Antarctic ice sheet

Top PDF Antarctic ice sheet:

isprs archives XLI B8 481 2016

isprs archives XLI B8 481 2016

The Greenland and Antarctic ice sheets contain more than 99 % of the freshwater ice on Earth, and thus, they are important contributors to global sea level rise. If they were melted com- pletely, sea level would rise by 66 meters. Rapid warming has caused a dramatic decrease of ice in the Artic region during last few decades. Sea ice extent rapidly declined; glaciers sped up, thinned and retreated, and permafrost warmed up and thinned. Arctic warming is further amplified as surface temperature in- creases due to the melt of the protective snow and ice cover. The Greenland Ice Sheet (GrIS) has lost an average 250 Gt/yr ice an- nually, equivalent to 0.7 mm/yr sea-level rise, since 2003. There remains much uncertainty in estimating the current mass loss of the Antarctic Ice Sheet (AIS). While vast regions of the West Antarctic Ice Sheet exhibit increasing ice loss in its marine-based regions, increasing snowfall or long-term dynamic thickening of the East Antarctic Ice Sheet might balance this ice loss.
Baca lebih lanjut

7 Baca lebih lajut

isprs archives XLII 2 W7 1579 2017

isprs archives XLII 2 W7 1579 2017

Accurate information of ice sheet surface slope is essential for estimating elevation change by satellite altimetry measurement. A study is carried out to recover surface slope of Antarctic ice sheet from Ice, Cloud and land Elevation Satellite (ICESat) elevation measurements based on repeat orbits. ICESat provides repeat ground tracks within 200 meters in cross-track direction and 170 meters in along-track direction for most areas of Antarctic ice sheet. Both cross-track and along-track surface slopes could be obtained by adjacent repeat ground tracks. Combining those measurements yields a surface slope model with resolution of approximately 200 meters. An algorithm considering elevation change is developed to estimate the surface slope of Antarctic ice sheet. Three Antarctic Digital Elevation Models (DEMs) were used to calculate surface slopes. The surface slopes from DEMs are compared with estimates by using in situ GPS data in Dome A, the summit of Antarctic ice sheet. Our results reveal an average surface slope difference of 0.02 degree in Dome A. High resolution remote sensing images are also used in comparing the results derived from other DEMs and this paper. The comparison implies that our results have a slightly better coherence with GPS observation than results from DEMs, but our results provide more details and perform higher accuracy in coastal areas because of the higher resolution for ICESat measurements. Ice divides are estimated based on the aspect, and are weakly consistent with ice divides from other method in coastal regions.
Baca lebih lanjut

5 Baca lebih lajut

isprs archives XLI B8 521 2016

isprs archives XLI B8 521 2016

The Antarctic ice sheet response to the global climate change, specifically the ice flow speed change of the glaciers, has been investigated by many researchers. However, most research results cover the period since 1970s or after the operation of the LANDSAT series. The availability of the film-based ARGON KH-5 data makes it possible to quantify the changes of the Antarctic ice sheet in 1960s. To meet the challenges of processing the low quality film-based ARGON images, a novel method was developed to allow estimating the ice sheet surface motion and reconstructing the surface model simultaneously from ARGON stereo images by decomposing the total parallaxes to terrain and motion based components. A photogrammetric approach was developed to distinguish stable ice surface features from those on motion and use them for recovering the camera orientation information. Several existing Antarctic mapping products were used to establish the ground control. The ice flow speed field is reconstructed using a hierarchical image matching strategy. Firstly, epipolar images are generated via a fundamental matrix derived from correspondences used in the geometric modelling process, and then an image pyramid is built. Second, the normalized cross-correlation (NCC) technique is conducted on each layer of the pyramid to match the extracted features. Since the images were taken at different times, during which the glacier motion occurred, the measured total parallaxes are decomposed to terrain and motion parallaxes according to given ice flow directions which are derived from the iteratively produced DTM or images. Finally, a speed map and a DTM can be generated at each level of the image pyramid. This process repeats itself. At the bottom of the pyramid the final speed map and DTM are produced at a resolution of about 60m and represent the ice flow field of 1963. This approach was tested using two ARGON stereo-pairs in Rayner glacier in East Antarctica. Both the ice flow speed map and DTM were generated, and their difference with recent products is briefly discussed.
Baca lebih lanjut

4 Baca lebih lajut

antarctic sea ice highlights06

antarctic sea ice highlights06

the extent and concentration of the sea ice surrounding Antarctica increased from the late 1970s until 2015. this increase is not reproduced by climate models, and comes despite the overall warming of the global climate and the region. At a January 2016 workshop, leading scientists gathered to discuss the potential mechanisms driving changes in Antarctic sea ice and ways to better under- stand the complex relationship between Antarctic sea ice and the broader ocean-climate system. A number of hypotheses have been posed to explain the recent expan- sion of Antarctic sea ice extent; more research is needed to make deinitive statements about the mechanisms. improvements in sea ice observations and models would improve scientists’ ability to tease apart the many local, regional, and global processes that inluence sea ice extent and thickness.
Baca lebih lanjut

4 Baca lebih lajut

DETEKSI BAKTERI PATOGEN YANG BERASOSIASI DENGAN Kappaphycus alvarezii (Doty) BERGEJALA PENYAKIT ICE-ICE

DETEKSI BAKTERI PATOGEN YANG BERASOSIASI DENGAN Kappaphycus alvarezii (Doty) BERGEJALA PENYAKIT ICE-ICE

Largo et al., (1999) menjelaskan mekanisme infeksi bakteri pada K. alvarezii sehingga dapat menimbulkan gejala ice-ice. Bakteri menempel pada makro alga yang stress, selanjutnya berkembang biak pada dinding sel dengan memanfaatkan polisakarida (karagenan) sebagai medianya atau sumber karbonnya. Setelah dua sampai tiga hari kemudian bakteri masuk ke dalam jaringan sampai pada lapisan medulla dengan cara menghidrolisa enzim karaginase (Lin dalam Yulianto & Mira, 2009), akibatnya warna thallus menjadi pucat/putih, jaringan lembek serta thallus mudah terputus. Selain itu, Musa & Wei (2008) dalam Arisandi et al., (2011) menyatakan bahwa infeksi bakteri dapat berpengaruh terhadap jaringan dan sel makro alga, sebab menurut Hamoda (1995) dalam Arisandi et al., (2011) beberapa bakteri memiliki kemampuan menghasilkan enzim ekstraseluler yang dapat diekskresikan ke luar selnya, sehingga mampu mendegradasi senyawa organik yang terdapat pada lingkungan tempat tumbuhnya, seperti dinding sel thallus makro alga. Lakitan (2011) menyatakan bahwa, dinding sel tanaman mempunyai fungsi utama sebagai pelindung dan rangka sel, sehingga apabila dinding sel mengalami kerusakan atau terdegradasi maka dapat mengakibatkan terjadinya perubahan bentuk sel.
Baca lebih lanjut

7 Baca lebih lajut

Identifikasi, patogenisitas bakteri dan pemanfaatan gen 16S rRNA untuk deteksi penyakit ice ice pada budidaya rumput laut

Identifikasi, patogenisitas bakteri dan pemanfaatan gen 16S rRNA untuk deteksi penyakit ice ice pada budidaya rumput laut

Ice-ice disease on seaweed aquaculture Kappaphycus alvarezii has a significant effect on decreasing production of seaweed. Decreasing rate of biomass and caragenan content have positive correlation with ice-ice infected thallus weight based on cohabitation test between healthy and infected thallus. Destruction of seaweed tissues occurred in accordance with incubation time of ice-ice disease. Several bacteria had been successfully isolated from infected seaweed thallus and identified using API 20 E and API NE 20 identification test. Isolate of Vibrio alginoliticus PNGK 1 had the higest pathogenicity compared to other species such as Pseudomonas cepacia, Flavobacterium meningosepticum, Pseudomonas diminuta and Plesiomonas shigelloides. V. alginoliticus was significantly display ice-ice symptoms on day 1 after challenge test with dose of 10 6 CFU/mL. Molecular characterization on V. alginoliticus showed that PNGK 1 isolate similar with V. alginoliticus strain CIFRI V-TSB1. DNA sequencing data of V. alginoliticus PNGK 1 was used as the base of specific primer design for rapid detection of bacteria on seaweed thallus. Results of specific primer design through Primer 3 Program for V. alginoliticus PNGK 1 were primer aSEFM-F ((5- CAGCCACACTGGAACTGAGA -3) and aSEFM-R (5- TTAGCCGGTGCTTCTTCTGT -3). Amplication of V. alginoliticus PNGK 1 DNA resulted in one amplicon 201 bp. Development of rapid detection method on the present of pathogenic bacteria (V. alginoliticus PNGK 1) on seaweed thallus was conducted with several steps optimation test on PCR temperature resulted that at annealing 60 o C the DNA of V. alginoliticus PNGK 1 could be detected. Using specifity test and sensitivity with that specific primer it was found a band of 201 bp. This detection method for pathogenic bacteria could be applied for early detectionof asymptoutic ice-ice sea weed.
Baca lebih lanjut

152 Baca lebih lajut

Analisis Perbandingan Perceived Quality Ice Cream Stormy Plate Dengan Ice Cream Lainnya.

Analisis Perbandingan Perceived Quality Ice Cream Stormy Plate Dengan Ice Cream Lainnya.

3. Persepsi konsumen tentang ice cream Stormy Plate yaitu harga ice cream paling murah dibanding dengan Baskin & Robbins dan Pisseta. Persepsi ini dapat muncul dikarenakan Stormy Plate mengusung motto yaitu “LESS THAN GOCENG, MAN” dan “GOCENG IS MY LIFE”. Tindakan yang harus dilakukan oleh Stormy Plate agar kenaikan harga ice cream tersebut tidak berdampak pada penurunan penjualan adalah :

55 Baca lebih lajut

Perancangan Alat Ukur Kadar Oksigen (O2) Menggunakan Gs Oxygen KE-25 Sensor Berbasis Mikrokontroller ATMega16 dengan Tampilan PC

Perancangan Alat Ukur Kadar Oksigen (O2) Menggunakan Gs Oxygen KE-25 Sensor Berbasis Mikrokontroller ATMega16 dengan Tampilan PC

Data sheet Mikrokontroler ATMega16 Data sheet IC 7805 Data sheet Gs Sensor Oxygen KE-25 Susanto.. Jakarta: Ghalia Indonesia.[r]

1 Baca lebih lajut

Efikasi Dry Ice terhadap Sitophilus oryzae dan Tribolium castaneum pada Beras Kemasan Plastik di Dataran Tinggi Efficacy of Dry Ice to Sitophilus oryzae and Tribolium castaneum in The Rice of Plastic Packaging at High Land

Efikasi Dry Ice terhadap Sitophilus oryzae dan Tribolium castaneum pada Beras Kemasan Plastik di Dataran Tinggi Efficacy of Dry Ice to Sitophilus oryzae and Tribolium castaneum in The Rice of Plastic Packaging at High Land

Sitophilus oryzae and Tribolium castaneum are pest that can always attack rice in long periode storage. Rice in the plastic packaging that spread in market has not did fumigation, so the pest can attack faster than rice in sack packaging. This research was aimed to understand the effectiveness of dry ice to attack S. oryzae and T. castaneum with effect of dry ice to rice in plastic packaging at high land. This research used completely randomized design (CRD) with two factors. The first factor was dose of dry ice and second factor was wrapper of dry ice. The data was analyzed in variance analysis then continue with Duncan Mean Range Test (DMRT). The result showed that dose of dry ice 10 g/rice 5 kg can effect for 90,83 % mortality of S. oryzae and T. castaneum but it have not made effect for imago and larvae population. Also, dry ice was not make effect for rice weight and rice quality (color of rice, scent of rice and taste of rice).
Baca lebih lanjut

5 Baca lebih lajut

Laporan Praktikum ADPG ke 1

Laporan Praktikum ADPG ke 1

apabila responden menjawab “c” maka kolom diisi dengan angka 3. Sheet yang terakhir pada proses koding adalah sheet “Recall”. Recall ini merupakan suatu metode untuk mengingat kembali makanan atau minuman apa saja yang telah dikonsumsi selama 24 jam terakhir. Sama seperti yang lainnya data A1 dan A5 diduplikasikan. Setelah itu dilanjutkan dengan pemberian kode, seperti berikut.

31 Baca lebih lajut

ICE BREAKING REFLEKTIF DAN

ICE BREAKING REFLEKTIF DAN

You will experience a painful sharpening from time to time, by going through various problems, but you'll need it to become a stronger person.. You will experience a painful..[r]

14 Baca lebih lajut

ICE BREAKING REFLEKTIF AKU

ICE BREAKING REFLEKTIF AKU

• Anak-anak yatim, Parmin, mbok Darmi, Anak-anak yatim, Parmin, mbok Darmi, pengemis tua, murid-murid pengajian, pengemis tua, murid-murid pengajian, jamaah masjid dan banyak lagi j[r]

13 Baca lebih lajut

Information Sheet

Information Sheet

A registrant in possession of gambling devices manufactured prior to the effective date of this statute should affix a serial number thereto if one is not already so affixed, together wi[r]

3 Baca lebih lajut

The cro magnum s weight loss diet

The cro magnum s weight loss diet

Within a couple thousands years of the ice sheet retreating, farming started up again and new foods evolved to be the mainstay they are in today’s weight loss diet.. Keywords: weight lo[r]

1 Baca lebih lajut

Index of /papers/Food_Beverage The Ice Cream Maker

Index of /papers/Food_Beverage The Ice Cream Maker

Keywords: ice cream maker, ice cream makers, ice cream Article Body: There is no doubt that ice cream is one of the nicest things you can have, in the summer it is possible to eat the[r]

1 Baca lebih lajut

Choosing The Best Ice Cream Maker

Choosing The Best Ice Cream Maker

Keywords: ice-cream, ice cream Article Body: You can make delicious ice cream at home, as good as any premium store brand, if you choose a good ice cream maker and follow a few tips..[r]

1 Baca lebih lajut

EFEKTIVITAS PENERAPAN METODE ICE BREAKIN (1)

EFEKTIVITAS PENERAPAN METODE ICE BREAKIN (1)

Penggunaan ice breaking dalam optimalisai pencapaian konsentrasi siswa dalam pelajaran fisika dapat digunakan dengan menyajikan kata-kata yang berkaita dengan persamaan yang ada dalam fisika. Seperti halnya penggunaan ice breaking untuk memudahkan menyerap atau mengingat perumusan mengenai listrik dalam fisika. ice breaking diawal pembelajaran memberikan semangat kepada siswa sebelum pembelajaran fisika dilaksanakan. Untuk membangkitkan motivasi belajar diawal pembelajaran, guru memberikan ice breaking diawal. Dengan guru memberikan ice breaking sebelum memulai kegiatan pembelajaran, guru memberiakan kesan yang menarik, menyenangkan, dan menumbuhkan perasaan nyaman pada awal pembelajaran. Ice breaking dipertengahan pembelajaran tujuannya untuk mengembalikan lagi konsentrasi siswa yang sudah mulai menurun. Hal ini dilakukan karena siswa pada pertengahan pembelajaran sudah terlihat malas, mengantuk dan bosan.
Baca lebih lanjut

6 Baca lebih lajut

HIDROEKSTRAKSI DAUN KETAPANG (Terminalia catappa L.) SEBAGAI PENGENDALI PENYAKIT ICE-ICE PADA BUDIDAYA Kappaphycus alvarezii

HIDROEKSTRAKSI DAUN KETAPANG (Terminalia catappa L.) SEBAGAI PENGENDALI PENYAKIT ICE-ICE PADA BUDIDAYA Kappaphycus alvarezii

Faktor utama pemicu timbulnya penyakit ice-ice adalah faktor abiotik yaitu kondisi perairan laut yang fluktuatif dan cenderung ekstrim yaitu perubahan salinitas, suhu air, dan intensitas cahaya mengakibatkan rumput laut mengalami stres (Vairappan, 2006) ketika rumput laut mengalami stres akan memudahkan infeksi patogen (Imardjono et al.,1989; Hurtado and Agbayani, 2000; Mintardjo, 1990; Kaas and Perez, 1990). Dalam keadaan stres, rumput laut (seperti: Gracilaria atau Kappaphycus) akan membebaskan substansi organik yang menyebabkan thallus berlendir dan diduga merangsang banyak bakteri tumbuh di sekitarnya (Trono, 1974; Aji dan Murdjani, 1986; Kaas and Perez, 1990; Uyenco et al. 1981). Morfologi thallus K. alvarezii memutih dikarenakan penyakit ice-ice dapat dilihat pada gambar 2.2
Baca lebih lanjut

89 Baca lebih lajut

Assignment attachment sheet

Assignment attachment sheet

Student name Please use block letters, and enter your name as it appears on your student card` Student ID Subject name Lecturer Assignment number / title Due date Plagiarism and Col[r]

2 Baca lebih lajut

jsp information sheet

jsp information sheet

Annual Salary in US$: Total Work Experience: Years: & Months: Years in Supervisory Level: if applicable While the Scholarship will provide most of your financial requirements during t[r]

8 Baca lebih lajut

Show all 2424 documents...

Related subjects