Ice Age

Top PDF Ice Age:

TRANSLATION SHIFT OF PREPOSITIONAL PHRASE ON  ICE AGE 4: CONTINENTAL DRIFT AND ITS SUBTITLE  Translation Shift Of Prepositional Phrase On Ice Age 4: Continental Drift And Its Subtitle.

TRANSLATION SHIFT OF PREPOSITIONAL PHRASE ON ICE AGE 4: CONTINENTAL DRIFT AND ITS SUBTITLE Translation Shift Of Prepositional Phrase On Ice Age 4: Continental Drift And Its Subtitle.

Alhamdulillahirobbil’alamin, praise and thanks are given to Allah SWT through His mercy and guidance for the writer also power of easier to finish this research. The writer aware that without Allah’s permission she is not able to finish her research paper entitle “Translation Shift of Prepositional Phrase on Ice Age 4: Continental Drift and Its Subtitle”

13 Baca lebih lajut

INTRODUCTION  Subtitling Strategy And Accuracy Of Elements Within Direct Speech In Ice Age: Dawn Of Dinosaurs Movie.

INTRODUCTION Subtitling Strategy And Accuracy Of Elements Within Direct Speech In Ice Age: Dawn Of Dinosaurs Movie.

Now days, there are many west film released in Indonesia. Most of them of course using English language, because English as an international language used by all of country in the world. English as a foreign language is not only other nations but also we can learn and understand subtitling on the meaning form subtitling on the meaning from subtitling. One of the movies is entitled Ice Age: Dawn of Dinosaurs.

6 Baca lebih lajut

An analysis on the verbal humor and the consistency of the Indonesian subtitle in Ice Age 3  Dawn of the Dinosaurs

An analysis on the verbal humor and the consistency of the Indonesian subtitle in Ice Age 3 Dawn of the Dinosaurs

This study was a qualitative research. The required data was gathered through the document analysis. According to Ary, Jacobs, Sorensen, and Razavieh (2010), document analysis or content analysis, analyzes and interprets recorded material to learn about specific data. They add that the material could be public records, textbooks, letters, films, tapes, diaries, themes, reports, or other documents. This study would like to analyze the consistency of the English subtitle translation into Indonesian language in the movie Ice Age 3: Dawn of the Dinosaurs. The writer studied the English and Indonesian subtitle and the scripts, as kinds of recorded material, containing the whole dialog of this movie. This was the writer’s rationale of utilizing the document analysis. Using the document
Baca lebih lanjut

89 Baca lebih lajut

An analysis on the verbal humor and the consistency of the Indonesian subtitle in Ice Age 3: Dawn of the Dinosaurs.

An analysis on the verbal humor and the consistency of the Indonesian subtitle in Ice Age 3: Dawn of the Dinosaurs.

The research focused on a 3D animated comedy movie, Ice Age 3: Dawn of the Dinosaurs. The reason for the selection of this title is that it provides the researcher with acceptable data to be analyzed in this thesis. The movie Ice Age 3: Dawn of the Dinosaurs, was released in 2009 by Twentieth Century Fox Film Corporation and Blue Sky Studios. Its full length is 94 minutes. It is the third sequel of the Ice Age movies line, as the Ice Age (2002) and Ice Age 2: the Meltdown (2006) released before. This film features Manny and Ellie the mammoths, Diego the tiger, Sid the sloth, and Crash and Eddie the opossums as the main characters. The story of this third episode tells about the adventure of the main characters embarking on a mission to save Sid the sloth that has been dragged by a Tyrannosaur Rex into the world of Dinosaurs. Sid takes away the Tyrannosaur Rex’s eggs from her causing him to go together with the dinosaurs to
Baca lebih lanjut

91 Baca lebih lajut

A DISCOURSE ANALYSIS ON CHARACTERS’ UTTERANCES IN THE ICE AGE 4 MOVIE BY USING AUSTIN’S SPEECH ACT THEORY

A DISCOURSE ANALYSIS ON CHARACTERS’ UTTERANCES IN THE ICE AGE 4 MOVIE BY USING AUSTIN’S SPEECH ACT THEORY

Based on Khatib, Hossein, and Rahimi (2012:32), the use of literature in language teaching traces back to the nineteenth century. It means that the use of literature in language teaching has been implemented since a long time ago. Povey (1972:187) argues that literature in language teaching will increase all language skills because literature will extend linguistic knowledge by giving evidence of extensive and subtle vocabulary usage, complex and exact syntax. Pardede (2011: 17) explains that literature has some different formats such as picture books, newspaper, novel, poetry, drama, and short stories. In this research, the researcher chooses a film of Ice Age 4 in analyzing speech act. Film can be used as a media for language teaching because it contains of authentic materials. It has moral value which can motivate the teachers and the students and it gives some knowledge about culture. In films, there so many kinds of English expression that can be learnt. It will make the students easy to study about expression from the film. 2.7. Ice Age 4 Description
Baca lebih lanjut

41 Baca lebih lajut

INTRODUCTION  INFLUENCE OF FRIENDSHIP ENVIRONMENT ON DIEGO PERSONALITY IN THE FILM ENTITLED ICE AGE: A BEHAVIORIST APPROACH.

INTRODUCTION INFLUENCE OF FRIENDSHIP ENVIRONMENT ON DIEGO PERSONALITY IN THE FILM ENTITLED ICE AGE: A BEHAVIORIST APPROACH.

To make the research appropriate with the object of the study, the researcher will make limitation to the research. The writer will only focus on “how the environment influences on Diego‟s personality in film Ice age by using behaviorism approach”.

7 Baca lebih lajut

INTRODUCTION  A Translation Shift Analysis Of Noun Phrase In Subtitling Of Ice Age 4 Movie.

INTRODUCTION A Translation Shift Analysis Of Noun Phrase In Subtitling Of Ice Age 4 Movie.

The reasons why the writer chooses the title because the movie has a good moral value for kids and in linguistic side, the movie entitled Ice Age 4 has many noun phrases. Noun phase in the movie Ice Age 4 much has shifted and is not equivalent to the meaning of the noun phrase. The writer would like to analyse the changes in noun phrases in this study.

7 Baca lebih lajut

SUBTITLING STRATEGY AND ACCURACY OF ELEMENTS WITHIN DIRECT SPEECH IN ICE AGE: DAWN OF  Subtitling Strategy And Accuracy Of Elements Within Direct Speech In Ice Age: Dawn Of Dinosaurs Movie.

SUBTITLING STRATEGY AND ACCURACY OF ELEMENTS WITHIN DIRECT SPEECH IN ICE AGE: DAWN OF Subtitling Strategy And Accuracy Of Elements Within Direct Speech In Ice Age: Dawn Of Dinosaurs Movie.

These purposes of this research are to describe the strategies of subtitling in ice age: Dawn of the Dinosaurs movie and to describe the accuracy of those elements within direct speech subtitling. The data are written expression consisting of expansion strategies and deletion strategies used in the subtitling result in ice age: Dawn of the Dinosaurs movie.

15 Baca lebih lajut

TRANSLATION SHIFT OF PREPOSITIONAL PHRASE ON  ICE AGE 4: CONTINENTAL DRIFT AND ITS SUBTITLE  Translation Shift Of Prepositional Phrase On Ice Age 4: Continental Drift And Its Subtitle.

TRANSLATION SHIFT OF PREPOSITIONAL PHRASE ON ICE AGE 4: CONTINENTAL DRIFT AND ITS SUBTITLE Translation Shift Of Prepositional Phrase On Ice Age 4: Continental Drift And Its Subtitle.

In this session consist of two part of explanation for answering the research problem in chapter I. Those are research findings which explain the data analysis of prepositional phrase on Ice Age 4: Continental Drift movie and discussion. This research is conducted to analyze the translation shift of prepositional phrase in Ice Age 4: Continental Drift movie.

13 Baca lebih lajut

INFLUENCE OF FRIENDSHIP ENVIRONMENT ON DIEGO PERSONALITY IN THE FILM ENTITLED ICE AGE:   INFLUENCE OF FRIENDSHIP ENVIRONMENT ON DIEGO PERSONALITY IN THE FILM ENTITLED ICE AGE: A BEHAVIORIST APPROACH.

INFLUENCE OF FRIENDSHIP ENVIRONMENT ON DIEGO PERSONALITY IN THE FILM ENTITLED ICE AGE: INFLUENCE OF FRIENDSHIP ENVIRONMENT ON DIEGO PERSONALITY IN THE FILM ENTITLED ICE AGE: A BEHAVIORIST APPROACH.

There are two results of the study; the first result comes from structural analysis. The structural elements in the film include character and characterizations, plot, point of view, mise_en_scene, sound, theme, style, cinematography and the last is editor. The analysis shows that each of the elements are interrelated to each other. Therefore it makes easier to the reader in understanding the story of the Ice Age film. The second result comes from behavior analysis; the study shows that the influence on major character gives the positive impact of his personality. Therefore it makes him more comfortable in his life.
Baca lebih lanjut

12 Baca lebih lajut

A TRANSLATION SHIFT ANALYSIS OF NOUN PHRASE IN SUBTITLING OF ICE AGE 4 MOVIE BY SAGAZ NET  A Translation Shift Analysis Of Noun Phrase In Subtitling Of Ice Age 4 Movie.

A TRANSLATION SHIFT ANALYSIS OF NOUN PHRASE IN SUBTITLING OF ICE AGE 4 MOVIE BY SAGAZ NET A Translation Shift Analysis Of Noun Phrase In Subtitling Of Ice Age 4 Movie.

This research aims to identify the translation shifts of noun phrase found in the subtitling of Ice Age 4 movie by sagaz net and to describe the equivalence of noun phrase subtitling found in the Ice Age 4 movie by sagaz net. The data in this research are English and Indonesian movie subtitling. The data source are in Ice Age 4 movie subtitle containing noun phrase.

13 Baca lebih lajut

A TRANSLATION SHIFT ANALYSIS OF NOUN PHRASE IN SUBTITLING OF ICE AGE 4 MOVIE BY SAGAZ NET  A Translation Shift Analysis Of Noun Phrase In Subtitling Of Ice Age 4 Movie.

A TRANSLATION SHIFT ANALYSIS OF NOUN PHRASE IN SUBTITLING OF ICE AGE 4 MOVIE BY SAGAZ NET A Translation Shift Analysis Of Noun Phrase In Subtitling Of Ice Age 4 Movie.

The type of research is descriptive qualitative research. This research is proposed to identify the translation shifts of noun phrase found in the subtitling of Ice Age 4 movie by sagaz net and to describe the equivalence of noun phrase subtitling found in the Ice Age 4 movie by sagaz net. In this research the writer uses describtive study or literary study by reading and collecting data, classifying, analyzing the data and finally drawing the conclusion. The object of the study are noun phrases found in the movie entitled Ice Age 4 and it’s subtitling. The data are all linguistic units and their translation consists of noun phrases taken from subtitles of Ice Age 4 Movie. The data source are Ice Age 4 directed by Steve Martino and Mike Thurmeier and the manuscript was made by Michael Berg. The subtitle translated by Sagaz Net. In collecting data, the writer uses the documentation technique by using the following steps: reading the subtitle of ice Age 4 Movie, bolding the English word containing noun phrase from Ice age 4 Movie, writing them down into paper, and coding the data, such as 0001/IA4/SL1/TL1. The writer analyses the data by using comparison technique. The steps are:
Baca lebih lanjut

18 Baca lebih lajut

INTRODUCTION  Translation Shift Of Prepositional Phrase On Ice Age 4: Continental Drift And Its Subtitle.

INTRODUCTION Translation Shift Of Prepositional Phrase On Ice Age 4: Continental Drift And Its Subtitle.

In this research proposal, the researcher analyzes the translation shift strategy and the equivalence of translation. But the researcher limits the study only on prepositional phrase found in Ice Age 4: Continental Drift movie. Preposition is one of the most important parts of the sentence meaning as well. Therefore, this will make more specific focus in this study. The data will be analyzed using the theory and Practice of Translation theory written by Nida and Taber on 1969 and A Linguistic Theory of Translation by J.C. Catford 1965.
Baca lebih lanjut

8 Baca lebih lajut

Head circumference-for-age, arm circumference-for-age, triceps skinfold-for-age and subscapular skinfold-for-age

Head circumference-for-age, arm circumference-for-age, triceps skinfold-for-age and subscapular skinfold-for-age

The study populations lived in socioeconomic conditions favourable to growth and where mobility was low, ≥ 20% of mothers followed WHO feeding recommendations and breastfeeding support was available (de Onis et al., 2004b). Individual inclusion criteria were: no known health or environmental constraints to growth, mothers willing to follow MGRS feeding recommendations (i.e. exclusive or predominant breastfeeding for at least 4 months, introduction of complementary foods by the age of 6 months, and continued partial breastfeeding up to at least 12 months), no maternal smoking before and after delivery, single term birth, and absence of significant morbidity (de Onis et al., 2004b). As part of the site-selection process in Ghana, India and Oman, surveys were conducted to identify socioeconomic characteristics that could be used to select groups whose growth was not environmentally constrained (Owusu et al., 2004; Bhandari et al., 2002; Mohamed et al., 2004). Local criteria for screening newborns, based on parental education and/or income levels, were developed from those surveys. Pre-existing survey data for this purpose were available from Brazil, Norway and the USA. Of the 13 741 mother-infant pairs screened for the longitudinal component, about 83% were ineligible (WHO Multicentre Growth Reference Study Group, 2006e). Families’ low socioeconomic status was the most common reason for ineligibility in Brazil, Ghana, India and Oman, whereas parental refusal was the main reason for non-participation in Norway and the USA (WHO Multicentre Growth Reference Study Group, 2006e). For the cross-sectional component, 69% of the 21 510 subjects screened were excluded for reasons similar to those observed in the longitudinal component. Term low-birth-weight (<2500 g) infants (2.3%) were not excluded. Since it is likely that in well-off populations such infants represent small but normal children, their exclusion would have artificially distorted the standards’ lower percentiles. Eligibility criteria for the cross-sectional component were the same as those for the longitudinal component with the exception of infant feeding practices. A minimum of three months of any breastfeeding was required for participants in the study’s cross- sectional component.
Baca lebih lanjut

237 Baca lebih lajut

Identifikasi, patogenisitas bakteri dan pemanfaatan gen 16S rRNA untuk deteksi penyakit ice ice pada budidaya rumput laut

Identifikasi, patogenisitas bakteri dan pemanfaatan gen 16S rRNA untuk deteksi penyakit ice ice pada budidaya rumput laut

Pengelolaan budidaya rumput laut yang sehat dan bebas penyakit ice-ice merupakan komponen penting dalam peningkatan produksi rumput laut. Untuk mendukung pengendalian terpadu penyakit ice-ice pada budidaya rumput laut diperlukan informasi variasi genetik bakteri patogen dan penyediaan deteksi secara cepat dan akurat. Kajian yang dilakukan bertujuan untuk mengidentifikasi bakteri patogen berdasarkan hasil analisis sekuen gen 16S-rRNA, mengkonstruksi primer PCR spesifik dari sekuen gen 16S-rRNA dari bakteri yang memiliki tingkat patogenisitas tertinggi. Gen 16S-rRNA bakteri yang memberikan tingkat patogenisitas tertinggi diamplifikasi dengan primer PCR universal domain bakteri forward primer 63f (5’-CAG GCC TAA CAC ATG CAA GTC-3’) dan reverse primer 1387r (5’-GGG CGG WGT GTA CAA GGC-3’). Hasil sekuensing DNA dibandingkan dengan data base European Bioinformatics Institute (EBI) BLASTN. Perancangan dan analisis kelayakan pasangan primer yang diperoleh dilakukan dengan menggunakan program Primer 3. Dua primer spesifik PCR berhasil dirancang yakni aSEFM-F (5- CAGCCACACTGGAACTGAGA -3) dan aSEFM-R (5- TTAGCCGGTGCTTCTTCTGT -3). Kedua primer ini bereaksi optimum pada suhu 60 o C dengan yang menghasilkan amplikon berukuran 201 bp.
Baca lebih lanjut

152 Baca lebih lajut

Analisis Perbandingan Perceived Quality Ice Cream Stormy Plate Dengan Ice Cream Lainnya.

Analisis Perbandingan Perceived Quality Ice Cream Stormy Plate Dengan Ice Cream Lainnya.

Stormy Plate adalah salah satu perusahaan yang bergerak di bidang franchise ice cream. Stormy Plate menawarkan produk ice cream dengan konsep “ALL ABOUT ICE CREAM”. Pada pertengahan tahun 2004, Stormy Plate membuka lokasi pertamanya di Bandung dengan pendirinya Vivo Wibisono. Ide mendirikan Stormy Plate berasal dari modifikasi terbaik dari banyak jenis franchise yang ada. Stormy Plate bergerak dalam bidang industri ice cream home made. Alamat kantor pusat Stormy Plate di Jl. Pasir Kaliki Dalam no.109/65 Bandung. Perusahaan Stormy Plate didukung penuh oleh ahli-ahli yang telah teruji kualitasnya. Melakukan inovasi-inovasi secara terus-menerus untuk menemukan resep-resep rahasia yang bercita rasa dan berkelas. Stormy Plate menjadi salah satu bidang usaha yang cukup berpotensi dan menjanjikan. Misi dari Stormy Plate adalah menyediakan makanan dengan cita rasa dan kelas cafe dengan harga yang sangat terjangkau anak kost. Motto Stormy Plate adalah “LESS THAN GOCENG, MAN” dan “GOCENG IS MY LIFE” . Jargon Stormy Plate adalah “THE MOST WANTED AND CHEAPEST ICE CREAM IN TOWN”. Visi Stormy Plate adalah dengan melihat besarnya angka pengangguran dan masyarakat miskin dewasa ini, maka Stormy Plate hadir guna membuka lapangan kerja baru bagi orang-orang yang kurang memiliki kesempatan.
Baca lebih lanjut

55 Baca lebih lajut

ICE CREAM PARE ENAK DI LIDAH SERTA BERNILAI GIZI TINGGI.

ICE CREAM PARE ENAK DI LIDAH SERTA BERNILAI GIZI TINGGI.

Dengan itu program ini bisa membantu meningkatkan daya tarik terhadap buah pare tersebut, tentunya untuk megubah mindset masyarakat agar tidak mencam bahwasanya pare itu selalu pahit. Oleh karena itu membuat suatu kreativitas yang dapat membuat pengolahan pare menjadi lebih meningkat penggemarnya, kami terinspirasi untuk membuat ICE CREAM PARE ENAK DILIDAH SERTA BERNILAI GIZI TINGGI .

12 Baca lebih lajut

THE IMPACT OF RETIREMENT AGE ON ORGANIZATIONAL COMMITMENT

THE IMPACT OF RETIREMENT AGE ON ORGANIZATIONAL COMMITMENT

Secondly, how would have organizational commitment been affected if retirement age was set based on functional age? Intention to retire is like to be different if retirement age is measured based on the physical and psychological abilities of an employee. Workers who are still highly productive may not choose to retire even if their chronological age has categorized them as “older workers”. Will such workers be more committed to their organizations if they were to retire based on the time they think it is appropriate? On the other hand, should unproductive workers be encouraged to retire earlier so that organizations will not continue to pay for the lower value of work outcomes received? When retirement is fixed based on functional age of an employee, will there be any impact on organizational commitment among staff? The second hypothesis (H2) is developed to examine the relationship between these 2 variables.
Baca lebih lanjut

7 Baca lebih lajut

isprs archives XLI B7 543 2016

isprs archives XLI B7 543 2016

For all images, the best results (the highest user’s and producer’s accuracies) were obtained for the consolidated ice (CI) class. For other classes, three main problems were observed during classification. The first is related to skim ice (SI) and open water (OW). It occurred using the RADARSAT-2 data from 01.12.13 and TerraSAR-X data from 02.12.13. The skim ice surface is smooth and does not contain air bubbles, resulting in low backscattering similar to that of open water. The second problem relates to distinguishing agglomerated skim ice (ASI) and juxtaposed skim ice (JSI). It was observed using three datasets (RADARSAT-2 01.12.13, TerraSAR-X 02.12.13 and TerraSAR-X 13.12.13). Both of these classes have the same origin, skim ice, and they differ in its concentration. Agglomerated ice is more packed than juxtaposed ice; however, there is no strict boundary between them. The last issue is related to skim ice (also juxtaposed skim ice) and frazil runs. This problem occurred for two data sets (RADARSAT-2 and TerraSAR-X) from the same day (08.12.13). At borders between skim ice sheets, the backscattering value is higher due to ice roughness. Therefore, these places may be classified as frazil ice, which is generally characterised by a higher backscattering value than is skim ice. This type of problem was also noted by Jasek (2013).
Baca lebih lanjut

6 Baca lebih lajut

KARAKTERISTIK GENETIK Kappaphycus alvarezii SEHAT DAN TERINFEKSI PENYAKIT ICE-ICE DENGAN METODE Amplified Fragment Length Polymorphism (AFLP)

KARAKTERISTIK GENETIK Kappaphycus alvarezii SEHAT DAN TERINFEKSI PENYAKIT ICE-ICE DENGAN METODE Amplified Fragment Length Polymorphism (AFLP)

Infeksi penyakit ice-ice pada Kappaphycus alvarezii seringkali menyebabkan penurunan produksi yang sangat signifikan. K. alvarezii merupakan alga merah penghasil karaginan yang memiliki nilai ekonomi tinggi dan banyak dimanfaatkan dalam berbagai industri, seperti farmasi, makanan, stabilizer, dan kosmetik. Perbaikan genetik sangat diperlukan untuk meningkatkan produksi. Penelitian ini bertujuan untuk mengetahui karakteristik kemiripan genetik K. alvarezii sehat dan terinfeksi penyakit dari Balai Penelitian dan Pengembangan Budidaya Air Payau (BPPBAP), Maros dengan metode Amplified Fragment Length Polymorphism (AFLP). Pada penelitian ini juga dianalisis K. alvarezii asal Bone (BNE), Gorontalo (GRL), Tambalang (TMB), dan Kendari (KND) sebagai kontrol rumput laut sehat. Metode AFLP menggunakan enzim restriksi Psti dan Mset, preamplifikasi dan amplifikasi selektif diawali dengan isolsi DNA, uji genimoc DNA, restriksi dan ligasi. Hasil yang diperoleh menunjukkan penggunaan marker AFLP dengan primer forward P11 dan primer reverse M48, M49 dan M50 terhadap K. alvarezii yang berasal dari Takalar (TKL), dan Mataram (MTR), tanpa infeksi (sehat) dan terinfeksi penyakit Takalar ice (TKL+), Mataram ice (MTR+), serta K. alvarezii kontrol (BNE), (GRL), (TMB), dan (KND) menghasilkan 519 fragmen dalam 122 lokus dengan ukuran 50 - ~ 370 pb. Kemiripan genetik K. alvarezii yang terinfeksi penyakit ice-ice lebih rendah jika dibandingkan dengan yang sehat. Kemiripan genetik K. alvarezii dari Takalar sehat (TKL) dan terinfeksi ice-ice (TKL+) adalah 0,8176 dan MTR-MTR+ adalah 0,8033.
Baca lebih lanjut

10 Baca lebih lajut

Show all 2230 documents...