THE RESPONSE OF MASTITIS-CAUSING BACTERIA TO
GARLIC AND BLACK PEPPER EXTRACTS
MOLEFE PETLANE
GRADUATE SCHOOL
entittled;
GENETIC EVALUATION OF TLR4 AND CaLA-DRB GENES FOR MASTITIS SUSCEPTIBILITY IN DAIRY GOATS AND THE RESPONSE OF MASTITIS-CAUSING BACTERIA TO GARLIC AND BLACK PEPPER EXTRACTS
is based on my original work and produced through the guidance of my academic advisors and that neither the whole work nor part of it has been submitted for another degree at this or any other University.Where other sources of information have been used, they have been acknowledged in the text as well as in the references.
Bogor, July 2012
BAU Bogor Agricultural University
BMSCC Bulk Milk Somatic Cell Counts
BoLA Bovine Leukocyte Antigen
BPA Baird-Parker Agar
BPW Buffered Peptone Water
CaLA Caprine Leukocyte Antigen (see GoLA)
CD4 Cluster of Differentiation4
CFU Colony Forming Units
CMT California Mastitis Test
DCM Dichloromethane
DMSCC Direct Microscopic Somatic Cell Count
DMSO Dimethyl Sulfoxide
DMRT Duncan’s Multiple Range Tests
DNA Deoxyribonucleic Acid
dNTP Deoxyribonucleotide Triphosphate
DRB Designation for a region in CaLA/GoLA/BoLA/MHC
EDTA Ethylenediaminetetraacetic Acid
EMBA Eosin Methylene Blue Agar
EtBr Ethidium Bromide
FAOSTAT Food and Agricultural Organization Statistics
FDA Food and Drugs Administration
FEZL Forebrain Embryonic Zinc-Like
GLM General Linear Model
GoLA Goat Leukocyte Antigen (see CaLA)
H-W Hardy Weinberg Equilibrium
LSCS Lactation Average of Somatic Cell Scores
MDR Multi Drug Resistant
MgCl2 Magnesium Chloride
MHA Mueller Hinton Agar
MHC Major Histocompatibility Complex
MIC Minimum Inhibition Concentration
MyD88 Myeloid Differentiation88
NA Nutrient Agar
NB Nutrient Broth
NFKB Nuclear Factor-kappa-B
PAMP Pathogen Associated Molecular Patterns
PCR Polymerase Chain Reaction
PIC Polymorphic Information Content
RFLP Restriction Fragment Length Polymorphism
RNA Ribonucleic Acids
SCC Somatic Cell Count
SCS Somatic Cell Scores
SNF Solid Non-Fat
TCR T-Cell Receptor
TLR4 Toll-like Receptor4 gene
TNF Tumor Necrosis Factor
TRAF5 TNF Receptor Associated Factor6; see TNF
MOLEFE PETLANE. D151108141. Genetic Evaluation of TLR4 and CaLA-DRB Genes for Mastitis Susceptibility in Dairy Goats and the Response of Mastitis-Bacteria to Garlic and Black pepper Extracts. Supervised by RONNY R. NOOR and RARAH R.A. MAHESWARI.
Mastitis is a bacterial disease that affects mammary glands of nursing animals. It results in serious production and economic losses due to costs attached to its treatment and loss of animals through culling. This study was aimed at evaluating TLR4 and CaLA-DRB genes for mastitis susceptibility in Saanen, PE and PESA using PCR-RFLP and also to investigate the antibacterial effects of garlic and black pepper extracts on mastitis causing bacteria. TLR4 is a transmembrane protein that recognizes PAMPs, convey signals into nucleus thus causing transcription factors that inhibit primary infection while DRB is a cell surface protein that recognizes antigens and present such antigens to T-cells and CD4.
Allicin is an active ingredient in garlic; it confers antibiotic properties by interfering with the bacterial polymerase enzyme system thus inhibiting the formation of nucleic acids whereas piperine is an alkaloid that forms active ingredient in black pepper. Piperine alters the permeability of bacterial membrane and inhibits NorA efflux pump mechanism thus causing leakage and accumulation of extracellular substances into the cell which may cause cell death. A total of 68 lactating dairy goats; consisting of animals from Balitnak, Caprito farm, Cordero dairy farm and Bangun dairy farm were used in this study, the population consisted of both mastitic and healthy animals. Genetic polymorphism was detected by digesting TLR4 PCR product with AluI while DRB amplicon was digested with PstI and TaqI in two separate reactions. Antimicrobial tests were performed using agar well diffusion technique. The study found that TLR4|AluI locus was monomorphic and fixed with allele “T” in all breeds analyzed. Allele P had high frequency in PE (0.7069) followed by PESA (0.6900) then Saanen (0.6705) while allele T had high frequency in PESA (0.9205), followed by PE (0.8976) then Saanen (0.7188). DRB|PstI and DRB|TaqI loci were found polymorphic where Saanen exhibited most heterozygosity. DRB|PstI had moderate to high PIC in all breeds while DRB|TaqI had low PIC in PE and PESA. χ2 tests indicated that with the exception of DRB|TaqI locus in PE and in Saanen, all breeds were still in Hardy-Weinberg equilibrium. Staphylococcus aureus was the most frequently (80%) isolated bacteria in mastitic animals while Escherichia coli
was less frequent (<30%), thus leading to decision that S.aureus is the main etiological agent in caprine mastitis. The study also found that all genotypes are susceptible to mastitis but genotype PP and TT are comparatively more resistant as compared to other genotypes since they displayedcomparatively higher frequency of healthy animals against other genotypes. Antibacterial tests revealed that E.coli
was more sensitive to garlic while S.aureus was more sensitive to black pepper.
Keywords: Dairy goats, TLR4 gene, CaLA –DRB gene, PCR-RFLP,
DRB Genes for Mastitis Susceptibility in Dairy Goats and the Response of Mastitis-Bacteria to Garlic and Black pepper Extracts. Supervised by RONNY R. NOOR and RARAH R.A MAHESWARI.
Milk is a whitish liquid secreted by the mammary glands of female mammalian species. It provides balanced nutrition for young ones from birth until the time when they can eat solid feeds. Milk can be processed into various products like butter, cheese, yoghurt and processed milk or be used in preparation of other foods like cake and pudding, thus enhancing milk utility. Goat is among the first animals to be domesticated and it is assumed that ancient man domesticated goats for provision of milk to be consumed by him. Since domestication and the advent of technology, man strived to increase the productivity of livestock; and the industry also played a very crucial role in human nutrition and economic development.
The efforts to improve production of dairy animals are often limited by mastitis and other factors. Mastitis is caused by bacteria that enter the mammary glands, causes irritation and swellings that lead to pathological changes in the udder, alterations in milk chemical composition and reduced animal productivity. The use of antibiotics to treat mastitis does not render animals immune from next infections whilst prolonged use of antibiotics is not recommended for the benefit of animal itself and the consumers of its milk and meat.
In pursuit of mastitis therapy, genes that play a pivotal role in antigens recognition and the presentation of such antigens to T-cells and CD4 become a focal point for immunogenetics. The use of herbs to treat animal’s diseases is also gaining momentum as market interests shift from conventional farming to organic agriculture. Genes like TLR4, DRB and lactoferrin gene are reported to be associated with mastitis. Several herbs are also reported to have antibiotic properties. This study was intended to evaluate Toll like receptor4 (TLR4) and Caprine Leukocyte antigen for mastitis susceptibility in dairy goats and also to assess the antibiotic effect of garlic and black pepper extracts on mastitis causing bacteria.
TLR4 is transmembrane protein that plays a key role in innate immune system. It recognizes conserved pathogen associated molecular patterns created by bacteria, transmits signals into the nucleus to initiate transcription factors that may lead to inflammatory responses. TLR4 basically keeps primary infection under check before adaptive responses are triggered. DRB is a cell surface glucoprotein and a member of MHC genes that are entirely involved in immune responses and diseases resistance. The function of DRB is to recognize antigens and present such antigens to T-cells and CD4 for destruction. Diversity in these genes is associated better immune responses.
extracellular materials in bacteria which may lead to cell death.
This research was conducted from September 2011 to May 2012 and it was kick-started with on-farm mastitis testing using IPB1 reagent to identify candidate sample animals from which blood and milk samples were collected. A total of 68 heads of dairy goats comprised of PESA (28), PE (32) and Saanen (8) were identified, and this included both mastitic and healthy goats. This was followed by laboratory based work where DNA was extracted from the samples following phenol-chloroform method. DNA was then amplified for genetic analysis and mastitis association. All genes were amplified using standard polymerase chain reaction (PCR) procedures; where TLR4 gene (382 bp) was amplified using the following oligonucleotides F:5’- AGA CAG CAT TTC ACT CCC TC and R:3’ -ACC -ACC GAC ACA CTG ATG AT, while DRB (285 bp) was amplified using DRB1.1 F TAT CCC GTC TCT GCA GCA CAT TTC and DRB1.2 R TCG CCG CTG CAC ACT GAA ACT CTC. Concurrent with DNA extraction, milk quality parameters (somatic cell counts, protein, fat, solid non fat, lactose, salts, milk density, freezing point) were also measured; while bacteria (Eschericia coli and
Staphylococous aureus) were isolated to confirm mastitis etiology and lastly the antibacterial activities of garlic and black pepper were tested on E. coli and S.
aureus using agar well diffusion method.
Genetic analysis showed that TLR4 gene was monormophic at TLR4|AluI restriction site, making it a poor genetic marker for mastitis resistance or susceptibility studies. DBR|TaqI and DRB|PstI loci were found polymorphic with three genotypes. At DRB|PstI locus, PE had the highest frequency of P allele (0.7069) followed by PESA (0.6900) and Saanen (0.6705) whereas on the other hand PESA had the highest frequency of T allele (0.9205) followed by PE (0.8976) and Saanen (0.7188) at DBR|TaqI locus.
Heterozygosity analysis showed that Saanen has high Hobs (0.4773), followed by PESA (0.4600) and PE (0.4483) for DRB|TaqI loci whereas at DRB|TaqI loci, Saanen (0.2708) was the most heterozygous, followed by PE (0.1325) and PESA (0.1136). All breeds are still in Hardy-Weinberg equilibrium with the exception of Saanen and PE at DRB|TaqI loci.
Saanen had high prevalence of mastitis, followed by PESA and PE. Homozygous recessive genotypes (pp and tt) were not available in samples used for genotype-mastitis association, while heterozygous genotypes (Pp and Tt) were less frequent among healthy animals as compared to homozygous dominant genotypes (PP and TT). This led to conclusion that PP and TT genotypes are comparatively resistant.
Bacteriological tests showed that caprine mastitis was caused mostly by
S.aureus because it was isolated in more than 80% of the mastitis cases whereas
E.coli was isolated in less than 30% cases. Antibacterial tests showed that E.coli is more sensitive and inhibited more by garlic while S.aureus was more responsive to black pepper. In mixed concoctions, both E. coli and S.aureus were inhibited with bigger zones as compared to straight extracts at the same concentration.
Keywords: Dairy goats, TLR4 gene, CaLA –DRB gene, PCR-RFLP,
© Copyright of IPB, year 2012
Copyright reserved
1. No part or all of this thesis may be excerpted without inclusion or
mentioning the sources
a. Excerption only for research and education use, writing for scientific papers, reporting, critical writing or reviewing of a problem
b. Excerption does inflict a financial loss in the proper interest of Bogor Agricultural University
THE RESPONSE OF MASTITIS-CAUSING BACTERIA TO
GARLIC AND BLACK PEPPER EXTRACTS
MOLEFE PETLANE
A Thesis Submitted to the Graduate School
in Partial Fulfillment of the Requirements for the Degree of
Master of Science
In
The Department of Animal Production Science and Technology
GRADUATE SCHOOL
External Examiner for Thesis Final Examination
Garlic and Black pepper Extracts.
Name : Molefe Petlane
Registration Number : D151108141
Approved
Advisory Committe
Prof. Dr. Ir. Ronny Rachman Noor, MRur.Sc Dr.Ir.Rarah.R.A.Maheswari, DEA
Supervisor Co-supervisor
Agreed
Head of Study Programme/ Major Dean of Graduate School, IPB Animal Production Science and Technology Secretary Masters Program
Dr. Ir. Rarah R. A. Maheswari, DEA Dr. Ir. Dahrul Syah, M.Sc. Agr
protection, grace, strength and wisdom to go through this academic training. I would also like to send my sincere gratitude of appreciation to the government of the Republic of Indonesia for giving me this opportunity to further my studies in Indonesia under the Developing Countries Partnership Scholarship; and the government of Kingdom of Lesotho for allowing me to further my studies.
Next I would like to thank my mother, Theresia Moliehi ‘Maphiri Petlane for her upbringing, love and all the support she gave throughout my life and education endeavors. Also, I highly need to thank my wife, Ntsebo Sempe-Petlane and our kids Mosa and Rorisang as well as my brothers and sisters for their invaluable support throughout my studies. Without their support which was a motivation to me, I would have not pursued this degree or survived in Indonesia. To my kids, I know you missed my presence and I am sorry.
I would also like to express my deepest gratitude to my academic supervisors, Professor Dr. Ir. Ronny Rachman Noor, MRur.Sc. and Dr. Ir. Rarah R.A Maheswari, DEA for their excellent guidance, caring, patience and provision of excellent and fruitful atmosphere for my academic and social development. Dr Rarah, you have been more than an academic advisor, but also parent, a mother, a motivator and a friend through thick and thin. I also wish extend my thanks to Dr. Ir. M. Yamin M. Agr. Sc. for invaluable contribution as external examiner during my thesis examination.
I would also like to convey my greatest thanks to the following dairy goats farm managers and owners for allowing me to conduct my study in their farms:
1) Professor Muladno Basar and his family; your parental guidance and care within and outside the academic arenas are invaluable. The activities you organized for international students really made us not feel lonely and lost during academic holidays.
2) Professor Cece Sumantri; Prof, you have been a true parent and a motivator to me and without your support genetics could have been really difficult for me.
3) Dr Jakaria Thabrani; Bapak Jak, you have been a lecturer as well as a friend, offering a very conducive stance for discussion on academic issues and life in general.
I would also like bow in honor of professionalism displayed by IPB administration staff that was involved in welcoming and induction of international students in 2009/2010 academic year. Mrs. Anisa M. Anwar, Mr. Soleh Hidayat and Dr Mukhulas your love, guidance, smile and laughter made me settle in Indonesia. Occasionally, I stepped on your toes, but it was not intentional.
Sarwar Khan (S. Pt), Ribka (S.Pt). Guys, without your invaluable support this research project could have been a fiasco or so slow if ever materialized. May God bless you; enrich you with wisdom and luck.
the fifth child out of six (four boys and two ladies) from ‘Tsoeu Edward and Maphiri Theresia Petlane.
I got my elementary education at Masianokeng Primary School from 1986 and passed primary school leaving examinations (PSLE) with first class in 1992. I proceeded to Masianokeng High school in 1993 where I passed Junior Certificate (JC) with first class in 1995 and then continued with high school education at the same place and sat for Cambridge Overseas School Certificate (COSC) examination in 1997 and obtain second class pass. In the year 1999, I was admitted into The National University of Lesotho (NUL) to pursue Bachelor of Science in Agriculture (B.Sc. Agric) from 1999- 2003 where I obtained second class second division (2 ii) pass.
After graduating from NUL, I worked with the ministry of education as a teacher at several high schools between July 2003 and December 2004 after which I worked with the ministry of agriculture and food security as an extension agent from 2005 – 2006. In the year 2006, I transferred to Lesotho Agricultural College (LAC) where I am currently working as an instructor in the Department of Animal Science.
During my service in the Lesotho Government, I have been active as sports administrator at Mount Tabor High School and LAC. I also served as an examiner for biological sciences in tertiary schools; as a judge in national central agriculture shows and participated in several community development projects.
LIST OF FIGURES ... v
Mastitis and Mastitis Therapy... 9
Toll-like Receptor4 Gene ... 11
Major Histocompatibility Complex Genes: DRB Region ... 13
Antibiotic Properties of Garlic ... 15
Antibiotic Properties of Black pepper ... 17
METHODOLOGY ... 19
Time and Place ... 19
Material ... 19
Animals and DNA Samples ... 19
Testing Mastistis Milk Quality Parameters ... 20
Milk Quality Parameters ... 20
Antibacterial Tests……… ... 20
Garlic and Black pepper... 20
Agar Well Diffusion and Minimun Inhibition Concentration 21 Methods DNA Extraction ... 21
CaLA DRB and TLR4 Amplification ... 21
Genotyping and Electrophoresis ... 21
Testing for Mastitis Milk Quality Parameters ... 22
Determination of Somatic Cell Counts & Somatic Cell Scores 23 Isolation of Bacteria and Bacterial Enumeration ... 23
Extraction of Garlic and Black pepper ... 24
Antimicrobial Tests ... 24
Data Analyse Genetic Data Analysis ... 25
Polymorphism Information Content (PIC) ... 26
Inhibitory Effect of Garlic and Black pepper Extracts on
Bacteria ... 27
RESULTS AND DISCUSSION... 29
PCR Amplification, Genotyping and Genetic Analysis ... 29
Genotyping, Allele and Genotype Frequencies ... 35
PIC and Mastitis ... 35
Mastitis Prevalence ... 35
Testing Mastitis ... 41
Somatic Cell Counts and Somatic Cell Scores ... 41
Isolation and Enumeration of Bacterial (E. coli ans S. aureus) .... 44
Bacteriological Enumeration ... 45
Correlation Matrix between SCC and Milk Quality Parameters .. 46
Antimicrobial Suseptibilty Test and Minimum Inhibition Concentration Determination ... 48
Minimum Inhibition Concentration ... 52
Discussion ... 54
CONCLUSION AND RECOMMENDATION ... 57
REFERENCES ….. ... 59
1. Blood and milk samples ... 19
2.Total DNA samples ... 20
3. Primers and the conditions used for DNA amplification ... 20
4. Garlic and black pepper extracts concentration ... 24
5. Goat milk grading according to Thai Agricultural Standards ... 27
6 TLR4|AluI locus allele and genotype frequencies analysis ... 33
7. DRB|PstI locus allele and genotype frequencies analysis ... 34
8. DRB|TaqI locus allele and genotype frequencies analysis ... 34
9. Heterozygosity, H-W and PIC values per locus and breed ... 34
10. Analysis of mastitis prevalence and rating in Saanen DRB locus ... 35
11. Analysis of mastitis prevalence and rating in PESA DRB locus ... 36
12. Analysis of mastitis prevalence and rating in PE DRB locus ... 36
13. CaLA –DRB alleles expression frequencies by mastitis status ... 37
14. Analysis of SCC and SCS by breed ... 37
15. Analysis of SCC and SCS by breed and health condition ... 39
16. Analysis of DRB|PstI locus for SCC per breed ... 39
17. Analysis of DRB|PstI locus for SCS per breed ... 39
18. Analysis DRB|TaqI locus for SCC per breed ... 40
19. Analysis of DRB|TaqI Locus for SCS per Breed ... 40
20. Pearson correlation values and their P values for milk quality factors 47 21. Comparison of quality factors between healthy and mastitic animals ... 48
22. Analysis of means for diameter of inhibition of garlic on E. coli and S. aureus ... 48
23. Analysis of means for diameter of inhibition of black pepper on E. coli and S. aureus ... 49
24. Means of diameter for inhibition zone for garlic and black pepper interaction on E.coli and S.aureus ... 51
2. Etawah Grade Goat (PE) goat with twin kids ... 8
3. Saanen goat ... 8
4. PESA goats ... 9
5. TLR4 gene signaling pathway ... 11
6. TLR4 gene structure and its sequence ... 13
7. MHC II receptor signaling pathway ... 14
8. MHC showing DRB and sequence for the region to be amplified . 15 9. Garlic plant (A) and its edible gloves (B) ... 16
10.Generation of allicin ... 17
11. Inhibition of nucleic acids synthesis by allicin ... 17
12.Black pepper seeds ... 17
13.The structure of piperine... 18
14.TLR4 PCR amplification product (382 bp) ... 29
15.DRB PCR amplification product (285 bp) ... 29
16.RFLP product for TLR4|AluI ... 30
17.TLR4 PCR product sequence showing primers, annealing & restriction sites for AluI ... 30
18.The RFLP product for DRB|PstI... 31
19.DRB amplicon sequence showing primers, annealing & restriction sites for PstI ... 31
20.RFLP product for DRB|TaqI ... 31
21.DRB amplicon sequence showing primers, annealing & restriction sites for TaqI ... 32
22.Mastitis test results. A) mastitis negative milk (Score 0), B mastitis 1 milk, C) mastitis 2 and D) mastitis 3 ... 41
1. Protocols for extraction of DNA from samples stored in absolute
7. Descriptive summary for bacterial population enumeration ... 74
8. T- test results for SCC and SCS between breeds... 75
9. T test for SCC and SCS by breeds and health status ... 76
10. T test on SCC and SCS for DRB|PstI locus per breed... 77
11. T tests on SCC and SCS for DRB|TaqI per locus per breed ... 78
12. T-tests on milk quality parameters between healthy and sick animals 81 13. ANOVA on effect of garlic on E. coli using GLM procedure of SAS system ... 82
14. ANOVA on effect of garlic on S. aureus using GLM procedure of SAS system ... 82
15. Analysis of means of inhibition zone (±SD) for garlic on E.coli and S.aureus using SAS/DMRT ... 82
16. ANOVA on effect of black pepper on E. coli using GLM procedure of SAS system ... 82
17. ANOVA on effects of black pepper on S. aureus using GLM Procedure of SAS System ... 82
18. Means for inhibition zone (±SD) for Black pepper on E.coli and S.aureus using SAS/DMRT ... 83
19. ANOVA on Bacteria Inhibition zone using GLM proc of SAS System (9.1) ... 83
20. Comparison of interaction means for inhibition zone (±SD) for On E. coli using SAS System/DMRT ... 83
21. Comparison of interaction means for inhibition Zone (±SD) on S.aureus using SAS System/DMRT ... 84
INTRODUCTION
Background
Milk is as ancient as mammals as it is the substance created to feed the young ones of mammalian species. It provides a balanced nutrition for young ones from birth until the time when they can eat solid feeds. It is assumed that ancient man learned to domesticate animals for the provision of milk to be consumed by him. He domesticated animals such as cows, sheep, buffaloes, camels and goats; of which all or some of these animals are still used for production of milk in various parts of the world. Domestic goat (Capra hircus) is among the first animals to become domesticated and it is derived from its wild ancestor called bezoar (Capra aegargus). In 2008, the world’s goats population was estimated to be 861. 2 million; of which 59.7% was in Asia, 33.8% in Africa, 0.4 % in North America, 2.1 % in Europe, and 0.5% in Caribbean and the population was estimated to be growing at the rate of 3.5 % per year (FAOSTAT 2009). In Indonesia, the goats’ population is estimated to be 1, 682, 100 heads of goats in the year 2010, and the population has increased from 13, 409, 300 over the last five years (FAOSTAT 2010). The current milk productions estimate is 281328 tonnes of milk while the total production for dairy cows is 912, 800 tonnes from a population 13, 633, 000 cows.
Since domestication and the advent of technology, livestock industry has played a very tremendous role in human nutrition and economic development. In particular, dairy industry provides milk which can be processed into various products like butter, cheese, yoghurt and processed milk. Milk can also be used in preparation of other several foods like cake and pudding, thus enhancing milk utility.
However, regardless of the efforts made to improve production potential of livestock, the level of production for dairy animals is often limited by diseases and other factors. Mastitis is one of the diseases that frequently affect mammary glands of dairy animals. It is a major social and economic problem across all dairy animals throughout the world. It causes inflammation of the mammary glands as a result of introduction and multiplication of pathogenic microorganisms such as
Staphylococcus aureus, Escherichia coli and Streptococcus agalactiae in the
mammary glands. It leads to animal suffering and distress, reduced animal performance and death in extreme cases. Diagnostic and control measures include on-farm screening of lactating goats using California Mastitis Test (CMT) or IPB1 to detect variations in milk somatic cells counts (SCC), qualitatively monitor mastitis rates within the herd and treating pathological changes in mammary tissue (Gianneechini et al. 2002). In Indonesia mastitis is estimated to occur at the rate of 75% - 83% accompanied by 45% reduction in milk quantity and 40 % reduction in quality (Sudarwanto et al. 2006, Sudarwanto 1999) and the costs associated to mastitis are estimated around Rp 3 000 000 per animal per annum (Akira 2009). For that reason, it is imperative to make every effort to maintain mammary glands of farm animals in good conditions.
the body, and genes that present such antigens to T cells and CD4 for destruction are being intensively investigated in cows. Genes such as lactoferrin, bovine leucocyte antigen, toll-like receptor genes, interleukin genes and others have been studied and suggested as possible candidate genes for mastitis resistance. Studies that focused on herbs reported garlic, black pepper, Nigella sativa (Jintan hitam),
Piper betle and other herbs to display antibiotic properties. This research was conducted to investigate the relationship between the genetic polymorphism of TLR4 and DRB genes and susceptibility to mastitis in dairy goats and also to study the response of mastitis causing bacteria to garlic and black pepper extracts.
Rationale for Study
Knowledge on genetics of Caprine mastitis is still superficial because most of the researches conducted so far addressed bovine mastitis while other dairy animals received little attention. This study was basically conducted to address
Caprine mastitis in pursue of a breakthrough into genetic and herbal therapy of mastitis.
Purpose of the Study
1. To find the association between the genetic variability of TLR4 (exon 3) and CaLA-DRB genes with susceptibility to mastitis in dairy goats.
2. To determine the effectiveness of herbs (garlic and black pepper) on treating and harnessing the activity of mastitis causing bacteria.
Benefits of the Study
The results of this study will serve as the baseline for selection and breeding programs that aim at incorporating production traits and traits related to animal health into selection criterion. It will also serve as a precursor to necessitate additional and advanced in vivo research on the activity of herbs on mastitis.
Statement of the Problem
The aim of this study was to answer the following questions;
2. Can garlic and or black pepper be used to inhibit and or arrest the activity of mastitis causing bacteria?
Hypothesis
The study assumed that there are mutations in the wild alleles of TLR4 and or DRB genes that result in allelic variants that are incapable of recognizing the activities of pathogenic bacteria and their resulting antigens which leads to failure to present such bacteria to T-cells and CD4 for destruction which leads to higher infection rates, escalated SCC and finally reduced production. Then the study hypothesized that:
1. Some TLR4 and or CaLA-DRB gene variants have resistance to mastitis. 2. Garlic and or black pepper have effect on the activity of bacteria.
Scope of Study
The study mainly focused on two issues viz;
1. CaLA-DRB and TLR4 genes variability and their association with SCC and mastitis susceptibility.
Figure 1 Schematic presentation of the steps to be followed in the research.
LITERATURE REVIEW
Goat Milk and Dairy Goats
Goat milk is a popular beverage among the health conscious communities, infants and people with cow’s milk allergy (Ballabioet al. 2011, Bellioni-Businco
et al. 1999) because it does not cause allergic reactions like cow’s milk. Cow’s milk allergies are often accompanied by Immunoglobulin E (IgE) reactions like asthma, vomiting and diarrhea (Lara-Villoslada et al. 2005). Milk casein and whey proteins become important biologically active chemical components in milk and their relative proportions determine the allergenicity of cow’s milk (Park 2009, Ballabio et al. 2011, Lara-Villoslada et al. 2005). The bio-active peptides in milk are alleged to have several functions which include antimicrobial activities, anticytotoxic, antioxidative and mineral carrying activities and all these functionalities are exploited when protein is digested (Park 2009).
Compared to cow’s milk, goat milk does not cause allergic reactions and is alleged to posses some therapeutic properties in humans thus making it a unique commodity. Casein and β-lactoglobulin (a major whey protein in cow’s milk) are major causes of allergic reactions whereas its medicinal properties are attributed to its fat (Park 2009). Goat’s milk has higher content of short and medium-chain length fatty acid globules rendering it easy for digestion and absorption as compared cow’s milk fat. It is also reported to have better buffering capacity as compared to cow’s milk. Because of all this benefits, goat’s milk is normally sold at higher price as compared to cow’s milk and hence it has been an important commodity in human nutrition and economic value in developing counties where cows are considered expensive to keep.
Etawah Grade Goat (PE)
production systems (Sodiq et al. 2003). It is a composite breed descended from Indonesian local goats and Jamnapari goat that was introduced from India around 1920s (Devendra & Burns, 1983). A mature female animal has the height of 70-80 cm, and weighs 40-45 kg while a mature male weighs a round 80-100 kg.
Figure 2 Etawah Grade (PE) goat with twin kids
Saanen Goat
Saanen (Figure 3) is the most popular and widely distributed breed of dairy goat that originates from the Saane valley in Switzerland. Phenotypically, Saanen is the largest of all dairy goat breeds. It has short fine hair, white to creamy white coat color and the white color is more preferred. The ears are erect and may point forward (Gillespie & Flanders 2009). It is the highest milk producer. Mature does weigh around 68 kg and measure 75 cm at the withers while the adult male weighs 80-91 kg and measures around 90 cm at withers (Solaiman 2010; Devendra & Burns 1983).
PE and Saanen Crossbreed (PESA)
PESA (Figure 4) is a cross breed descended from PE and Saanen with the aim of exploiting heterosis (Zurriyati 2010). It has a big udder like as seen on the figure below. This research did not secure milk production data, however farmers report that PESA production is above the average of its parents. Phenotypically, PESA has long droopy ears, dominantly white colors get more preference although it may have some shadings of brown color on the back as it is a composite breed from PE and Saanen (Figures 2 and 3).
Figure 4 PESA goats.
Mastitis and Mastitis Therapy
Mastitis
status of mammary glands where the price of milk is inversely related to SCC. Mastitis also reduces longevity and the number of progenies that can be successfully reared. It also poses thread to human life when viable pathogens and their toxins and large numbers of bovine neutrophils are ingested by man through unpasteurized or improperly pasteurized milk because man can get zoonotics Sharma et al. (2011).
Inclination to get infected with mastitis is a function of both individual’s genetic make-up and the environment. Holding the environment constant, it is well documented that animals co-existing in the same place have different degree susceptibility to mastitis. In the experiment to analyze breed dependent responses to E.coli, in Jersey and Holstein cows, Bannerman et al. (2006) reported that there were no significant differences in overall infection rates between Jersey and Holstein cows, however temporal responses indicated that Jersey showed earlier and better adaptive responses against Holstein cows whereas Sung et al (1999) reported significant differences in susceptibility to mastitis in dairy goats where Alpine and Saanen showed lower somatic cell counts as compared to Toggenburg and Nubian in Taiwan, which indicates that Alpine and Saanen were better adapted to Taiwan conditions. This generally implies that dairy animals that are adapted to temperate climate conditions like Saanen are also more likely to develop mastitis when they are brought to tropical places like Indonesia or vice versa.
Mastitis Therapy
Toll-like Receptor4 Gene
Toll like receptors (TLRs) is a group of genes that play a key-role in innate immune system by recognizing conserved molecules on the surface of microbes. TLRs group (Figure 5) and its mammalian relatives are transmembrane proteins involved in conveying antigen signals into the cell. They form a base for strong and responsive immune system as the ability of an organism to fight infections entirely depends on its immune to recognize pathogens and presented such pathogens to CD4 and or T-cells for destruction. TLRs are expressed indiscriminately at the site of infection where their main function is to harness primary infection. They perform their duty through the help of their extracellular recognition ligand that binds to specific pathogen-associated molecular patterns (PAMPs), then intracellular domain cascades signals through MyD88, IRAK, TRAF6 and NFKB adaptors into the cell thus initiating signaling events that will begin translocation of transcription factors that stimulate inflammatory responses and or release of antimicrobial agents (Jungi et al. 2010).
Source: Takeda & Akira (2004).
Figure 5 TLR4 receptor gene signaling pathways.
that functions like MyD88 in mammals (Jungi et al. 2010). This implies that whenever a pathogen attacks host, the host will trigger innate immune responses chiefly to keep the pathogen under control before specific immunity that consists of antibodies and immune cells can fight the pathogen more precisely.
TLRs recognize pathogen-associated molecular patterns (PAMP) among various classes of chemical molecules within and between pathogens (Takeda & Akira 2003). The molecules of this gene also serve as a link between innate and mechanisms of the adaptive immune system. Thus TLRs and their specific adaptors can be exploited to transform innate immune responses so culminating in a more beneficial outcome to the host.
In a study where TLR4-knockout mice were used as treatment it was discovered that mice were hypo-responsive to lipopolysaccharide (LP) which led to conclusion that TLR4 genes are responsible for activation of innate and adaptive immune responses in vertebrates (Hoshino et al. 2010, Wang et al.
2007). To date, more than ten (10) types of TLR4 have been identified and all of them perform the same work of recognizing conserved lipopolysaccharides (LPs) pattern of bacteria but specializing in specific pathogens (De Schepper et al.
Source: www.ncbi.nlm.nih.gov/nuccore/HM627213.2; Accession: HM627213.2 Figure 6 TLR4 gene structure and sequence.
Major Histocompatibility Complex Genes: DRB Region
Major histocompatibility complex (MHC) (Figure 7) genes form a complex or a group of genes that encode molecules that are intimately involved in control of immune responses and diseases resistance (Axford et al. 2000). They form cell surface molecules made of glycoprotein and they play a central role in regulation of the immune response through their ability to bind foreign antigens and present them to T-cell receptors. They are known for their large number of genes and diversity in alleles found in most vertebrates. These genes are divided into three classes (Figure 8) of which classes I and II genes exhibit most genetic variation that play central role in pathogens and parasites recognition (Baghizadeh et al. 2009). The signals detected by the MHC receptors (Figure 7) that are located on the cell surface are send through the nuclear membrane via cytoplasm into the nucleus where they are decoded by T-cell receptors (TCR) and the cluster of differentiation4 (CD4) to initiate appropriate transcription factors for relevant adaptive immune responses.
Source: Goodsell D. 2005 .T cell Receptor. doi: 10.2210/rcsb_pdb/mom_2005_3 www.rcsb.org/pdb/101/motm.do?momID=63
Figure 7 MHC II receptor signaling pathway.
MHC genes had been reported polymorphic in exon 2 of class II of cattle, sheep, goat, pig and dog (Baghizadeh et al. 2009). The caprine lymphocyte antigen (CLA) or goat lymphocyte antigen (GoLA) system has been reported to have homology with BoLA (Bovine leukocyte antigen) in that they both express class II antigens, viz DQ and DR.
The studies that explored genetics of mastitis reported several genes like IgG2a (Conington et al. 2005), IgG2, TRL4 (Sharma et al. 2006; De Schepper et al. 2007) and MHC-DRB (Mukoyama et al. 2009; Firouzamandi et al. 2010; Kelm et al. 1997; Axford et al. 2000) as possible candidate genes for mastitis resistance because of their high polymorphism and association with other innate immune-pathways. Sugimoto et al. (2006) also reported that forebrain embryonic zinc finger-like (FEZL) receptor influence responses associated to mastitis and demonstrated that its activation happens through TLR4 signaling route pathway.
worthy for mastitis resistance. These findings were similar to that of Swiderek et al. (2006) where they studied DRB polymorphism and its association with SCC is ewes.
Source: www.ncbi.nlm.nih.gov/nuccore/1332452. Accession: X83367
Figure 8 MHC showing DRB and sequence for the region to be amplified.
Antibiotic Properties of Garlic
Several studies that focused on plants that have antibacterial activities indicated that garlic (Allium sativum L.) and black pepper (Piper .nigrum L.) can inhibit bacterial growth (Poeloengan & Komala 2009; Avancini et al. 2008; Ruegg 2009; Karsha & Lakshmi 2010, Safithri et al. 2011). Garlic is also reported to show antibacterial activity on multi drug resistant (MDR) bacteria that cause most troublesome diseases to man. However, even though there is no single herb documented to have successfully treated or cured mastitis; organic farmers in Wisconsin (USA) have used garlic tinctures to treat mastitis (Ruegg 2009).
propagation. Garlic is widely distributed around the world and it is believed that it originates from Egypt while most of the cultivated species with high diversity are distributed in Central Asia and Pakistan (Brewster 2008; Rabinowitch & Currah 2002).
Source: http://www.wegrowgarlic.com
Figure 9 Garlic plant (A) and its edible cloves (B).
Based on molecular approach, garlic is taxonomically classified under class;
Liliopsida (Monocodyledons), Order; Asparagales (Amaryllidales) where all
monocots herbs belong, family; Alliaceae, genus; Allium and the specie sativum
(Friesen et al. 2006, Rabinowitch & Currah 2002). The genus has approximately seven hundred and fifty (750) species which include onions, leek, chives and garlic etc.
Diallyl thiosulfinate commonly known as allicin is a volatile sulphur
compound that forms active ingredient in garlic (Coleby et al. 2002, Jabar & A-Mossawi 2007). Allicin (Figure 10) is a product of alliinase (alkyl-sulfenate-lyase) and non protein amino acid called alliin (S-allylcysteine S-oxide) (Feldberg et al.
Source: Ankri & Mirelaman (1999). Figure 10 Generation of allicin.
According to Feldberg et al. (1988) and Ankri & Mirelaman (1999),
allicin’s antibacterial properties are attributed to its ability to interact with several enzymatic pathways thus inhibiting some fundamental process within some pathogenic agents whereas in bacteria it interfere with polymerase reactions leading to reduced DNA and RNA synthesis (Figure 11), where greatest effect is shown on RNA inhibition (Figure 11, A)
Source: Feldberg et al. (1988).
Figure 11 Inhibition of nucleic acids formation by allicin. A) RNA synthesis, B) DNA synthesis.
Symbols: *-* indicates control while o-o indicates cells treated with allicin.
Antibiotic Properties of Black Pepper
approximately five (5) millimeters in diameter when fully grown up. Literature suggests that black pepper originates from India, where there are still more commercially and medicinally important species (Joy et al. 2007).
Black pepper belongs to order; Piperales Family; Piperaceae,genus; Piper
and the specie is nigrum. According to Joy et al. (2007) nigrum is tetraploid (n = 13) while other pipper members are diploid. Piperine (Figure 13) is a nitrogenous compound belonging to alkaloid and it is responsible for antibacterial activity in black pepper (Chaudhry & Tariq 2006).
Source:www.21food.com/products/sarawak-faq-black-pepper-596558.html Figure 12 Black pepper seeds.
Piperine exercises its antibiotic properties by altering the permeability of bacteria membrane thereby allowing leakage of extracellular materials which may cause cell death (Karsha & Lakshmi 2010) whereas Sangwan et al. (2008) and Kumar et al. (2008) indicated that piperine inhibits NorA efflux pump in S.
aureus; where NorA pumps out toxic substances inside bacteria.
Source: Dyer & Palmer (2004)
METHODOLOGY
Time and Place for Research
The research commenced on September 2011 and ended on June 2012. It was conducted at Bogor Agricultural University (BAU); in Animal Molecular Genetics Laboratory and Milk Science Laboratory of the Faculty of Animal Science. The samples (blood and milk) analyzed in this research study were collected from Livestock Research Institute (Balai Penelitian Ternak) in Bogor, Cordero farm in Ciapus, Caprito dairy goats’ farm in Cariau and Bangun dairy farm in Cijeruk.
Mastitis tests were performed at farm level whereas genetic analysis was done in Animal Molecular Genetics Laboratory while milk analyses were performed in the Laboratory of Milk Science and Technology of the Faculty of Animal Science (FAPET- IPB).
Materials
Animals and DNA Samples
The research was conducted using sixty eight (68) dairy goats (Table 1) from which blood and milk samples were collected. DNA was extracted from both blood and milk samples then used to associate genotypes with mastitis susceptibility while genetic variability within dairy goats sub populations was analyzed using a collection of DNA samples (Table 2) from Animal Molecular Genetics Laboratory and DNA samples extracted during this study.
Table 1 Blood and milk samples
Breed Saanen* PESA Etawah Grade (PE)
--- (heads) ---
Balitnak - 7 5
Cordero Farm - - 21
Caprito Farm - 21 4
Bangun farm 8 2
Total 8 28 32 68
*The animals named Saanen used in association studies are not pure Saanen, rather F1 of male Saanen
Table 2 Total DNA samples
Goats sub population Total DNA (sample)
Saanen 53
Table 3 Primers and the conditions used for DNA amplification Locus Annealing
temperature
PCR
product Primer sequence TLR41 57.0 oC 382 bp F:5’R:3’-AGACAGCATTTCACTCCCTC -ACCACCGACACACTGATGAT
CaLA-DRB2 60 oC 285 bp DRB1.1 F TATCCCGTCTCTGCAGCACATTTC DRB1.2 RTCGCCGCTGCACACTGAAACTCTC
Milk quality parameters were tested using electronic milk analyzer (Milko tester, Master Pro) where proteins, fat, salts, freezing temperature solid non fat and density were recorded. Somatic cells counts and bacterial contamination were also determined according to Petersson et al. (2011) & www.fda.gov respectively.
Antibacterial Test
Garlic. Fresh and healthy garlic (Allium sativum) was used for extraction, and then the extracts were used for antibacterial tests.
Black Pepper. Fresh black pepper (Piper nigrum) seeds were used for
Agar Well Diffusion Method and Minimum Inhibition Concentration (Liasi
et al. 2009). The following materials and equipment were used for determining
inhibition the zone diameter: petri dish, pipettes, laminar air flow, vernier caliper, incubator, autoclave, vortex, Mueller Hinton Agar (MHA), Nutrient Agar (NA) and test tubes.
Methods
DNA Extraction
Genomic DNA was extracted from whole blood and milk samples. Blood samples were extracted following phenol-chloroform method (Sambrook & Russell 2001) modified for blood sample stored in alcohol (Appendix 1).
CaLA-DRB and TL4 Fragments Amplification
A total of 204 DNA samples (Table 1 & 2) were amplified for this study. Both CaLA-DRB (285 bp) and TLR4 (382 bp) genes fragments were amplified using polymerase chain reaction (PCR). PCR reaction volumes were 15 µ l; and the amplification cocktail was made of 1 µ l of DNA sample (50 ng/µ l), 0.3 µ l of forward and reverse primer (25 pmol/µ l), 1 µ l of MgCl2 (1 mM), 0.3 µ l of dNTPs (200µM) and 0.05 µl of Taq polymerase (0.5 units) and 1.5 µl of 10x Dream Taq buffer™ (Tris-HCL 100 mmol/L) then all were diluted with distilled water upto 15 µl.
TLR4 amplification was cycled for 5 minutes at 95 oC during denaturation, 0.45 seconds at 57oC for annealing, 1 minute at 72 oC during extension while most DRB was cycled for 5 minutes at 95 oC during denaturation, 0.45 seconds at 60 oC for annealing, 1 minute at 72 oC during extension. Amplification was cycled for thirty five (35) cycles for both genes. GeneAmp® PCR system 9700 Applied Biosystem was used for amplification process.
Genotyping and Electrophoresis
cuts at CTGCA|G) at 37 oC for 16 hours, while the other half was digested with 3 units of TaqI at 65 oC for 16 hours as well. TaqI enzyme recognizes T|CGA sequence and between T and C.
The RFLP digestion products were then separated on 2% agarose gel/ 0.5X TBE (tris borate EDTA) stained with ethidium bromide (EtBr) (2.5 µl) and calibrated with 100 bp ladder marker for all genes. Electrophoresis chamber was then run on 100 Volts power supply for forty minutes. The gels were finally visualized under UV transilluminator.
Testing for Mastitis and Milk Quality Parameters
Mastitis Testing. Lactating goats were tested for mastitis using IPB1 reagent following CMT protocols; where approximately two milliliter (2 ml) of milk from each quarter was milked into mastitis paddle, and then the same amount of IPB1 reagent was added. The reagent and milk were mixed by a swirling movement for 10-30 seconds and the mix was immediately observed for gelling as a sign of mastitis. The standard California mastitis test concept was followed to interpret the results based on gelling properties where mastitis negative milk does not show any gelling while mastitis positive milk will form gel like substance. Based on the degree of gelling mastitis was classified on the scale of 1-3, where;
Healthy animals- No gel is formed when milk is mixed with IPB1.
Mastitis 1- Weak gelling is formed that disappears with continued swirling,
Mastitis 2- A thicker gel that collects in the center is formed; it pours out leaving some little milk behind;
While Mastitis 3 forms a very thick gel that collects at centre of the cup and pours out without leaving anything.
However, care should be taken as milk from goats in late pregnancy and postpartum animals may be misinterpreted to be mastitis positive.
Milk quality factors and milk composition included, protein content (%), fat content (%), lactose (%), salts (%), solids non fat/SNF (%), freezing temperature (oC), milk density and SCC.
Determination of Somatic Cell Counts and Somatic Cell Scores
Somatic cell count (SCC) was determined using direct microscopic somatic cell count (DMSCC) procedure (Petersson et al. 2011). Milk sample (0.01 ml) was put on a glass slide and then spread evenly within the area of 1 cm2 and then air dried. The sample was then fixed on the slide by heating over the bunsen burner. The slides were then put in ether alcohol for approximately 1-2 minutes to remove fat followed by staining with methylene blue loeffler. Excess dye was removed by washing the slides with water. The slides were then dipped in alcohol (96 %) approximately for five (5) minutes to remove excess dye then followed by drying and counting total SCC. The slides were viewed under the microscope for counting, where counts were made on 30 spots along the line to avoid double somatic cell counting and the average SCC was determined and finally converted to total SCC per millimeter of milk (SCC/ml). The only limiting factor is the absence of universal agreement on the threshold SCC beyond which animals can be considered mastitis positive because some countries use a threshold of 7.5 *105 SCC/ml of milk whereas others use 106 SCC/ ml of milk. This makes SCC-based quality regulation of goat milk somehow cumbersome.
Isolation of Bacteria (E. coli and S. aureus) and Bacterial Enumeration
Bacterial Enumeration. Bacterial enumeration was done using ten-fold serial dilution method where 1 ml of milk sample was diluted in 9 ml of buffered peptone water (BPW, oxoid). Diluted samples (100 micro liters) from the 5th (fifth) upto 9th (ninth) dilutions were streaked on EMBA and BPA media and then incubated at 37 oC for 24 hours. This was followed by enumeration of countable colonies using digital colony counter then converted to total bacterial population estimate per milliliter of milk sample.
Extraction of Garlic and Black Pepper
Garlic Extraction. Garlic was extracted using distilled water following Jabar and Al-Mossawi (2007) modified by not freeze drying the extract. Fresh garlic (200 g) was chopped and grinded in porcelain mortar then soaked in one liter of water for 20 hours, followed by filtering out of the extracts (Appendix 2).
Extraction of Black pepper. Black pepper was extracted following Karsha and Lakshmi (2010), where black pepper (50 g) was ground then dissolved in dichloromethane (DCM) using soxhelt apparatus and continuous heat extraction for 24 hours. The extract was concentrated by evaporating the solvent under reduced pressure. The concentrate is then dissolved in Dimethyl sulfoxide (DMSO) to give required black pepper concentrations (Table 4).
Table 4 Garlic and black pepper extracts concentrations Black pepper concentration
Jabar and Al- Mossawi modified (2007).
Antimicrobial Tests
distributed into test tubes (20 ml) followed by autoclave at 121oC for 15 minutes. The media was then cooled to 40-50 °C before it is poured into petri dishes that were already loaded with bacteria (1 ml with 5 x 105 cfu/ml, an adjustment from McFarland standards 0.5). The media was allowed to solidify in room temperature. Four wells per dish were made using a corked borer with a diameter of 7-8 mm, then 50 µ l of test solution (extract garlic or black pepper) was put into wells. The petri dish together with the culture were then put in the refrigerator (8 °C for 30 minutes) to allow antibiotic agent to diffuse into the media before incubating at 37 °C for a period of 24 hours. The zone of inhibition was measured using vernier caliper and the results were recorded.
Minimum Inhibition Concentration (MIC)
Minimum inhibition concentration was determined using the two fold serial dilution method according to Liasi et al. (2009). Two fold serial dilution (50 µl) of the test compound was aseptically transferred into the nutrient broth (9 ml) using a pipette. Each test tube was inoculated with 105 CFU/ml (1000 µ l) of actively growing bacterial culture in a log phase. The culture tubes were then incubated at 37 °C for a period of 24 hours. The tubes were then analyzed visually for turbidity resulting from bacterial growth and the corresponding concentrations were noted and expressed in PPM as MIC.
Data Analysis
Genetic Data Analysis.
Allele frequencies were determined according to Nei and Kumar (2000) while polymorphism information content was computed following Bostein et al.
Where;
I = frequency of allele ith
nii = total individuals with genotype ii nij = total individuals with genotype ij N = population size
Polymorphism Information Content (PIC)
Polymorphism information content (PIC) was determined following (Bostein et al.1980).
Where;
PIC = polymorphism information content Pi = population frequency for ith allele
n = number of alleles per marker
Testing for Mastitis and Milk Quality Parameters. Mastitis was tested as outlined in methods section and the results were interpreted as follows:
Healthy animals- No gel is formed when milk is mixed with IPB1.
Mastitis 1- Weak gelling is formed that disappears with continued swirling, Mastitis 2- A thicker gel that collects in the center is formed; it pours out leaving some little milk behind;
While Mastitis 3 forms a very thick gel that collects at centre of the cup and pours out without leaving anything.
Milk quality parameters were tested and recorded using Milkotester (Master Pro).
Determining Somatic Cells Counts and Somatic Cell Scores
The formula below was used to determine SCC;
SCC were then converted to somatic cell scores following Nascimento et al. (2006);
Bacterial Contamination Analyses
The number of bacteria or total plate count (cfu/ml) was determined using the formula below (Maturin & Peeler 2001).
Where:
∑c = the sum of colonies on plates counted
n1 = the number of plates in the first dilution counted n2 = the number of plates in the second dilution counted d = the dilution from which the first counts were obtained cfu/ml = colony forming units per ml of milk sample
Milk Grading
Milk samples were graded using total plate count, SCC and SCS following Thai Agricultural Standards (2008) for raw goat milk.
Table 5 Goat milk grading according to Thai Agricultural Standards Grading Parameter /
Characteristic
Grade
Premium Good Standard 1. Total plate count (cfu/ml)* <5 x 104 5 x 104 to 105 >105 to 2 x 105 2. Somatic cells (cells/ml)* <7 x 105 7 x 105 to 106 >106 to 1.5 x 106 3.SCS** <15.77 15.77-16.28 >16.28-16.87 Source: *Thai Agricultural Standard (2008).
**
Nascimento et al. (2006).
Inhibitory Effect of Garlic and Black pepper on Bacteria
according to Quinn and Keogh (2002);
Yijk = + i + j + ( )ij + ijk
Where:
Yijk = Observation at the ith garlic concentration jth pepper concentration; =the population mean;
I = the treatment effect of the ithgarlic concentration; j = the treatment effect of the jthpepper contration;
( )ij =the interaction effect between the ithgarlic concentration and jth pepper concentration;
ijk =the random error.
Minimum Inhibition Concentration (MIC)
RESULTS AND DISCUSSION
PCR Amplification, Genotyping and Genetic Polymorphism Analysis
Target region of TLR4 (382 bp) (Figure 14) and DRB (285 bp) (Figure 15) genes were amplified using PCR. The amplicons were then genotyped as outlined in methodology and the gels are depicted below (Figure 16, 17 and 18).
Figure 14 TLR4 PCR amplification product (382 bp)
Figure 15 The DRB PCR amplification product (285 bp)
Genotyping, Allele and Genotype Frequencies
Figure 16 RFLP product for TLR4|AluI.
Source : www.ncbi.nlm.nih.gov/nuccore/HM627213.2
Figure 17 TLR4 PCR product sequence showing primers, annealing & restriction sites for AluI
.
DRB|PstI locus genotyping (Figure 18) showed polymorphism with two alleles. The restriction patterns (Figure 18 & 19) were 226 bp, 44 bp and 15 bp (for P restriction site) or 270 bp and 15 (p restriction sites) in all three breeds. PE had the highest frequency (0.7069) of P allele while p allele was highest in Saanen (0.3295) (Table 7).
DRB|PstI polymorphism and PIC analysis (Table 9) showed that saanen had highest heterozygosity (Ho 0.4773) and PIC (0.3443) while PE had the lowest heterozygosity (0.4483) and PIC (0.3285).At DRB|PstI locus, Ho was higher than Hein all breeds analyzed. This may be accounted for by frequent introduction of new germplasm which reduces inbreeding, or the locus has an appreciable degree of crossing over (Andolfatto & Przeworski 2001). χ2 tests show that Saanen and PESA were still in Weinberg equilibrium while PE was not in Hardy-Weinberg equilibrium.
2461 gtgtcaactg gaacaggtgt cctggacggc atttcactcc ctccctagcc ttcaggtgct 2521 gaatatgagt cacaacaaac tcttgtcatt ggatacattt ctttatgaac cactccactc 2581 gctccggatc ctagactgca gtttcaaccg tatcacggcc tctaaggagc aagaactacg 2641 gagtttgcca aggaacctca cttggctaaa tcttactcag aatgaatttg cttgtgtttg
2701 tgaacatcag agtttcctgc agtgggtcaaggaccagagg cag|ctcttgg tgggag|ctga
Figure 18 The RFLP product for DRB|PstI.
Source: www.ncbi.nlm.nih.gov/nuccore/1332452
Figure 19 DRB amplicon sequence showing primers, annealing & restriction sites for PstI.
DRB|TaqI (Figure 20) restriction sites were 163 bp and 122 bp fragments for allele T or the undigested fragment at 285 bp for ‘t’ restriction site (Figure 21). PESA has the highest frequency (0.9205) of T allele followed by PE (0.8976) while Saanen has high frequency of allele “t” (0.0795) (Table 8). This locus showed highest Hobs in Saanen (0.2708) and PESA was the lowest (0.1136) while PE had the lowest He and PIC respectively (Table 9). This locus is still within Hardy-Weinberg equilibrium for PESA while Saanen and PE do not follow Hardy-Weinberg equilibrium.
Figure 20 RFLP product for DRB|TaqI.
1. TATCCCGTCTCTGCA|GCACATTTCCTGGAGTATCATAAGAGCGAGTGTCATTTCTTCAAC
61GGGACCGAGCGGGTGTGGTACCTGGACAGATACTTCTATAATGGAGAAGAGTACGTGCGC
121 TTCGACAACGACTGGGGCGAGTACCGGGCGGTGGCCGAGCTGGGGCGGCCGGACGCCAAG
181 TACTGGAACAGCCAGAAGGAGATCCTGGAGCGGAAGCGGGCCAATGTGGACACGTACTGC
Source: www.ncbi.nlm.nih.gov/nuccore/1332452
Figure 21 DRB amplicon sequence showing primers, annealing & restriction sites for TaqI
The results obtained here for TLR4|AluI are inconsistent with Wang et al. (2007) and Jungi et al. (2010) where the same locus was found polymorphic with moderate PIC and still in H-W equilibrium for cattle.
Genotyping DRB|PstI (Figure 18) displayed three genotypes. Homozygous recessive pp genotype had low frequency in all breeds while in Egyptian goats it was displayed at comparatively higher frequency (29.5 %) (Wang et al. 2007). Egyptian goats did not display homozygous dominant (PP) genotype while the heterozygous genotype (Pp) had the highest frequency as compared to this study where the same genotypes displayed moderate to high frequency.
DRB|TaqI showed three genotypes in Egyptian goats as well as in this study. However, in contrast to Egyptian goats, the frequency of homozygous dominant (TT) genotype was found to be high for all breeds in this study whereas the same genotype occurred in moderate frequency in Egyptian goats. Heterozygous genotype (Tt) was low in all the analyzed breeds for this study while in Egyptian goats it was highest. The overall analysis for Hardy-Weinberg indicated that all the genotypes are still within Hardy-Weinberg equilibrium with the exception of DRB|Taq in PE and in Saanen.
In agricultural animals as opposed to natural populations, H-W equilibrium may hardly be obeyed. This is because of intensive directional selection favoring certain phenotypes/genotypes that may be superior in respect of market demands. That may also be due to introductions of new germplasm, technically known as gene flow or migration.
2. ATCCCGTCTCTGCAGCACATTTCCTGGAGTATCATAAGAGCGAGTGTCATTTCTTCAAC
62 GGGACCGAGCGGGTGTGGTACCTGGACAGATACTTCTATAATGGAGAAGAGTACGTGCGC
122 TT|CGACAACGACTGGGGCGAGTACCGGGCGGTGGCCGAGCTGGGGCGGCCGGACGCCAAG
182 TACTGGAACAGCCAGAAGGAGATCCTGGAGCGGAAGCGGGCCAATGTGGACACGTACTGC
Table 6 TLR4|AluI Locus Allele and Genotype Frequencies Analysis
Locus Population n Allele frequency Genotype Frequency
T t TT Tt tt
TLR4|AluI Saanen 61 1.00 0.00 1.00 0.00 0.00
PESA 59 1.00 0.00 1.00 0.00 0.00
PE 88 1.00 0.00 1.00 0.00 0.00
Table 7 DRB|PstI Locus Allele and Genotype Frequencies Analysis
Locus Population n Allele frequency Genotype Frequency
P p PP Pp pp
DRB|PstI Saanen 44 0.6705 0.3295 0.4318 0.4773 0.0909
PESA 50 0.6900 0.3100 0.4600 0.4600 0.0800
PE 87 0.7069 0.2931 0.4828 0.4483 0.0690
Table 8 DRB|TaqI Locus Allele and Genotype Frequencies Analysis
Locus Population n Allele frequency Genotype Frequency
T t TT Tt tt
DRB|TaqI Saanen 48 0.7188 0.2813 0.5833 0.2708 0.1458
PESA 44 0.9205 0.0795 0.8636 0.1136 0.0227
PE 83 0.8976 0.1024 0.8313 0.1325 0.0361
Table 9. Heterozygosity, H-W and PIC values Per Locus and Breed
Locus Breed Observed Heterozygosity (Hobs)
Expected Heterozygosity (He)
PIC χ2
TLR4|AluI Saanen 0.000 0.000 0.000 -
PESA 0.000 0.000 0.000 -
PE 0.000 0.000 0.000 -
DRB|PstI Saanen 0.4773 0.4470 0.3443 0.28
PESA 0.4600 0.4321 0.3363 0.28
PE 0.4483 0.4168 0.3285 0.58
DRB|TaqI Saanen 0.2708 0.4086 0.3226 5.23*
PESA 0.1136 0.1481 0.1357 2.21
PE 0.1325 0.1850 0.1669 6.47*
Χ2
PIC and Mastitis
Polymorphism information content (PIC) measures the degree of informativeness of a rare mutation as a candidate marker for linkage studies (Botstein et al. 1980). It is an index of the probability that a certain marker allele of an offspring will enable one to deduce which of the two marker alleles it received from the affected parent. Its values range between zero and one (0-1). It is directly related to genetic polymorphism. Therefore its values are determined by the number of alleles and their frequencies. DRB|TaqI in PESA and PE have low PIC (Table 9) hence less informative to be genetic markers for mastitis resistance whereas DRB|PstI had moderate to high PIC in all breeds.
Mastitis Prevalence
Saanen has highest prevalence of mastitis where the entire population sample was mastitis positive (Table 10) of which it may be due to limited population sample, followed by PESA (79% prevalence) (Table 12) and lastly PE (59% prevalence).
Table 10 Analysis of mastitis prevalence and rating in Saanen DRB Locus
Genotype Health Status and Mastitis Ranking (n=8)
PESA (Table 11); had the highest prevalence of mastitis 2 and mastitis 3 infection animals, PESA has lower rates of healthy animals as compared to PE (Table 12) whereas all Saanen were mastitis positive.
Table 11 Analysis of mastitis prevalence and rating in PESA DRB Locus
Genotype Health Status and Mastitis Ranking (n=28)
Genotype Contribution % Healthy(0) Traces(1) Mastitis (2) Mastitis (3) Healthy Sick DRB|PstI
The heterozygous (Tt) genotype in PESA had lowest infection rate (7.14%) while TT genotype (71.43%) and PP genotype (57%) in locus (DRB|PstI) were the highest. Conversely, TT genotype had the highest rate of healthy animals (21%) followed by PP (18%), while the heterozygous Pp had the lowest rate of healthy animals (3.6%). The homozygous genotype “pp” is present only in Saanen where it is mastitis positive and in PESA where it is mastitis negative.
Table 12 Analysis of mastitis Prevalence and rating in PE DRB Locus
