Aplikasi Teknologi DNA Rekombinan pada

10  51  Download (0)

Teks penuh

(1)

Aplikasi Teknologi DNA Rekombinan pada Rekayasa Genetik

Kentang Tahan Penyakit Late Blight

Edy. F. Lengkong

(Staf Pengajar jur.Budidaya Fak. Pertanian Universitas Sam Ratulangi-Manado) E-mail: edylengkong@yahoo.com

ABSTRAK

Lengkong, E.F. 2008. Application of Recombinan DNA Technology on potato genetic engineering resistance to late blight disease. J. Formas

Potato (Solanum tuberosum) is one of the important crop besides wheat, rice and maize. Cultivate this crop is most influenced by late blight disease that is caused of Phytophthora infestans fungi. This disease can decrease the potato productivity 15 % until 100 %. Farmers usually used chemical fungicide spraying to protect their plant from this disease, but this application are costly and give bad impact to environment. Development of Recombinant DNA technology in plant improvement is useful to produce potato plant that resistance to late blight disease attack. By recombinant DNA technology be able to create a new transgenic potato plant containing particular gene that can stimulate resistant to late blight. This article explain briefly how the application of Recombinant DNA technology to get the transgenic potato resistance to late blight disease.

Keywords : Solanum tuberosum, Phytophthora infestans, Recombinan DNA technology,

PENDAHULUAN

Kentang merupakan tanaman pangan penting di dunia selain gandum, padi dan jagung. Sebagai tanaman pangan, kentang merupakan sumber pangan dengan kandungan nutrisi tinggi, yang menyediakan banyak vitamin penting, mineral, dan asam amino dan merupakan sumber tambahan nutrisi dan kalori yang penting pada masyarakat yang dalam kebutuhan pangan hariannya didominasi beras (Anonim, 2004)

(2)

kentang sebesar 65.000 ha, rata-rata biaya penanggulangan penyakit late blight dengan menggunakan fungisida mencapai 224 US$/ha (ABSP-II, 2008)

Mempertimbangkan seriusnya tingkat serangan penyakit late blight terhadap kehilangan hasil kentang, biaya penanggulangan dengan fungsida yang tinggi serta dampaknya terhadap lingkungan dan kesehatan produk, maka dianggap perlu segera dilakukan upaya penanggulangan terhadap penyakit ini melalui pemuliaan tanaman kentang tahan penyakit late blight.

Pemuliaan kentang tahan late blight dapat dilakukan secara konvensional, yaitu dengan persilangan antara tanaman kentang budidaya yang peka penyakit late blight dengan tanaman kentang tipe liar yang memiliki sifat/gen ketahanan terhadap penyakit late blight. Metode lainnya yang dapat digunakan adalah melalui teknologi DNA rekombinan atau rekayasa genetika, yaitu dilakukan dengan cara memasukan konstruksi gen tertentu yang tahan terhadap penyakit late blight ke tanaman peka sehingga tanaman tersebut menjadi tahan terhadap penyakit late blight (Litbang Deptan, 2007; Glick and Pasternak, 1991; )

Melalui tulisan ini akan coba dijelaskan secara singkat bagaimana penerapan teknologi DNA rekombinan untuk mendapatkan tanaman kentang transgenik yang tahan penyakit late blight mulai dari isolasi gen ketahanan, konstruksi gen dan perbanyakan pada plasmid rekombinan, transformasi ketanaman kentang yang dimediasi oleh agrobacterium tumefaciens, deteksi dini keberhasilan transformasi.

REKAYASA GENETIK KENTANG TAHAN PENYAKIT LATE BLIGHT

Secara garis besar upaya rekayasa genetik dengan teknologi DNA Rekombinan untuk mendapat suatu tanaman kentang yang tahan terhadap penyakit late blight meliputi 4 (empat) kegiatan pokok, yaitu identifikasi dan isolasi gen ketahanan; Konstruksi gen ketahanan pada plasmid vektor tertentu dan perbanyakan konstruksi gen tersebut pada sel inang; Transformasi konstruksi gen ke tanaman kentang dan; Deteksi hasil transformasi pada tanaman transgenik (Sambrook, et.al. 1989 ; Stiekema and Visser, 1991)

Isolasi gen ketahanan late blight.

(3)

berbagai sumber baik dari jenis tanaman kentang budidaya, kentang non budidaya (tipe liar), jenis tanaman lain maupun dari mikroorganisme. Gen ketahanan terhadap penyakit late blight yang telah berhasil diidentifikasi antara lain gen endo-1-3 β-glucanase, gen Chitinase yang berasal dari jamur Trichoderma, gen penyandi glucose oxidase, dan gen RB yang diisolasi dari tanaman kentang tipe liar Solanum bulbocastanum (Jones, R.W., et al. 2006; Budiani , et al. 2000; Bisaria, V..S., et al. 1990; Martín-Cuadrado, et al. 2003; Colton, et al. 2006)

Gen ketahanan dari genom donor dapat diperoleh dengan cara mengisolasi DNA total genom atau dari RNA total. Selanjutnya untuk mendapatkan klon cDNA gen target yang berasal dari RNA dapat dilakukan dengan RT-PCR, menggunakan primer spesifik tertentu. Misalnya untuk gen ketahanan xyloglucan specifik endoglucanase inhibitor (XEIP) menggunakan primer dengan urutan sekuens 5’

CTCGAGATGGCTTCTTCTTATTGT 3’(AXF) dan

5’CTCGAGAGCAATTGAAGTGAAATT 3’ (AXR). Sintesis cDNA tersebut dilakukan dengan menggunakan Superscript III one Step RT-PCR System kit protokol (Johansen and Carrington, 2001) . Gen glukanase dapat menggunakan primer spesifik βglu-F 5’ GCCAACCIGTCTCCGATACA 3’ dan primer βglu-R 5’ GCAGTTGGAAATGAAGTCAG 3’. Untuk gen Khitinase menggunakan primer Chi-F 5’ GGCCAGACACCAGAATTGA-3’ dan primer Chi-R 5’ TCCACTTGATATGAAAGTC -3’ (Budiani, dkk. 2004). Sedangkan untuk isolasi gen RB menggunakan primer dengan sekuens 5’ CACGAGTGCCCTTTTCTGAC 3’ dan primer 5’ACAATTGAATTTTTAGACTT 3’ (Colton, et al. 2006). cDNA yang berasal DNA total dapat diperoleh dengan cara menggandakan fragmen gen target menggunakan jenis primer yang sama. Hasil PCR tersebut selanjutnya dielektroforesis pada gel agarose dan pita DNA target dikeluarkan dari gel, dipurifikasi dan diklon pada vektor plasmid tertentu menjadi pustaka cDNA untuk gen ketahanan penyakit late blight.

Konstruksi dan penggandaan gen ketahanan

(4)

pCambia 1302. Plasmid ini pada open reading frame (ORF) dari T-DNA selain memiliki marker seleksi hygromycin dan canamycin, juga memiliki gen green fluorecens protein (GFP) yang dapat menjadi agen seleksi dini keberhasilan transformasi (Johansen and Carrington, 2001)

Konstruksi gen ketahanan pada plasmid vektor dilakukan denga mula-mula mengeluarkan fragmen gen target pada klon cDNA meggunakan jenis enzim restriksi tertentu yang situs pemotongannya juga terdapat pada ORF plasmid pCambia, misalnya enzim restriksi Xho. Pemotongan enzim restriksi yang sama juga dilakukan pada plasmid vektor, sehingga plasmid vektor tersebut menjadi linear dengan ujung-ujung memiliki urutan basa nitrogen yang saling komplementer dengan ujung fragmen klon cDNA. Penyatuan/konstruksi antara plasmid vektor dan klon cDNA disambungkan dengan menggunakan Quick Ligase (Promega) sehingga menghasilkan konstruksi plasmid rekombinan yang mengandung gen ketahanan late blight. DNA ini dapat disimpan pada suhu -200C

sebelum digunakan.

Gambar 1. Topologi Plasmid Vektor pCambia 1302

(5)

dengan cara memasukan konstruksi plasmid tersebut pada bakteri Escherichia coli, dan untuk tujuan transformasi gen spesifik ke dalam genom tanaman digunakan Agrobacterium tumfaciens yang bertindak sebagai inang sekaligus transporter gen spesifik tersebut. Bakteri-bakteri ini ditumbuhkn pada media Luria Berthani (LB) yang ditambahkan antibiotik tertentu sesuai dengan agen seleksi yang dimiliki oleh plasmid vektor tersebut, dan hanya koloni bakteri yang hidup yang dapat ditransformasikan karena koloni tersebut merupakan kumpulan bakteri yang membawa gen ketahanan yang telah disisipkan tersebut. Koloni bakteri ini yang mengandung konstruksi gen ketahanan, bila belum akan digunakan dapat disimpan pada suhu 40C dan dapat diremajakan setiap 1 bulan

Transformasi gen ketahanan ke tanaman kentang

Transformasi gen pada dasarnya dapat dilakukan dengan beberapa metode seperti dengan menggunakan bakteri Agrobacterium tumefaciens, mikroinjeksi, elektroporasi, penembakan partikel, DNA virus/fage lamda. Khusus untuk transformasi pada tanaman kentang metode yang biasa digunakan dan memberikan hasil transformasi yang memuaskan yaitu menggunakan Agrobacterium tumefaciens (Stiekema and Visser, 1991)

Transformasi dengan diperantaraan Agrobacterium tumefaciens dilakukan dengan cara mula-mula agrobacterium yang didalamnya mengandung gen ketahanan pada plasmid vektor ditumbuhkan selama 1-2 hari pada media LB cair yang ditambahkan antibiotik tertentu, kemudian disentrifugasi dan pelet yang terbentuk ditambahkan dengan media feeding layer yang mengandung nutrisi makro-mikro, vitamin, hormon tumbuh dan acetosyringone. Suspensi bakteri ini dipakai untuk merendam eksplan kentang (bagian nodus atau internodus) yang sebelumnya telah 2 hari ditumbuhkan diatas kertas saring whatman pada media feeding layer. Selanjutnya eksplan tersebut di kokultivasi selama 2 hari kemudian dipindahkan ke media regenerasi sampai menghasilkan tunas dan planlet.

(6)

Transformasi agrobacterium baik melalui agroinfiltrasi dan co-cultivation dalam waktu 3-4 minggu akan menghasilkan tanaman transforman yang masih membutuhkan pengujian keberhasilan transformasi untuk memastikan apakah tanaman transgenik yang diperoleh benar-benar mengandung gen ketahanan yang diinsersikan serta mampu mengekspresikan sifat ketahanan terhadap penyakit late blight..

Deteksi keberhasilan transformasi

Deteksi keberhasilan transformasi dapat dilakukan secara dini yaitu beberapa jam setelah inokulasi atau setelah tanaman transforman tumbuh menjadi tanaman transforman beberapa minggu kemudian. Deteksi dini hasil transformasi bertujuan untuk mengetahui apakah gen target yang disisipkan/transformasikan berhasil masuk ketanaman resipien, Sedangkan deteksi tingkat lanjutan bertujuan untuk mengetahui apakah tanaman dapat mengekspresikan gen tersebut melalui penampilan ketahanan terhadap penyakit dilapang

Deteksi dini dapat dilakukan secara visual melalui ekspresi gen GFP, yaitu dengan melihat signal fluoresens menggunakan mikroskop UV pada daun tanaman yang ditansformasi atau dengan pemotretan menggunakan kamera digital tertentu yang mampu mendeteksi pendaran fluoresens pada bagian daun yang ditransformasi (metode agroinfiltrasi). Pendaran fluoresens tersebut merupakan ekspresi dari gen GFP yang terdapat pada plasmid rekombinan yang telah ditranformasikan tersebut (Jones, el.al. 2006);

(7)

dengan klon cDNA probe akan memberikan signal pada lembaran film setelah diautoradiografi pada ruang gelap (Wiendi, 2005; Sambrook, et al.1989)

Bentuk deteksi dini lainnya yang juga dapat digunakan yaitu dengan menggunakan PCR untuk menggandakan segmen DNA tanaman transforman yang mengandung gen ketahanan tersebut dengan menggunakan primer spesifik seperti yang dipakai pada isolasi gen ketahanan sebelumnya. Bila transforman memiliki gen tanaman tersebut maka penggandaan dengan PCR terhadap DNA total tanaman akan menghasilkan pita DNA yang ukurannya sesuai dwngan ukuran gen yang disisipkan. Demikian sebaliknya, bila tanaman tidak mengandung gen target maka penggandaan dengan PCR tidak akan menghasilkan pita DNA pada gel elektroforesis . (Wiendi, 2005; Budiani, dkk. 2004 dan Siswanto, dkk. 2003)

Tanaman-tanaman transforman mengandung gen ketahanan berdasarkan hasil seleksi dini selanjutnya harus diuji ekspresi gen ketahanannya secara bioassay . Bioassay dilakukan dengan cara menginokulasikan suspensi sporagia dari patogen Phytophthora infestans langsung ke daun tanaman transforman maupun pada tanaman yang tidak ditransformasi sebagai kontrol. 6 hari Setelah inokulasi akan terlihat apakah tanaman transforman tahan atau tidak tahan tehadap patogen tersebut melalui gejala serangan pada luasan permukaan daun yang terinfeksi yang dibandingkan dengan tanaman kontrol.

Tanaman yang tahan tehadap patogen late blight merupakan tanaman transgenik yang nanti setelah melalui tahapan skrining yang ketat dan sosialisasi pada masyarakat dan memenuhi persyarakatan keamanan pangan, pada suatu saat dapat dilepas untuk dibudidayakan sebagai jenis kentang baru yang tahan terhadap penyakit late blight.

KESIMPULAN

(8)

Rekayasa genetika untuk menghasilkan tanaman transgenik yang tahan penyakit late blight dapat dilakukan karena didukung oleh tersedianya teknologi DNA rekombinan yang terus berkembang sehingga memungkinkan peneliti mengidentifikasi, mengisolasi, menggandakan, memasukan gen ketahanan tersebut pada tanaman kentang budidaya yang peka penyakit late blight, bahkan dapat mendeteksi keberhasilan transformasi gen tersebut pada tingkat dini sehingga dapat mempersingkat waktu pengujian hasil transformasi.

Keberhasilan transformasi gen pada akhirnya ditentukan oleh apakah gen yang diinsersikan/disisipkan ke genom tanaman dapat diekspresikan oleh tanaman tersebut bilamana tanaman tersebut dipaparkan langsung dengan patogen penyakit, serta apakah gen ketahanan ini tetap dapat diekspresikan pada generasi-generasi selanjutnya. Untuk menjawab ini maka uji bioassay mutlak dilakukan.

Akhirnya, bagaimanapun hebatnya teknologi yang sudah dikembangkan untuk menghasilkan tanaman tanaman transgenik yang mampu mengatasi kendala-kendala dibidang pertanian, semuanya tidak akan banyak berarti atau hanya akan sampai pada tataran eksperimen dilaboratorium kalau masyarakat yang merupakan muara akhir dari produk transgenik tidak dapat memahami, menerima dan menggunakan produk ini, oleh karena proses sosialisasi yang menyeluruh perlu terus dilakukan pada semua lapisan masyarakat baik oleh pemerintah sebagai pemegang otoritas maupun oleh peneliti sebagai perekayasa produk tanaman transgenik.

DAFTAR PUSTAKA

Anonimous, 2004. Indonesia late blight profile. http://gilb.cip.cgiar.org. 13 Januari 2008

ABSP II, 2008. Late blight, Single-project report.

http://www.absp2.cornel.edu/project, 13 Januari 2008

Bisaria, S., P. S. R. Babu and T. Panda, Madras, 1990. Endoglucanase from the

(9)

Budiani, A, I. Susanti, S. Mawardi, D.A. Santoso, dan Siswanto. 2004. Ekspresi β-glukanase dan Kitinase pada tanaman kopi arabika (Coffea arabica L.) tahan dan rentan karat daun. Menara Perkebunan 72(2):55-68.

Colton, L.M, H.I.Groza, S.M.Wielgus, and J.Jiang. 2006. Marker-assisted selection for the broard-spectrum potat late blight resistance conferred by gene RB dirived from a wild potato species. Crop Science 46 (2):589-594

Glick,B.R, J.J.Pasternak. 1994. Molecuar Biothecnology: Principles and application of recombinant DNA. ASM press, Washington DC.

Jones, R.W., M. Ospina-Giraldo, and K. Dealh. 2006. Gene silencing indicates a role for endoglucanase inhiitor protein in germplasm reistance to late blight. Amer J. of Potato Res. 81:41-46

Johansen, L.K and J.C.Carrington. 2001. Silencing on the spot induction and supression of RNA silencing in the Agrobacterium-mediated transient expression system. Plant pysiol. 126:930-938

Litbang Deptan. 2007. Kentang transgenic tahan hawar daun. http:// www.litbang.deptan.go.id . 13 januari 2008

Martín-Cuadrado1, A. B., E. Dueñas, M. Sipiczki, C. R. V. de Aldana1, and F. del Rey1. 2003. The endo-b-1,3-glucanase eng1p is required for dissolution of the primary septum during cell separation in Schizosaccharomyces pombe

Sambrook,J, E.F,Fritsch, T.Maniatis. 1989. Molecular cloning; A laboratory manual 2nd (ed). Cold Spring Harbor Laboratory Press

Siswanto, F. Oktavia, A. Budiani, Sudarsono, Priyono, dan S. Mawardi. 2003. Transformasi kopi robusta (Coffea canephora) dengan gen kitinase melalui Agrobacterium tumefaciens LBA4404. Menara Perkebunan 71(2):56-69

Stiekema,W.J and L. Visser. 1991.Gene transfer and gene to be transfered. in Biotechnological Innovations in Crop Improvement. Butterworth-Heineman Ltd.

Wiendi, Ni Made Armini. 2005. Konstruksi fusi transkripsi gen kitinase asal Aeromonas caviae WS7b dan ekspresinya pada tanaman kentang kultivar Desiree. Disertasi. Sekolah Pascasarjana IPB.

(10)

Figur

Gambar 1.  Topologi Plasmid Vektor pCambia 1302

Gambar 1.

Topologi Plasmid Vektor pCambia 1302 p.4

Referensi

Memperbarui...