Top PDF Identifikasi, patogenisitas bakteri dan pemanfaatan gen 16S-rRNA untuk deteksi penyakit ice-ice pada budidaya rumput laut (Kappaphycus alvarezii)

Identifikasi, patogenisitas bakteri dan pemanfaatan gen 16S-rRNA untuk deteksi penyakit ice-ice pada budidaya rumput laut (Kappaphycus alvarezii)

Identifikasi, patogenisitas bakteri dan pemanfaatan gen 16S-rRNA untuk deteksi penyakit ice-ice pada budidaya rumput laut (Kappaphycus alvarezii)

Upaya peningkatan produksi dari pengelolaan budidaya rumput laut maka aspek kesehatan rumput laut merupakan hal yang penting. Salah satu komponen penting untuk mewujudkan hal tersebut tersedianya suatu perangkat teknologi yang dapat menunjang kesehatan rumput laut. Penelitian ini bertujuan untuk menentukan optimasi, spesifitas dan sensitifitas primer spesifik dan mengembangkan metode deteksi secara molekuler untuk mendeteksi bakteri penyebab penyakit ice-ice pada thallus rumput laut. Uji optimasi, spesifitas dan sensitivitas serta deteksi pada thallus rumput laut menggunakan primer spesifik PCR (aSEFM-F dan aSEFM-R). PCR dilakukan dengan sebagai berikut : Pra denaturasi 94 0 C selama lima menit, denaturasi 94 0 C selama 30 detik, penempelan primer 60 o C selama 30 detik, sintesis 72 o C selama 2 menit, post PCR suhu 72 o C selama 7 menit dan reaksi PCR dihentikan pada suhu 4 o C. Hasil penelitian menunjukkan bahwa pengunaan PCR dengan primer spesifik aSEFM-F dan aSEFM-R mampu mengidentifikasi isolat Vibrio alginolyticus PNGK 1 dari kultur murni dan mendeteksi penyakit ice-ice langsung dari jaringan rumput laut dalam waktu 6 jam dengan kepekaan konsentarsi DNA 0,21 ng/µl sedangkan kepekaan konsentrasi sel bakteri 2.3 x 10 3 sel ml -1 dan kespesifikan yang tinggi yang ditandai munculnya pita pada gel elektroforesis 201 bp, dengan evaluasi perbandingan bakteri Vibrio alginolyticus SKT b, Vibrio harveyi, Pseudomonas cepacia, Flavobacterium meningosepticum, Pseudomonas diminuta dan Plesiomonas shigelloides.
Baca lebih lanjut

279 Baca lebih lajut

Identifikasi, patogenisitas bakteri dan pemanfaatan gen 16S rRNA untuk deteksi penyakit ice ice pada budidaya rumput laut

Identifikasi, patogenisitas bakteri dan pemanfaatan gen 16S rRNA untuk deteksi penyakit ice ice pada budidaya rumput laut

Ice-ice disease on seaweed aquaculture Kappaphycus alvarezii has a significant effect on decreasing production of seaweed. Decreasing rate of biomass and caragenan content have positive correlation with ice-ice infected thallus weight based on cohabitation test between healthy and infected thallus. Destruction of seaweed tissues occurred in accordance with incubation time of ice-ice disease. Several bacteria had been successfully isolated from infected seaweed thallus and identified using API 20 E and API NE 20 identification test. Isolate of Vibrio alginoliticus PNGK 1 had the higest pathogenicity compared to other species such as Pseudomonas cepacia, Flavobacterium meningosepticum, Pseudomonas diminuta and Plesiomonas shigelloides. V. alginoliticus was significantly display ice-ice symptoms on day 1 after challenge test with dose of 10 6 CFU/mL. Molecular characterization on V. alginoliticus showed that PNGK 1 isolate similar with V. alginoliticus strain CIFRI V-TSB1. DNA sequencing data of V. alginoliticus PNGK 1 was used as the base of specific primer design for rapid detection of bacteria on seaweed thallus. Results of specific primer design through Primer 3 Program for V. alginoliticus PNGK 1 were primer aSEFM-F ((5- CAGCCACACTGGAACTGAGA -3) and aSEFM-R (5- TTAGCCGGTGCTTCTTCTGT -3). Amplication of V. alginoliticus PNGK 1 DNA resulted in one amplicon 201 bp. Development of rapid detection method on the present of pathogenic bacteria (V. alginoliticus PNGK 1) on seaweed thallus was conducted with several steps optimation test on PCR temperature resulted that at annealing 60 o C the DNA of V. alginoliticus PNGK 1 could be detected. Using specifity test and sensitivity with that specific primer it was found a band of 201 bp. This detection method for pathogenic bacteria could be applied for early detectionof asymptoutic ice-ice sea weed.
Baca lebih lanjut

152 Baca lebih lajut

DETEKSI BAKTERI PATOGEN YANG BERASOSIASI DENGAN Kappaphycus alvarezii (Doty) BERGEJALA PENYAKIT ICE-ICE

DETEKSI BAKTERI PATOGEN YANG BERASOSIASI DENGAN Kappaphycus alvarezii (Doty) BERGEJALA PENYAKIT ICE-ICE

Kappaphycus alvarezii merupakan salah satu spesies makro alga yang paling banyak dibudidayakan di Indonesia. Penyakit utama yang menyerang budidaya rumput laut ini adalah penyakit ice-ice yang dapat menurunkan hasil panen hingga 70-80%. Tujuan penelitian iniadalah untuk mengetahui bakteri patogen yang berasosiasi dengan K. alvarezii bergejala penyakit ice-ice dan mengetahui agen penyebab penyakit ice-ice. Jenis penelitian yang dilakukan adalah penelitian deskriptif. Sampel K. alvarezii yang bergejala ice-ice diambil dari lokasi budidaya di Teluk Bumbang Dusun Gerupuk Lombok Tengah. Sampel tersebut kemudian dibawa ke Laboratorium Biologi untuk diisolasi bakteri yang berasosiasi dengan K. alvarezii bergejala ice-ice. Terhadap isolat yang diperoleh dilakukan karakterisasi parsial. Selanjutnya dilakukan uji patogenisitas (postulat Koch) untuk mengetahui apakah bakteri yang diperoleh merupakan agen penyebab penyakit ice-ice. Hasil isolasi menunjukkan terdapat 28 isolat bakteri yang berasosiasi dengan K. alvarezii bergejala ice-ice. Selanjutnya, uji postulat Koch memperlihatkan hanya satu isolat yang mampu menyebabkan gejala ice-ice yaitu isolat K25.
Baca lebih lanjut

7 Baca lebih lajut

DAYA HAMBAT EKSTRAK RUMPUT LAUT (Kappaphycus alvarezii) TERHADAP BAKTERI PLAK SUPRAGINGIVA (EKSPERIMENTAL LABORATORIS)

DAYA HAMBAT EKSTRAK RUMPUT LAUT (Kappaphycus alvarezii) TERHADAP BAKTERI PLAK SUPRAGINGIVA (EKSPERIMENTAL LABORATORIS)

Background. Periodontal disease caused by polymicrobe in the oral cavity which was accumulated into biofilm called plaque. If plaque removal is not adequate, it will cause gingival inflammation (gingivitis), this stage can be continuing into chronic infection and lead attachment loss. This series of infection will cause periodontitis. Antibacterial plaque agent to increase oral hygiene used as preventive step. Purpose. The aim of this research is to know the effectiveness of Kappaphycus alvarezii extract inhibiting supragingival plaque bacteria. Methode. This research was done by using serial dilution and checked by colony counting in nutrient agar. Result. There were significant differences of supragingival plaque bacteria growth (p<0,05) among different concentration. Conclusion. Kappaphycus alvarezii extract is effective to inhibit the growth of supragingival plaque bacteria.
Baca lebih lanjut

60 Baca lebih lajut

Potensi budidaya rumput laut Kappaphycus alvarezii dan Gacilaria gigas dalam penyerapan karbon

Potensi budidaya rumput laut Kappaphycus alvarezii dan Gacilaria gigas dalam penyerapan karbon

Walaupun nitrat merupakan bentuk dari senyawa nitrogen dengan kandungan tertinggi pada air laut, namun nitrat harus melewati dua tahapan proses reduksi untuk menjadi senyawa amonium, sebelum bergabung ke dalam senyawa organik (Granbom et al. 2004). Pada proses asimilasi nitrat, terdapat enzim yang berperan dalam mempercepat fase reduksi nitrat menjadi nitrit, dimana fase ini dianggap sebagai fase pembatas dalam proses konversi nitrat menjadi amonium (Crawford et al. 1986). Enzim tersebut adalah nitrat reduktase. Hasil penelitian Granbom et al. (2004) menunjukkan bahwa aktivitas maksimum enzim nitrat reduktase pada spesies K. alvarezii dicapai pada pH 8,0; menurun 10% pada pH 7,5; sedangkan pada pH 7,0 dan 8,5 aktivitas enzim tesebut masih diatas 60%. pH perairan Teluk Gerupuk pada saat penelitian berkisar antara 7,86 – 8,11 (rata-rata 7,92 ± 0,097). Pada kisaran tersebut aktivitas enzim nitrat reduktase dapat berlangsung maksimum, sehingga fase reduksi nitrat menjadi nitrit tidak menjadi pembatas dalam laju konversi nitrat menjadi amonium yang menjadi sumber nutrien bagi rumput laut. Hasil penelitian tentang penggunaan senyawa nitrogen dengan konsentrasi rendah menunjukkan bahwa semua jenis algae yang diuji efisien dalam memanfaatkan nitrogen (Hanisak & Harlin 1978 in Dawes 1981). Dawes (1981) menyatakan bahwa algae makroskopik dapat menyimpan cadangan nitrogen selama periode/fase pertumbuhan lambat, kemudian menggunakannya selama periode/fase laju pertumbuhan tinggi. Menurut Ryder et al. (2004) menunjukkan bahwa pertumbuhan Gracilaria parvispora umumnya dibatasi oleh ketersediaan nitrogen di perairan, namun CO 2 dapat juga menjadi pembatas ketika
Baca lebih lanjut

80 Baca lebih lajut

PENYERAPAN KARBON PADA BUDIDAYA RUMPUT LAUT Kappaphycus alvarezii dan Gracilaria gigas DI PERAIRAN

PENYERAPAN KARBON PADA BUDIDAYA RUMPUT LAUT Kappaphycus alvarezii dan Gracilaria gigas DI PERAIRAN

Penelitian telah dilaksanakan di perairan Teluk Gerupuk, Kabupaten Lombok Tengah, Provinsi Nusa Tenggara Barat. Jangka waktu pelaksanaan penelitian terdiri atas satu siklus budidaya rumput laut (satu siklus 45 hari), yang telah dilaksanakan pada awal musim tanam di lokasi tersebut, yaitu pada bulan Juli- Agustus 2012. Bibit rumput laut yang digu- nakan dalam penelitian ini adalah jenis Kappaphycus alvarezii strain Maumere yang berasal dari National Seaweed Center, Balai Budidaya Laut, Lombok yang berlokasi di perairan Teluk Gerupuk, Kabupaten Lombok Tengah; dan Gracilaria gigas yang berasal dari tambak budidaya rumput laut milik pem- budidaya di Desa Sekotong Barat, Kabupaten Lombok Barat. Selama penelitian dilakukan pengujian sampel rumput laut dan sampel air laut dari lokasi budidaya yang diambil pada hari ke-0, 10, 20, 30, dan 45 pemeliharaan. Penelitian dilaksanakan menggunakan ran- cangan acak lengkap (RAL) satu faktor. Faktor perlakuan terdiri atas dua taraf yaitu dua spesies rumput laut yang berbeda (K. alvarezii dan G. gigas), dengan lima ulangan. Ulangan yang dilakukan berupa ulangan sampling, yaitu dengan pengambilan sampel rumput laut pada lima titik tanam.
Baca lebih lanjut

11 Baca lebih lajut

Potensi budidaya rumput laut Kappaphycus alvarezii dan Gacilaria gigas dalam penyerapan karbon

Potensi budidaya rumput laut Kappaphycus alvarezii dan Gacilaria gigas dalam penyerapan karbon

Walaupun nitrat merupakan bentuk dari senyawa nitrogen dengan kandungan tertinggi pada air laut, namun nitrat harus melewati dua tahapan proses reduksi untuk menjadi senyawa amonium, sebelum bergabung ke dalam senyawa organik (Granbom et al. 2004). Pada proses asimilasi nitrat, terdapat enzim yang berperan dalam mempercepat fase reduksi nitrat menjadi nitrit, dimana fase ini dianggap sebagai fase pembatas dalam proses konversi nitrat menjadi amonium (Crawford et al. 1986). Enzim tersebut adalah nitrat reduktase. Hasil penelitian Granbom et al. (2004) menunjukkan bahwa aktivitas maksimum enzim nitrat reduktase pada spesies K. alvarezii dicapai pada pH 8,0; menurun 10% pada pH 7,5; sedangkan pada pH 7,0 dan 8,5 aktivitas enzim tesebut masih diatas 60%. pH perairan Teluk Gerupuk pada saat penelitian berkisar antara 7,86 – 8,11 (rata-rata 7,92 ± 0,097). Pada kisaran tersebut aktivitas enzim nitrat reduktase dapat berlangsung maksimum, sehingga fase reduksi nitrat menjadi nitrit tidak menjadi pembatas dalam laju konversi nitrat menjadi amonium yang menjadi sumber nutrien bagi rumput laut. Hasil penelitian tentang penggunaan senyawa nitrogen dengan konsentrasi rendah menunjukkan bahwa semua jenis algae yang diuji efisien dalam memanfaatkan nitrogen (Hanisak & Harlin 1978 in Dawes 1981). Dawes (1981) menyatakan bahwa algae makroskopik dapat menyimpan cadangan nitrogen selama periode/fase pertumbuhan lambat, kemudian menggunakannya selama periode/fase laju pertumbuhan tinggi. Menurut Ryder et al. (2004) menunjukkan bahwa pertumbuhan Gracilaria parvispora umumnya dibatasi oleh ketersediaan nitrogen di perairan, namun CO 2 dapat juga menjadi pembatas ketika
Baca lebih lanjut

149 Baca lebih lajut

Identifikasi Molekuler Isolat Bakteri Pendegradasi Inulin dari Rizosfer Umbi Tanaman Dahlia - Universitas Negeri Padang Repository

Identifikasi Molekuler Isolat Bakteri Pendegradasi Inulin dari Rizosfer Umbi Tanaman Dahlia - Universitas Negeri Padang Repository

Identifikasi bakteri secara molekuler dilakukan dengan membandingkan urutan basa nukleotida parsial gen 16S rRNA dari isolat RZ-01 dengan urutan basa nukleotida gen 16S rRNA dari berbagai bakteri yang dimuat pada basis data GenBank menggunakan program BLASTn (http://www.ncbi.nlm.nih.gov pada 06 April 2016). Hasil BLASTn dimuat pada Gambar 11. Fragmen gen 16S rRNA isolat RZ-01 mempunyai kemiripan yang tinggi dengan 100 buah gen 16S rRNA bakteri pada basis data GeneBank. Kebanyakan bakteri tersebut adalah Klebsiella. Dengan demikian dapat disimpulkan bahwa isolat RZ-01 termasuk kelompok genus Klebsiella dengan spesies Klebsiella pneumoniae. Klebsiella pneumoniae merupakan bakteri gram negatif. Metoda nonstaining menggunakan larutan KOH 3% pada isolat RZ-01 juga menunjukkan bakteri gram negatif. Elektroferogram parsial gen 16S RNA isolat RZ-01 menggunakan primer BactF1 dimuat pada Lampiran 2.
Baca lebih lanjut

28 Baca lebih lajut

ISOLASI, IDENTIFIKASI DAN DETEKSI GEN INA BAKTERI ICE NUCLEATION ACTIVE PADA TUMBUHAN BERDAUN JARUM DI JALUR PENDAKIAN CEMORO SEWU GUNUNG LAWU.

ISOLASI, IDENTIFIKASI DAN DETEKSI GEN INA BAKTERI ICE NUCLEATION ACTIVE PADA TUMBUHAN BERDAUN JARUM DI JALUR PENDAKIAN CEMORO SEWU GUNUNG LAWU.

perpustakaan.uns.ac.id digilib.uns.ac.id commit to user i ISOLASI, IDENTIFIKASI DAN DETEKSI GEN INA BAKTERI ICE NUCLEATION ACTIVE PADA TUMBUHAN BERDAUN JARUM DI JALUR PENDAKIAN CE[r]

1 Baca lebih lajut

Pemanfaatan Karbondioksida (CO2) Untuk Optimalisasi Pertumbuhan Rumput Laut Kappaphycus alvarezii

Pemanfaatan Karbondioksida (CO2) Untuk Optimalisasi Pertumbuhan Rumput Laut Kappaphycus alvarezii

Akuarium pemeliharaan dibentuk satu rangkaian dengan filter yang bertujuan untuk efisiensi ruang dalam melakukan penelitian. Bahan yang digunakan pada akuarium filter yaitu gravel, karbon aktif (arang), sponge, dan bioball. Sebelum komponen- komponen filter digunakan, terlebih dahulu dicuci dengan menggunakan air tawar lalu dijemur hingga kering. Gravel diletakkan pada kolom pertama, karbon aktif pada kolom kedua, dan bioball pada kolom. Sponge diletakkan pada setiap dinding pemisah antar kolom agar air yang telah di filter bersih. Sistem akuarium di bagi menjadi dua yaitu sistem filter dan wadah pemeliharaan, seperti yang disajikan pada Gambar 4.
Baca lebih lanjut

127 Baca lebih lajut

TUGAS PENGEMBANGAN INDUSTRI AKUAKULTUR

TUGAS PENGEMBANGAN INDUSTRI AKUAKULTUR

Proses budidaya dilakukan selama 45 hari (Susilowati, dkk. 2012; Pongarrang, dkk. 2013). Selama masa pemeliharaan dilakukan pengontrolan organisme uji, dengan membersihkan kotoran berupa lumut atau hewan pengganggu pada tali ris dan rumput laut yang dilakukan setiap 5 hari sekali. Alimuddin (2013), menyatakan bahwa pembersihan terhadap kotoran yang menempel pada wadah-wadah penelitian untuk memperlancar sirkulasi air. Selain itu, juga dilakukan pengukuran kualitas air lingkungan pemeliharaan. Saat pembersihan diamati spesies hama pengganggu dan tanda-tanda apabila terdapat kontaminasi penyakit. Pada hari tersebut juga dilakukan pengukuran suhu, salinitas, arah dan kecepatan arus, kecerahan, pH, oksigen terlarut, total nitrogen serta ortophospat (Arisandi, dkk . 2013).
Baca lebih lanjut

9 Baca lebih lajut

Introduction of PaCS gene encoding Citrat Synthase to Kappaphycus alvarezii using Agrobacterium tumefaciens

Introduction of PaCS gene encoding Citrat Synthase to Kappaphycus alvarezii using Agrobacterium tumefaciens

Proses transfer gen dari A. tumefaciens ke dalam sel tanaman terjadi melalui beberapa tahapan yaitu (1) kolonisasi bakteri, (2) induksi sistem infeksi bakteri, (3) transfer T-DNA, dan (4) integrasi T-DNA ke dalam tanaman. Proses infeksi dimulai dari pelukaan yang menyebabkan tanaman mengeluarkan senyawa fenolik yang akan mengaktifasi gen-gen vir dimulai dengan penerimaan sinyal oleh virA. VirA merupakan protein sensor trans-membran yang diaktifasi oleh pH asam dan senyawa fenolik seperti asetosiringon. Selanjutnya virA mengaktifasi protein virG melalui proses fosforilasi. VirG berfungsi sebagai faktor transkripsi yang akan mengaktifkan ekpresi gen-gen vir lainnya (de la Riva et al 1998). Protein virG akan menginduksi ekspresi gen virD1 yang akan memotong utas T- DNA sehingga menghasilkan utas tunggal. Protein virD2 akan terfosforilasi oleh protein virD1. Asosiasi virD2 melindungi T-DNA dari aktifitas endonuklease pada ujung 5 T-DNA dan juga berfungsi membedakan ujung 5 T-DNA (right border) sebagai ujung yang akan ditransfer terlebih dahulu ke sel tanaman. Sintesis utas T-DNA dimulai dari batas kanan T-DNA dan berlangsung dari arah 5’ - 3’, kompleks utas tunggal T -DNA-virD2 dibungkus oleh protein virE. Asosiasi protein ini mencegah serangan nuklease dan berfungsi untuk membentangkan utas kompleks T-DNA sehingga mudah melewati kanal membran dan mengarahkan daerah T-DNA menuju nukleus tanaman (de la Riva et al 1998).
Baca lebih lanjut

41 Baca lebih lajut

Analisis ekologi, biologi dan sosial ekonomi untuk dasar kebijakan pengelolaan budidaya rumput laut (kasus budidaya rumput laut kappaphycus alvarezii di Pulau Nain)

Analisis ekologi, biologi dan sosial ekonomi untuk dasar kebijakan pengelolaan budidaya rumput laut (kasus budidaya rumput laut kappaphycus alvarezii di Pulau Nain)

Hal terpenting dalam penentuan kebijakan yang berkaitan dengan peluang investasi Pulau-pulau kecil (P2K) di Indonesia adalah pengetahuan akan keragaan nilai ekonomi dari P2K itu sendiri. Ini berguna untuk menentukan langkah lanjut pengelolaannya. Setiap pulau mempunyai keragaan ekonomi yang berbeda-beda, bergantung pada kondisi sumberdaya yang ada serta kondisi bio-geo-fisiknya (Fauzi dan Anna, 2005). Selanjutnya dinyatakan bahwa P2K menghasilkan barang (sumberdaya alam) yang dapat dikonsumsi, baik langsung maupun tidak langsung, dan juga menghasilkan jasa-jasa yang manfaatnya sering lebih terasa dalam jangka panjang. Sumberdaya alam yang ada di P2K, selain menghasilkan nilai ekonomi yang dapat dimanfaatkan langsung, juga memilikki nilai non-ekonomi yang memberikan manfaat terhadap keberlanjutan P2K tersebut. Manfaat-manfaat ini disebut sebagai manfaat fungsi ekologis. Potensi pemanfaatan P2K dapat dilihat dari berbagai sisi, antara lain ekonomi, sosial, ekologi, keamanan, dan navigasi. Selama ini potensi pemanfaatan belum dikelola secara optimal, mengingat ada berbagai kendala yang dihadapi. Kebijakan menyangkut pemanfaatan P2K pada dasarnya haruslah berbasiskan kondisi karakteristik biogeofisik serta sosial-ekonomi masyarakatnya, mengingat peran dan fungsi kawasan tersebut sangat penting, baik bagi kehidupan ekosistem sekitar maupun kehidupan ekosistem di daratan. Selanjutnya dinyatakan bahwa jika saja P2K ini berhasil dikembangkan dan dimanfaatkan secara optimal dan berkelanjutan, bukan saja akan menjadi pertumbuhan baru yang signifikan, tetapi juga sekaligus mengurangi kesenjangan pembangunan antar wilayah dan kelompok sosial. Wilayah pesisir P2K menyediakan sumberdaya alam yang produktif dari dua sistem lingkungan, yakni: ekosistem alamiah: terumbu karang, mangrove, padang lamun, pantai berpasir, pantai berbatu, estuaria yang semuanya bersifat alamiah, dan ekosistem buatan: kawasan pariwisata, rekreasi, konservasi, budidaya dan permukiman.
Baca lebih lanjut

290 Baca lebih lajut

Introduksi Gen Metallothionein Tipe II ke dalam Rumput Laut Kappaphycus alvarezii Menggunakan Agrobacterium tumefaciens.

Introduksi Gen Metallothionein Tipe II ke dalam Rumput Laut Kappaphycus alvarezii Menggunakan Agrobacterium tumefaciens.

Saat ini transformasi genetik yang banyak dilakukan pada microalga, umumnya menggunakan metode transformasi genetik secara langsung seperti elektroporasi, agitasi dengan glass beads dan particle bombartment. Metode transformasi menggunakan Agrobacterium memiliki beberapa keuntungan dalam metode transfer gen secara langsung. Keuntungan tersebut meliputi kemungkinan dapat mentransfer DNA yang berukuran besar, jumlah kopi transgen yang terintegrasi rendah, transgen dengan penyusunan kembali sedikit, secara sempurna dapat bergabung pada sisi aktif transkripsi dan sangat sederhana (San et al. 2011). Pada tahap transformasi embrio pemberian acetosyrngone dan glukosa pada tahap inokulasi dan media kokultivasi sangat penting untuk efisiensi transfer T-DNA, dan jumlahnya tergantung tipe dan genotipe eksplan yang digunakan (He et al. 2010).
Baca lebih lanjut

34 Baca lebih lajut

B1J009155 2.

B1J009155 2.

ii IDENTIFIKASI BAKTERI PENGOKSIDASI BESI DAN SULFUR BERDASARKAN GEN 16S rRNA DARI LAHAN TAMBANG TIMAH DI BELITUNG Oleh DHEWANTI PUSPITASARI B1J009155 Untuk Memenuhi Persyaratan Memp[r]

1 Baca lebih lajut

Analisis ekologi, biologi dan sosial ekonomi untuk dasar kebijakan pengelolaan budidaya rumput laut (kasus budidaya rumput laut kappaphycus alvarezii di Pulau Nain)

Analisis ekologi, biologi dan sosial ekonomi untuk dasar kebijakan pengelolaan budidaya rumput laut (kasus budidaya rumput laut kappaphycus alvarezii di Pulau Nain)

The declining of seaweed production in the Nain Island migh be attributed to the frequency use of seeds repeatedly for many years. In addition to the use of seeds, the declining was also due to the construction of houses on the area of cultivation. Nain Island is a semi enclosed waters so that waste can be trapped in it. The study was conducted in several stages: seaweed growth test, water quality observations, interviews, and measurement of potential contamination. The results of observations show that Nain Island water is still below the threshold limit values and quality of raw water pollution control and water quality standard for marine biota. Distribution of domestic waste has not reached the area of seaweed cultivation. The capacity of a viable operating area is 7 units per acre. Total production of Kappaphycus alvarezii in the area of 1.075,2 hectares is 4,449 tons per harvest or 26.695,2 tons per year. Firms benefit if they start the cycle in stage IV, and continued to increase. Net present value (NPV) is Rp. 102.074.976, benefit cost ratio (B/C ratio) is 1.27, and payback period for 1 year 3 months 8 days. If seaweed prices fell Rp. 10.000/kg then the NPV is Rp. 22.523.280 and B/C ratio is 1,106. If there is an increase of 25% of production costs, the project is still feasible to be developed, where the NPV is still positive (Rp. 16.988.526) with B/C ratio of 1,04. Relative efficiency values for seaweed cultivation on the Nain Island is 100%. This shows that seaweed cultivation on Nain Island has been efficient.
Baca lebih lanjut

288 Baca lebih lajut

ANALISIS KESESUAIAN LAHAN BUDIDAYA RUMPUT LAUT (Kappaphycus alvarezii) DI KABUPATEN PARIGI MOUTONG PROVINSI SULAWESI TENGAH

ANALISIS KESESUAIAN LAHAN BUDIDAYA RUMPUT LAUT (Kappaphycus alvarezii) DI KABUPATEN PARIGI MOUTONG PROVINSI SULAWESI TENGAH

nelayan tangkap. Di kawasan ini telah dibentuk koperasi yaitu Koperasi Teluk Tomini yang dapat membeli produksi rumput laut yang ada. Keberadaan infrastruktur di lokasi pene- litian umumnya belum tersedia secara baik. Kondisi jalan menuju kawasan inti minapoli- tan dalam keadaan yang tidak terlalu baik. Dukungan penyedia alat budidaya (Saprokan) belum tersedia, sebagian besar sarana budi- daya tersebut didatangkan dari Palu, Ibukota Provinsi Sulawesi Tengah. Fasilitas penunjang yang sudah tersedia di lokasi penelitian di antaranya: listrik, pengisian bahan bakar

13 Baca lebih lajut

Transformasi Gen Kappa(Κ) Carrageenase Pada Rumput Laut Kappaphycus Alvarezii

Transformasi Gen Kappa(Κ) Carrageenase Pada Rumput Laut Kappaphycus Alvarezii

Tahap pertama dalam penelitian ini, adalah pembuatan vektor ekspresi gen dan penyediaan bakteri transforman sebagai kendaraan/biotransport (Muladno 2002). Gen κ -Carrageenase (sekitar 1300 bp) dikonstruksi pada vektor pMSH (pMSH/ κ -Car) dikendalikan oleh promoter 35S CaMV (sekitar 300 bp) di bagian depan dan terminator Nos (tNos; sekitar 400 bp) di bagian left border, sehingga total ukuran dari promoter 35S, gen κ -Car, sampai dengan tNos adalah sekitar 2.000 bp. Kesuksesan transformasi pMSH/ κ -Car ke Escherchia coli DH5α (vektor kloning) dan ke Agrobacterium tumefaciens (agen transformasi), dibuktikan hasil uji pada media selektif menunjukkan koloni bakteri transforman dapat tumbuh pada media selektif, sedangkan koloni non transforman tidak dapat tumbuh. Kemampuan koloni bakteri untuk tumbuh pada media selektif menunjukkan bahwa bakteri tersebut mengandung pMSH/ κ -Car (bakteri transforman). Hal tersebut sejalan dengan Muladno (2002); Tsen et al. (2002), dan Tu et al. (2005) bahwa apabila sel bakteri transforman yang membawa DNA rekombinan (DNA plasmid dan gen insersi) ditumbuhkan pada media dengan antibiotik marka seleksi, akan mampu berkembang biak membentuk koloni, sebaliknya sel bakteri yang tidak membawa plasmid gen insersi akan mati. Hasil uji dengan PCR koloni E. coli maupun A. tumefaciens transforman menggunakan primer 35S-Forward dan Tnos-Reverse menghasilkan fragmen sekitar 2.000 bp, sesuai ukuran mulai 35S, gen κ -Carrageenase, sampai tNos. Hal ini menunjukkan transformasi gen κ -Carrageenase (pMSH/ κ -Car) ke biotranspor E. coli dan A. tumefaciens telah berhasil dilakukan dan siap digunakan lebih lanjut untuk transformasi pada K. alvarezii.
Baca lebih lanjut

73 Baca lebih lajut

KARAKTERISTIK GENETIK Kappaphycus alvarezii SEHAT DAN TERINFEKSI PENYAKIT ICE-ICE DENGAN METODE Amplified Fragment Length Polymorphism (AFLP)

KARAKTERISTIK GENETIK Kappaphycus alvarezii SEHAT DAN TERINFEKSI PENYAKIT ICE-ICE DENGAN METODE Amplified Fragment Length Polymorphism (AFLP)

Infeksi penyakit ice-ice pada Kappaphycus alvarezii seringkali menyebabkan penurunan produksi yang sangat signifikan. K. alvarezii merupakan alga merah penghasil karaginan yang memiliki nilai ekonomi tinggi dan banyak dimanfaatkan dalam berbagai industri, seperti farmasi, makanan, stabilizer, dan kosmetik. Perbaikan genetik sangat diperlukan untuk meningkatkan produksi. Penelitian ini bertujuan untuk mengetahui karakteristik kemiripan genetik K. alvarezii sehat dan terinfeksi penyakit dari Balai Penelitian dan Pengembangan Budidaya Air Payau (BPPBAP), Maros dengan metode Amplified Fragment Length Polymorphism (AFLP). Pada penelitian ini juga dianalisis K. alvarezii asal Bone (BNE), Gorontalo (GRL), Tambalang (TMB), dan Kendari (KND) sebagai kontrol rumput laut sehat. Metode AFLP menggunakan enzim restriksi Psti dan Mset, preamplifikasi dan amplifikasi selektif diawali dengan isolsi DNA, uji genimoc DNA, restriksi dan ligasi. Hasil yang diperoleh menunjukkan penggunaan marker AFLP dengan primer forward P11 dan primer reverse M48, M49 dan M50 terhadap K. alvarezii yang berasal dari Takalar (TKL), dan Mataram (MTR), tanpa infeksi (sehat) dan terinfeksi penyakit Takalar ice (TKL+), Mataram ice (MTR+), serta K. alvarezii kontrol (BNE), (GRL), (TMB), dan (KND) menghasilkan 519 fragmen dalam 122 lokus dengan ukuran 50 - ~ 370 pb. Kemiripan genetik K. alvarezii yang terinfeksi penyakit ice-ice lebih rendah jika dibandingkan dengan yang sehat. Kemiripan genetik K. alvarezii dari Takalar sehat (TKL) dan terinfeksi ice-ice (TKL+) adalah 0,8176 dan MTR-MTR+ adalah 0,8033.
Baca lebih lanjut

10 Baca lebih lajut

Hindroekstraksi Daun Ketapang (Terminalia catappa L.) sebagai Pengendali Penyakit Ice-ice pada Budidaya Kappaphycus alvarezii

Hindroekstraksi Daun Ketapang (Terminalia catappa L.) sebagai Pengendali Penyakit Ice-ice pada Budidaya Kappaphycus alvarezii

Ketapang (Terminalia catappa L.) merupakan salah satu tanaman yang dapat tumbuh di tanah yang kurang nutrisi dan tersebar sangat melimpah di Desa Palasa. Selama ini masyarakat di Desa Palasa hanya mengenal tanaman ketapang sebagai tanaman peneduh dan belum banyak dimanfaatkan sehingga nilai ekonomisnya masih rendah [14]. Ekstrak daun ketapang (T. catappa L.) diketahui memiliki sifat antimikroba karena mengandung senyawa flavonoid, saponin, triterpen, diterpen, fenolik dan tanin [15]-[16]-[17]- [18]. Ekstrak daun ketapang menggunakan metode maserasi dengan pelarut etanol dapat menghambat 70% bakteri Gram positif dan 63 % bakteri Gram negatif [16]. Penggunaan daun ketapang (T. catappa L.) sebagai ekstrak dalam skala besar tidak akan menimbulkan persaingan dengan pemenuhan kebutuhan pangan masyarakat [14]. Teknik ekstraksi terhadap daun ketapang secara maserasi, soxhlet, dan hidrodistilasi menghasilkan antimikroba yang sangat efektif, tetapi teknik ini memerlukan pelarut yang sangat mahal. Teknik ekstraksi yang lebih ekonomis sangat diperlukan untuk mengurangi biaya produksi sehingga dapat dengan mudah diaplikasikan khususnya bagi petani pembudidaya rumput laut skala kecil [19].
Baca lebih lanjut

8 Baca lebih lajut

Show all 10000 documents...