)

33

Tabel 2. Frekuensi alel dan frekuensi genotip (n total = 30)

Populasi Frekuensi Genotip Frekuensi Alel HWE CC GC GG C G X2hitung X2tabel Sapi Pasundan n (1) % 0,03 n (15) % 0,50 n (14) % 0,47 0,28 0,72 0,40 5,99 X2tabel (0,05;2)

Sebanyak 30 individu sapi Pasundan yang digunakan, diperoleh 15 individu dengan genotip GC, 14 individu genotip GG, dan hanya 1 individu dengan genotip CC. Berdasarkan frekuensi genotip dan frekuensi alelnya, gen CAST pada populasi sapi Pasundan adalah polimorfik dengan adanya frekuensi alel G maupun C kurang dari 99% (Tabel 2). Nei & Kumar (2000) menyatakan bahwa suatu alel dikatakan polimorfik jika memiliki frekuensi alel sama dengan atau kurang dari 0,99 (99%). Pada penelitian ini, frekuensi alel G ditemukan lebih tinggi dibanding alel C (Tabel 2). Hasil yang sama ditunjukkan pada penelitian Van Eenennaam et

al. (2007), yaitu alel G gen CAST sapi Brahman (B. indicus) lebih tinggi

dibandingkan alel C.

Hasil berbeda ditunjukkan pada beberapa penelitian yang menggunakan sapi

B. taurus, dimana alel C gen CAST lebih tinggi dibandingkan alel G. Schenkel et al. (2006) melaporkan pada sapi Limousin, Charolais, dan Angus (B. taurus)

diperoleh alel C gen CAST lebih tinggi (63%). Hasil yang sama diperoleh oleh Kok et al. (2013) pada sapi Grey Stappe dari Turki (B. taurus) dimana alel C sebesar 56,1%. Selain itu, alel C pada sapi Friesian, Blonde d’Aquitaine, Belgian Blue, dan Piemontese (B. taurus) memiliki frekuensi alel lebih besar (59%, 57%, 59%, 64%, berturut-turut) dibanding alel G (Lisa & Di Stasio, 2009). Sapi Aberdeen-Angus (B. taurus) juga memiliki frekuensi alel C dominan (80%) dibanding alel G (Fedota et al., 2016).

(48)

34

Hasil uji keseimbangan genetik menurut Hardy-Weinberg menunjukkan bahwa gen CAST pada populasi sapi Pasundan berada dalam keseimbangan genetik (Tabel 2), karena nilai X2hitung populasi sapi Pasundan yang diperoleh lebih kecil dari nilai X2tabel. Populasi dikatakan berada dalam keseimbangan genetik apabila nilai X2hitung yang diperoleh lebih kecil dari nilai X2tabel (Putra et

al., 2017). Menurut Holsinger & Weir (2009); Morin et al. (2009); Yurnalis &

Sarbaini (2014), suatu populasi berada dalam keseimbangan genetik apabila dalam populasi tersebut terjadi kawin acak, tidak mengalami migrasi, mutasi, seleksi dan genetic drift. Marson et al. (2005) menyebutkan bahwa suatu populasi berada dalam keseimbangan Hardy-Weinberg apabila frekuensi alel (p dan q) dan genotip (p2, 2pq, dan q2) tetap konstan atau sama dari generasi ke generasi berikutnya karena adanya perkawinan acak.

Perbedaan frekuensi alel antara sapi Pasundan dengan sapi Taurine (B.

taurus) dimungkinkan karena adanya perbedaan spesies di antara keduanya. Nilai

frekuensi alel antara sapi Pasundan dengan sapi Brahman sama karena berada dalam satu sub spesies yang sama, yaitu B. indicus. Sudrajat et al., (2016) menyebutkan bahwa sapi – sapi yang berasal dari sub spesies yang sama cenderung akan memiliki nilai frekuensi genotip maupun alel yang sama. Berdasarkan Kepmen RI. No. 1051/Ktsp/SR. 120/10/2014, sapi Pasundan merupakan hasil adaptasi dan persilangan lebih dari 10 (sepuluh) generasi antara

B. sondaicus/ banteng/sapi Bali, dengan sapi Jawa, sapi Madura, serta sapi Sumba

Ongole. Sapi Pasundan diketahui berasal dari persilangan antara B. javanicus (sapi Bali) dan B. indicus (sapi Ongole dan Madura) (Hardjosubroto, 1994; Mohammad et al., 2012; Said et al, 2017). Hartatik et al., 2019 menyebutkan

(49)

35

bahwa berdasarkan analisis cytochrome b (cyt b), sapi Pasundan memiliki garis keturunan mitokondrial DNA (mtDNA) yang berasal dari B. javanicus. Sulasmi (2016), melaporkan bahwa berdasarkan studi morfometrik, sapi Pasundan memiliki hubungan kekerabatan lebih dekat dengan sapi Peranakan Ongole (PO), sedangkan berdasarkan kraniumetrik (ukuran kranium) lebih dekat dengan sapi Madura.

Alel C pada gen CAST di beberapa jenis sapi B. taurus diketahui secara signifikan berpengaruh terhadap peningkatan keempukan daging terutama pada area otot longissimus/ longissimus muscle (LM) selama proses penyimpanan (Schenkel et al., 2006). Fedota et al. (2016) menyebutkan bahwa ekspresi alel C gen CAST menyebabkan tidak berfungsinya sintesis molekul Calpastatin. Berdasarkan nilai share force, sapi dari bangsa B. indicus (Brahman/Sahiwal) ataupun persilangan dengan B. taurus (Angus/Hereford) memiliki karakter daging yang kurang empuk (5,88 – 8,41 kg) dibandingkan sapi dari bangsa murni B.

taurus (4,40 – 5,11 kg) (Crouse et al., 1989). Sifat daging B. indicus yang kurang

empuk dibanding daging B. taurus disebabkan karena adanya penurunan aktivitas proteolisis, yang dihasilkan dari tingginya aktivitas calpastatin (Wheeler et al., 1994; Wright et al., 2018). Persentase darah Brahman yang meningkat, sesuai dengan berkurangnya degradasi troponin-T, desmin, dan titin pada otot karena berkurangnya autolisis calpain-1, sehingga daging akan semakin keras/ kurang empuk (Wright et al., 2018). Semakin kerasnya daging pada kelompok B. indicus tersebut dimungkinkan karena ada hubungannya dengan persentase alel G pada B.

(50)

36

Tabel 3. Keragaman genetik gen CAST pada situs dan bangsa sapi yang berbeda

No Subspesies_ Bangsa sapi Situs SNP/

enzim restriksi Frekuensi genotip Frekuensi alel Referensi

1

Bos indicus_ Sapi Bali, sapi Pesisir, sapi Madura, sapi Aceh,

sapi Kantingan SNP 61 AG’CT|AluI Ekson 1C – 1D CC GC GG Sapi Bali 0,078 0,127 0,794 Sapi Pesisir 0,041 0,347 0,612 Sapi Madura 0,059 0,279 0,662 Sapi Aceh 0,000 0,385 0,615 Sapi Kantingan 0,040 0,220 0,740 C G 0,142 0,858 0,214 0,786 0,199 0,801 0,192 0,808 0,150 0,850 Furqon, 2012 2 Bos indicus_ Sapi Peranakan Ongole

(PO) SNP 61 AG’CT|AluI CC GC GG 0,35 0,15 0,50 C G 0,42 0,57 Oktavia, 2016 3 Bos taurus_ Sapi Red angus, sapi Charolais, sapi Limosin,

sapi Simmental, sapi Hereford, sapi Polish friesian, sapi Polish red

SNP 61 AG’CT|AluI Ekson 1C – 1D CC GC GG 0,36 0,48 0,16 C G 0,69 0,31 Kubiak et al., 2004 4 Bos indicus_ Sapi Pasundan SNP 257 GT’AC|RsaI Ekson 5 – 6 CC GC GG 0,03 0,50 0,47 C G 0,28 0,72 Present study 5 Bos taurus_ Sapi Greysteppe SNP 257 GT’AC|RsaI Ekson 5 – 6 CC GC GG 0,26 0,50 0,24 C G 0,51 0,49 Kok et al., 2013 6 Bos taurus_

Sapi Abeerdeen Angus

SNP 257 GT’AC|RsaI Ekson 5 – 6 CC GC GG 0,61 0,37 0,02 C G 0,79 0,21 Fedota et al., 2016

Figur

Memperbarui...

Referensi

Memperbarui...

Related subjects :