PENGEMBANGAN DIAGNOSIS MOLEKULER
TOKSOPLASMOSIS BERDASARKAN SEKUEN
SPESIFIK Deoxyribonucleic Acid STADIUM
TAKIZOIT DAN BRADIZOIT
oleh
Ida Ayu Pasti Apsari
08/276691/SKH/62PROGRAM STUDI SAIN VETERINER
FAKULTAS KEDOKTERAN HEWAN
UNIVERSITAS GADJAH MADA
YOGYAKARTA
ii
PENGEMBANGAN DIAGNOSIS MOLEKULER
TOKSOPLASMOSIS BERDASARKAN SEKUEN
SPESIFIK
Deoxyribonucleic Acid
STADIUM
TAKIZOIT DAN BRADIZOIT
Disertasi untuk memperoleh derajat Doktor dalam Ilmu Kedokteran Hewan pada
Universitas Gadjah Mada
Dipertahankan terhadap sanggahan Dewan Penguji Program Studi Sain Veteriner Fakultas Kedokteran Hewan Universitas Gadjah Mada
Pada tanggal : 18 Juli 2012
oleh
Ida Ayu Pasti Apsari 08/276691/SKH/62
Lahir di Denpasar – Bali
84 PENGEMBANGAN DIAGNOSIS MOLEKULER TOKSOPLASMOSIS
BERDASARKAN SEKUEN Deoxyribonucleic Acid SPESIFIK STADIUM TAKIZOIT DAN BRADIZOIT
RINGKASAN
PENDAHULUAN Latar Belakang
Toksoplasmosis merupakan penyakit zoonosis yang tersebar di seluruh dunia. Kasus toksoplasmosis pada hewan dan manusia di Indonesia sangat tinggi. Prevalensi toksoplasmosis pada manusia 40–85%, sedangkan pada hewan berkisar antara 5–80% (Subekti et al., 2005). Tingginya kasus toksoplasmosis dan dampak negatif yang berakibat kerugian ekonomi maupun penurunan produksi, maka diagnosis menjadi hal yang sangat penting. Diagnosis melalui gejala klinis, toksoplasmosis tidak menciri (Bastien, 2002), melalui metode immunologis masih memerlukan uji tambahan (Remington et al., 2004), sedangkan melalui level molekuler, walau memberi hasil yang spesifik namun, biayanya mahal dan memerlukan peralatan khusus. Metode diagnosis yang praktis dan akurat oleh karena itu perlu dilakukan pengembangan. Penelitian ini berupaya mengembangkan diagnosis molekuler toksoplasmosis berdasarkan sekuen DNA spesifik stadium takizoit dan bradizoit sebagai probe molekuler dengan metode aplikasi hibridisasi dot blot.
Tujuan Penelitian
Tujuan umum untuk mendapat DNA probe berdasar fragmen DNA spesifik stadium takizoit dan bradizoit yang dapat memenuhi syarat sebagai probe untuk mendeteksi toksoplasmosis.
Tujuan khusus yaitu 1. mengamplifikasi dan sekuensing fragmen spesifik DNA takizoit dengan primer gen sag-1 dan bag-1 T. gondii, 2. menganalisis sekuen spesifik fragmen DNA stadium takizoit dan bradizoit yang dapat digunakan sebagai kandidat
85
dot blot untuk mendeteksi komplementernya, 4. menentukan spesifisitas dan sensitivitas
probe takizoit dan bradizoit dalam metode diagnosis aplikasi dot blot untuk mendeteksi
T. gondii.
Manfaat Penelitian
Probe takizoit dan bradizoit diharapkan dapat digunakan untuk mendeteksi infeksi akut dan infeksi kronis, sehingga secara tidak langsung dapat membantu meningkatkan keamanan pangan dari hewan ke manusia. Probe molekuler ini juga dapat digunakan pada proses hibridisasi lain, seperti southern blot, northen blot atau in situ hybridization, sehingga berguna bagi pengembangan ilmu pengetahuan baik dalam bidang biologi maupun pada bidang parasitologi.
TINJAUAN PUSTAKA Toksoplasmosis
Toksoplasmosis disebabkan oleh protozoa Toxoplasma gondii (Tenter et al., 2000). Toxoplasma gondii adalah parasit intraseluler obligat yang termasuk phyllum
Apicomplexa, class Sporozoea, ordo Eucoccidiida, family Sarcocystidae dan genus Toxoplasma (Soulsby, 1982; Levine, 1995; Ajioka et al., 2001). Parasit ini dapat menginfeksi semua vertebrata termasuk manusia dan berbagai hewan termasuk unggas serta hewan berdarah panas lainnya (Tenter et al., 2000; Dubey and Jones, 2008). Stadium infektif T. gondii yaitu, oosista yang hanya terdapat pada feses hospes definitif, sedangkan stadium takizoit dan bradizoit terdapat dalam bentuk sista jaringan di hospes perantara (Tenter et al., 2000; Dubey, 2007).
Rantai siklus hidup dari T. gondii, bisa terjadi penularan dari hospes definitif ke hospes perantara, dari hospes perantara ke hospes definitif dan diantara hospes perantara. Penularan terus berlanjut dalam waktu yang tidak terbatas, melalui sista jaringan diantara hospes perantara (walaupun pada keadaan ketidak hadiran hospes definitif) dan juga penularan dari oosista diantara hospes definitif (bahkan dalam ketidak hadiran hospes perantara) (Tenter et al., 2000).
Adanya antibodi dalam serum untuk keperluan diagnosis toksoplasmosis, merupakan manifestasi dari respon hospes terhadap keberadaan T. gondii di dalam
86 tubuhnya. Antibodi IgM terbentuk pada awal infeksi dan dapat dideteksi 5 hari setelah infeksi. Antibodi ini meningkat cepat selama 2 minggu dan menghilang setelah 2–3 bulan. Antibodi IgG dibentuk kemudian yang bisa bertahan cukup lama sampai 1 tahun. Adanya IgG merupakan tanda infeksi kronis (Cornain et al., 1990; Lubis et al., 1997).
Takizoit yang menginfeksi hospes cepat berreplikasi dan dengan cepat menyebar ke seluruh tubuh hospes. T. gondii secara mudah melewati barier darah retina, otak dan plasenta. Hospes yang mempunyai imunitas, menyebabkan takizoit berubah menjadi bradizoit. Bradizoit berada di dalam sel, membentuk sista jaringan yang resisten (Filiceti and Candolfi, 2004).
Diagnosis Toksoplasmosis
Diagnosis penyebab toksoplasmosis dapat dilakukan dengan dua cara yaitu secara klasik dan modern. Diagnosis secara klasik, berdasar gejala klinis, tidak berlaku untuk toksoplasmosis, karena toksoplasmosis secara klinis tidak menunjukkan gejala yang spesifik (Bastien, 2002), diagnosis dengan uji biologis, metode ini tidak praktis karena memerlukan waktu lama, sedangkan diagnosis metode immunologis juga tidak efektif karena masih memerlukan uji tambahan dan sering memberi hasil negatif palsu (Remington et al., 2004). Diagnosis secara modern, pada level molekuler, berdasar
deoxyribonucleic acid (DNA) T. gondii, seperti metode Polymerase Chain Reaction
(PCR), (Susanto et al., 2002; Priyowidodo, 2003) yang mengamplifikasi sekuen spesifik Toxoplasma gondii memberi hasil yang sangat spesifik, namun metode ini biayanya mahal dan memerlukan peralatan khusus. Diagnosis pada level molekuler yang mempunyai kendala dalam hal interpretasi hasil, maka metode teknik hibridisasi dengan DNA probe dapat dikembangkan (Samuelson et al., 1989; Garberi et al., 1994; Akin, 2001; Aidawati et al., 2007; Sarova and Saigoval, 2010).
Gena sag-1 dan bag-1 Toxoplasma gondii
Toxoplasma gondii mempunyai tiga stadium infektif yaitu takizoit, bradizoit dan sporozoit. Secara struktur ketiganya mirip, tapi mereka beda dalam penotipe dalam ekspresi protein spesifik. Protein 65 kDa sebagai MAG-1 dipakai sebagai penanda ekspresi secara khusus selama bradizoit, karena protein ini berlokasi dalam sista jaringan
87 dan secara imunobloting akan terdeteksi oleh ekstrak sista (Holec et al., 2007). Penelitian sebelumnya juga mendukung bahwa P30 dan P22 merupakan antigen spesifik takizoit yang reaktif.
Toxoplasma gondii mempunyai gena sag-1 merupakan gena spesifik untuk stadium takizoit, sedangkan bag-1 merupakan gena spesifik untuk stadium bradizoit (Weiss and Kim, 2000; Ajioka et al., 2001; Hartati et al., 2003; Cristina et al., 2004; Kazemi et al., 2007a dan Kazemi et al., 2007b). Melalui metode Polymerase Chain Reaction (PCR) gena spesifik stadium tertentu berhasil diisolasi menggunakan primer dengan panjang 18-24 nukleotida (Susanto et al., 2002; Priyowidodo, 2003).
Landasan Teori
Sista T. gondii (terdapat di jaringan) terkandung di dalamnya sejumlah bradizoit, dan takizoit terdapat bebas di cairan ekskresi dan sekresi (Tenter et al., 2000; Weiss and Kim, 2000). Menurut Zhang et al.(1999), Weiss dan Kim (2000) dan Ajioka et al.
(2001) ada gena yang spesifik pada stadium takizoit dan gena spesifik pada stadium bradizoit. Gena sag-1 merupakan gena spesifik untuk stadium takizoit, sedangkan bag-1 merupakan gena spesifik untuk stadium bradizoit (Weiss and Kim, 2000; Ajioka et al.,
2001; Hartati et al., 2003; Cristina et al., 2004; Kazemi et al., 2007a; Kazemi et al.,
2007b). Sampai saat ini, eksplorasi kedua gena tersebut untuk tujuan diagnosis belum banyak dilakukan. Menggunakan metode Polymerase Chain Reaction (PCR) gena spesifik stadium tertentu berhasil diisolasi menggunakan primer dengan panjang 18-24 nukleotida (Susanto et al., 2002; Priyowidodo, 2003).
Deoxyribonucleic acid dapat digunakan sebagai probe molekuler untuk diagnosis penyakit, disamping DNA mempunyai sifat yang komplementer dan adanya sifat sekuen yang conserve (konstan) dan variabel. Sekuen yang baik untuk calon probe
adalah sekuen yang conserve (Keller and Manak, 1989; Weiss, 1995). Panjang pendek sekuen dan jumlah copy gene sebagai calon probe juga mempengaruhi kualitas probe. Sekuen dengan panjang 100 – 300 bp ideal sebagai probe (Leitch et al., 1994), dan repetitif sekuen gen dengan jumlah 300 copy berhasil digunakan sebagai probe untuk mendiagnosis toksoplasmosis (Reischl et al., 2003; Sumartono, 2009; Pratama, 2009).
88 hibridisasi lebih cepat daripada yang lebih rendah. Isolasi dan analisis gena sag-1 (Ajioka et al., 2001) dan bag-1 (Bohne et al., 1995) mempunyai single copy, sebagai calon probe molekuler diharapkan dapat mendeteksi T. gondii.
Hipotesis
1. Primer spesifik gena sag1 dan bag-1 dapat dipergunakan untuk mengamplifikasi fragmen DNA takizoit T. gondii isolat lokal
2. Sekuen spesifik DNA stadium takizoit dan bradizoit dapat digunakan sebagai
probe molekuler toksoplasmosis
3. Probe takizoit dan bradizoit dapat dipergunakan mendeteksi toksoplasmosis 4. Probe takizoit dan bradizoit memiliki spesifisitas dan sensitivitas yang tinggi
sehingga dapat diaplikasikan untuk mendeteksi T. gondii
METODE PENELITIAN DAN CARA ANALISIS
Deoxyribonucleic Acid (DNA) takizoit diisolasi dari Takizoit Toxoplasma gondii
isolat lokal dengan metode alkali lysis. Sekuen spesifik fragmen gena sag-1 dan bag-1
Toxoplasma gondii, berhasil diamplifikasi dengan metode polymerase chain reaction
(PCR) menggunakan primer sag-1 (forward: 5′-CACCTGTAGGAAGCTG TAGTCACTG –3′ reverse: 5′- TCACTGTGACCATACAACTCTGTG - 3′) dan bag-1 (forward: 5′-AGGAGAGAAGACCTCGAAAGAAG-3′reverse: 5′-TGAACGCTAGGT TTCTGGATACG-3′) dan PCR reaction mix (Invitrogen). Produk PCR disekuensing dengan Automatic DNA sequencer Applied Biosystem 3130/3130x Genetic Analyser di Eijkman Institute, Jakarta. Spesifisitas sekuen stadium takizoit (sag-1) dan bradizoit (bag-1) dianalisis menggunakan program BLAST, dengan: genom T. gondii yang ada pada GenBank, genom hospes (sapi, kambing, domba, babi, unggas dan manusia), parasit yang mempunyai hubungan kekerabatan dekat dengan T.gondii (Sarcocystis, Hammondia hammondi, Neospora, Isospora, Eimeria). Analisis juga dilakukan diantara kedua sekuen, untuk memastikan tidak terjadi reaksi silang. Kajian sekuen sebagai probe
molekuler untuk metode hibridisasi dengan aplikasi dot blot, terlebih dahulu dilakukan pelabelan menggunakan Dig high prime DNA labeling and detection starter kit (Roche).
89 HASIL PENELITIAN
Sekuen sag-1 T. gondii isolat lokal hasil sekuensing 612 sekuen dan sekuen bag-1 T. gondii isolat lokal hasil sekuensing 470 sekuen sangat conserve dengan beberapa strain yang ada di GenBank. Analisis bagian sekuen yang conserve dari sekuen sag-1 dan bag-1 T. gondii isolat lokal diperoleh sekuen sebagai kandidat probe. Kandidat
probe yang dipilih memiliki spesifisitas terhadap T. gondii (tidak bereaksi silang dengan hospes dan parasit lain, serta memiliki tingkat homologi yang tinggi dengan berbagai strain T. gondii). Hasil analisis probe sag1 dan bag1 dengan program BLASTterhadap hewan yang berperan sebagai hospes T. gondii tidak ada sekuen yang dikenal oleh hospes, demikian pula pada parasit lain seperti Tyzzeria anseris, Histomonas meleagridis, Trichomonas gallinae, Hexamita sp dan Sarcocystis yang kemungkinan bisa menyerang ayam tidak ada index similarity yang signifikan. Probe terpilih lebih difokuskan untuk diagnosis ayam.
Probe sag1 panjang 136 nt mengandung 52,2% GC, dengan sekuen CAGCGCCACAGAGCCTCCCACTCTTGCGTACTCACCCAACAGGCAAATCTGC CCAGCGGGTACTACAAGTAGCTGTACATCAAAGGCTGTAACATTGAGCTCCT TGATTCCTGAAGCAGAAGATAGCTGGTGGAC dan probe bag-1 panjang 98 nt mengandung 57,6% GC, dengan sekuen GCGCGCCGGTTCCAGCTCCCGAGTA ATTACAAGCCCGACGGAATCAGTGCGGCAATGGACAACGGCGTTCTACGTG TCACGATCAAGGTCGAGGA. Aplikasi probe untuk mendeteksi suatu agen patogen dalam sampel klinis, probe harus memiliki kemiripan genetik tinggi dengan agen patogen dan kemiripan genetik yang rendah dengan genom hospes (Rueue, 1998; Brown, 2006). Panjang probe juga mempengaruhi spesifisitasnya (Pruitt et al., 2005).
Probe sag1 6,72 pg/µl berhasil mendeteksi 0,45 ng/µl DNA, sedangkan probe bag1 5,87 pg/µl berhasil mendeteksi 0,23 ng/µl DNA ayam buras yang terinfeksi toksoplasmosis.
90 SIMPULAN DAN SARAN
Simpulan
Deoxyribonucleic acid probe berdasar sekuen spesifik DNA stadium takizoit (sag-1) dan bradizoit (bag-1) T. gondii dapat digunakan untuk mendeteksi toksoplasmosis pada ayam buras dengan hibridasi dot blot. .
Saran
Disarankan menggunakan probe sag-1 dan bag-1 untuk diagnosis toksoplasmosis pada ayam buras dengan metode hibridisasi dot blot. Penelitian selanjutnya disarankan menggunakan probe sag-1 dan bag-1 untuk mendeteksi T. gondii
91 MOLECULAR DIAGNOSIS OF TOXOPLASMOSIS BASED ON
DEOXYRIBONUCLEIC ACID SPECIFIC SEQUENCE OF TACHYZOITE AND BRADYZOITE STAGE
SUMMARY INTRODUCTION Background
Toxoplasmosis is a zoonotic disease that spread throughout the world. Cases of toxoplasmosis in animals and humans in Indonesia is very high. The prevalence of toxoplasmosis in humans 40-85%, whereas in the animals ranged from 50-80% (Subekti
et al, 2005). The high cases of toxoplasmosis and negative impacts that result in economic losses and decline in production, then the diagnosis becomes very important. Diagnosis by clinical symptoms, toxoplasmosis does not distinguish (Bastien, 2002), by immunologically the method still requires an additional test (Remington et al., 2004), whereas the molecular level, although giving a specific result, however, be expensive and require special equipment. Therefore required the development the practical and accurate methods of diagnosis. This study make serious efforts to develop molecular diagnosis of toxoplasmosis based on specific DNA sequences tachyzoite and bradyzoite stage as molecular probes by hybridization method of dot blot application. Objectives of the Research
The general obyective of the research is to get a DNA probe based on specific DNA fragments tachyzoite and bradyzoite stage that can qualify as molecular probe to detect toxoplasmosis.
The specific objectives are 1) to amplifaying and sequensing tachyzoite specific DNA fragment using the primer sag1 and bag1 gene Toxoplasma gondii, 2) to analyze the specific sequences of DNA fragments tachyzoite and bradyzoite stage that can be used as candidate probes, 3)to make optimization tachyzoite and bradyzoite probe by hybridization method using dot blot aplication for detection of its complementary, 4) to
92 determine the spesivisity and sensitivity of the tachyzoite and bradyzoite probe in the dot blot method of diagnostic applications to detect Toxoplasma gondii.
Benefits of Research
Tachyzoite and bradyzoite probe expected to be used to detect acute and chronic infections, so it may indirectly help to improve food safety from animals to humans. Molecular probes can also be used in the hybridization process, such as Southern blotting, Northern blotting or in situ hybridization, making it useful for the development of field science in biology and parasitology
LITERATURE REVIEW Toxoplasmosis
Toxoplasmosis is caused by the protozoan Toxoplasma gondii (Tenter et al., 2000). Toxoplasma gondii is an obligate intracellular parasites belongs to phyllum Apicomplexa, class Sporozoea, Eucoccidiida order, family Sarcocystidae and genus Toxoplasma (Soulsby, 1982; Levine, 1995; Ajioka et al., 2001). These parasites can infect all vertebrates including humans and various animals including birds and other warm-blooded animals (Tenter et al., 2000; Dubey and Jones, 2008). Infective stage of
T. gondii, oocyst present only in the definitive host feces, while the tachyzoite , and bradyzoite stage contained in the cyst form of intermediate host tissues (Tenter et al., 2000; Dubey, 2007).
Life cycle chain of T. gondii, transmission can occur from the intermediate host to definitive host, the intermediate host to definitive host and among intermediate host. Transmission continues in indefinitely, through the tissue cyst between intermediate host (although in the absence of definitive host) and also the transmission of oocyst between definitive hosts (even in the absence of intermediate host) (Tenter et al., 2000).
Presence of antibodies in the serum for diagnosis of toxoplasmosis, is a manifestation of host response to the presence of Toxoplasma in its body. IgM
93 antibodies are formed early in infection and can be detected 5 days after infection. These antibodies increase rapidly for 2 weeks and disappeared after 2-3 months. IgG antibodies formed later that can survive long enough to 1 year. The presence of IgG is a sign of chronic infection (Cornain et al., 1990; Lubis et al., 1997).
Tachyzoite infected host that fast replication and quickly spread throughout the body. Toxoplasma easily pass through the blood retinal barrier, brain and placenta. Host who have immunity, causing tachyzoite turned into bradyzoite form. Bradyzoite that is in the intracellular, forming a resistant tissue cyst (Filiceti and Candolfi, 2004).
Diagnosis of Toxoplasmosis
The etiologic diagnosis of toxoplasmosis can be done by classical and modern techniques. The classical techniques, based on clinical symptoms, do not apply to toxoplasmosis, because toxoplasmosis is clinically not show specific symptoms (Bastien, 2002), diagnosis with biological tests, this method is not practical because it requires a long time, while the diagnosis of immunologically method is also not effective because still require additional testing and often give false negative results (Remington et al., 2004). The modern techniques, on a molecular level, based on deoxyribonucleic acid (DNA) of T. gondii, such as the method of Polymerase Chain Reaction (PCR), (Susanto et al. 2002; Priyowidodo, 2003) which amplifying a
Toxoplasma gondii specific sequences give very specific results, but the method is expensive and requires special equipment. Diagnosis at the molecular level that have a constraint in interpretation of the results, then the method of hybridization with DNA probe techniques can be developed (Samuelson et al., 1989; Garberi et al., 1994; Akin, 2001; Aidawati et al., 2007; Sarova and Saigoval , 2010).
Sag-1 and Bag-1 Toxoplasma gondii genes
Toxoplasma gondii has a three infective stage namely, tachyzoite, bradyzoite and sporozoites. In all of the structures are similar, but they vary in penotipe in the expression of specific proteins. Protein 65 kDa as the MAG-1 is used as a marker expression specifically during bradyzoite, because this protein is located in tissue cyst
94 and imunobloting cyst will be detected by a cyst extract (Holec et al., 2007). Previous research also supports that the P30 and P22 is a specific tachyzoite reactive gene.
Toxoplasma gondii has specific gene. Sag-1 is specific gene for tachyzoite stage, whereas Bag-1 is specific gene for bradyzoite stage (Weiss and Kim, 2000; Ajioka et al., 2001; Hartati et al., 2003; Cristina et al. 2004; Kazemi et al., 2007a and Kazemi et al., 2007b). Polymerase Chain Reaction (PCR) method successfully to be isolate specific genes from certain stages using the primers specific (length of 18-24 nucleotides) (Susanto et al., 2002; Widodo, 2003).
Basic Theory
Toxoplasma cyst (found in the tissues) contained a number of bradyzoite, and there tachyzoite freely in excretion and secretion fluid (Tenter et al., 2000; Weiss and Kim, 2000). According to Zhang et al. (1999), Weiss and Kim (2000) and Ajioka et al. (2001) there is a specific gene on tachyzoite stage and on bradyzoite stage. Sag-1 is specific gene for tachyzoite stage, whereas bag-1 is specific gene for bradyzoite stage (Weiss and Kim, 2000; Ajioka et al., 2001; Hartati et al., 2003; Cristina et al., 2004; Kazemi
et al., 2007a and Kazemi et al., 2007b). To date, exploration of both gene for the purpose of diagnosis has not been done. Through the method of Polymerase Chain Reaction (PCR) specific gene certain stages was isolated using the specific primers (length 18-24 nucleotides)(Susanto et al., 2002 and Widodo, 2003).
DNA molecules can be used as molecular probes for diagnosis, because of the nature of the sequence of conserve (constant) and variable. A good sequence for candidate probe is conserve sequences (Keller and Manak, 1989; Weiss, 1995). The length of sequence and the copy number of gene as a potential probe, also affects the quality of the probe. Sequences with a length of 100-300 bp ideal as probes (Leitch et al., 1994), and repetitive sequences of genes with copy number 300 successfully used as a probe for diagnosing toxoplasmosis (Reischl et al., 2003; Sumartono, 2009; Pratama, 2009). Probe from gene that have a high copy number, hybridization is faster than the lower. Isolation and analysis of genes sag-1 (Ajioka et al., 2001) and bag-1 (Bohne et al., 1995)
95 has a single copy gene, as prospective molecular probes are expected to detect
Toxoplasma gondii. Hypothesis
1. Using gene specific primers can be amplified sag1 and bag1 gene fragments that are specific stages of T. gondii in 400-700bp
2.There are specific DNA sequences tachyzoite and bradyzoite stage that meets the requirements as molecular probes
3. Probes can detect tachyzoite and bradyzoite complementary DNA.
4. Probe tachyzoite and bradyzoite has high sensitivity and specificity that can be applied to detect toxoplasmosis.
RESEARCH METHODS AND ANALYSIS
Deoxyribonucleic acid (DNA) tachyzoite Toxoplasma gondii was isolated from local isolates with alkaline lysis method. Specific sequences of gene fragments of sag-1 and bag-1 T. gondii, a method successfully amplified by Polymerase ChainReaction (PCR) using the primers sag-1 (Forward: 5'-CACCTGTAGGAAGCTG TAGTCACTG -3 'Reverse: TCACTGTGACCATACAACTCTGTG - 3') and bag-1 (Forward: 5'-AGGAGAGAAGACCTCGAAAGAAG-3 'Reverse: 5'-TGAACGCTAGGTTTCTGG ATACG-3') and the PCR reaction mix (Invitrogen). PCR products were sequenced with
Automatic DNA sequencer Applied Biosystem 3130/3130x Genetic Analyser at the Eijkman Institute, Jakarta. The specivicity tachyzoite stage sequence (sag-1) and bradyzoite (bag-1) were analyzed using the BLAST program, for : T. gondii genome that existed at GenBank, host genome (cow, goat, sheep, pigs, poultry and humans), a parasite that has close kinship with T.gondii (Sarcocystis, Hammondia hammondi, Neospora, Isospora, Eimeria). The analysis was also conducted between the two sequences, to ensure no cross-reaction occurs. Study sequences as molecular probes for hybridization method with dot blot applications, first performed using the Dig high prime DNA labeling and detection starter kit (Roche).
96 RESEARCH RESULTS
Sag-1 sequence of T. gondii local isolates sequencing results of 612 sequences and bag-1 sequence of T. gondii local isolates sequencing results were very conserve 470 sequences with several strains that exist in the GenBank. The conserve sequence analysis of sag-1 and bag-1 T. gondii local isolates sequences, obtained locally as a candidate probe. The selected candidate probes having specificity against T. gondii (not cross-react with other hosts and parasites, as well as having a high degree of homology with various strains of T. gondii). The results of the analysis probe sag-1 and bag-1 by BLAST program for animals that act as hosts of T. gondii no sequence is known by the host, as well as in other parasites such as Tyzzeria anseris, Histomonas meleagridis, Trichomonas gallinae, Hexamita sp and Sarcocystis who might attack the chicken does not no significant similarity index. Sag-1 probe length 136 nucleotide contains 52.2% GC, with sequences CAGCGCCACAGAGCCTCCCACTCTTGCGTACTCACCCAA CAGGCAAATCTGCCCAGCGGGTACTACAAGTAGCTGTACATCAAAGGCTGT AACATTGAGCTCCTTGATTCCTGAAGCAGAAGATAGCTGGTGGAC and bag-1 probe length of 98 ntucleotide containing 57.6% GC, with sequences GCGCGCCGGTTCCAGCTCCCGAGTAATTACAAGCCCGACGGAATCAGTGCG CAATGGACAACGGCGTTCTACGTGTCACGATTCGAGGA. Application of probes for detecting a pathogenic agent in clinical samples, the probe must have a high genetic similarity with pathogenic agents and low genetic similarity with the host genome (Rueue, 1998; Brown, 2006). The length of the probe also affect the specificity (Pruitt et al., 2005). The sag1 and bag1 probe successfully detected 0.45 ng/µl and 0.23 ng/µl DNA domestic poultry infected toxoplasmosis.
CONCLUSION AND SUGGESTIONS Conclusion
Based on sequence specific DNA probes tachyzoite stage (sag-1) and bradyzoite (bag-1) Toxoplasma gondii can be specific used to detect toxoplasmosis by dot blot hybridization method
97 Suggestion
Suggested using a probe sag1 and bag1 for diagnosis of toxoplasmosis in free-range chicken with dot blot hybridization applications.
98
DAFTAR PUSTAKA
Anonimus. 2007. Protocols and applications. Http://www.promega.com/paguide/chap9 html 3-12-2007.
Anonimus. 2008. 260/280 and 260/230 Ratios. T042-Technical Bulletin. Nanodrop Spectrofotometer. www.nanodrop.com.
Anonimus. 2009. Glen Reseach Product for RNA and DNA. www.glenresearch.com/reference/...html.
Ahn, H.J.; Kim, S.; Kim, H.E. and Lappin, M.R. 2006a. Molecular cloning of rhoptry protein (ROP6) secreted from Toxoplasma gondii. Korean J.Parasitol. 44(3): 251-254.
______. 2006b. Interactions between secreted GRA protein and host cell proteins across the parasitophorous vacuolar membrane in the parasitism of Toxoplasma gondii. Korean J.Parasitol. 44(4): 303-312.
Aidawati, N; Hidayat, S.H.; Hidayat, P.; Suseno, R.; Sujiprihati, S. 2007. Response of Various Tomato Genotypes to Begomovirus Infection and Its Improved Diagnostic. Hayati J.Bioscience. 14(3): 93-97.
Ajioka J.W.; Fitzpatrick, J.M. and Reitter, C.P. 2001. Toxoplasma gondii genomic : shedding ligth on Pathogenesis and Chemotheraphy. Expert Review. In Mol. Med. http://www.ermm.cbcu.cam.ac.uk. Departement of Pthology. University of Cambridge. Cambridge: 2 – 19
Akin, H.M. 2001. Penggunaan Pelacak Nonradioaktif (Digoxigenin-DNA Probe) untuk Mendeteksi Peanut Stripe Virus. J.Hama dan Penyakit Tumbuhan Tropika. 1(2): 75-79.
Ali, N.Z.; Valian, H.K.; Rezaian, M.; Khorramizadeh, M.R.; Kazemi, B.; A.Fazaeli, A. and Darde, M. 2005. Moleculer Characterization of Toxoplasma gondii from Bird Host. Iranian J.Publ Health. 34(3): 27-30.
Alcamo, E. 2001. DNA Analysis and Diagnosis. In DNA Technology. The A we some skill. Second edition. Academic Press, Printed USA. 155-158.
Alfonso, Y.; Fraga, J.; Jimenez, N.; Fonseca, C.; Dorta-Contreras, A.J.; Cox, R.; Cao, V.; Bandera, F.; Fomer, O.and Ginorio, D. 2009. Detection of Toxoplasma gondii in cerebrospinal fluid from AIDS pasient by nested PCR and rapid identification of type I alele at Bi gene by RLFP. Exp.Parasitol. 122(3): 203-207.
99 Amirudin; Hastuti, S. dan Artama, W.T. 1999. Deteksi Antigen Toxoplasma gondii
Isolat Lokal dengan cara ELISA Sandwich menggunakan Anti bodi monoklonal. Agrosain12(3): 187-197.
Angel, S.O; Blanco, J.C.;Maero, E.;Pzsenny, V. and Garberi, J.C. 1991. Repetitive DNA Sequences of Toxoplasma gondii for Development of Diagnostic Probes. Mem Inst Oswldo Cruz, Rio de Janeiro. 86(4): 483-484.
Angel, S.O.; Maero, E.; Blanco, J.C.; Pzsenny, V.; Zala, C.; Gonzalez, R.; Perelmulter, H. and Garberi, J.C. 1992. Early Diagnosis of Toxoplasmic Encephalitis in AIDS Patient by Dot Blot Hyridization Analysis. J.Clinical Microbiol. 30(12): 3286-3287
Araujo, F.G. 1994. Immunization against Toxoplasma gondii. Parasitol.Todays 10(9): 358-360.
Artama, W.T. 2007. Animal Toxoplasmosis in Indonesia : Serologic and Biomolecular Diagnostic. Prosiding Simposium Nasional Parasitologi dan Penyakit Tropis. 25-26 Agustus 2007. Bali: 1-11
Artama, W.T.; Utami, W.S. and Sarjono. 2009. Recombinant Granule Protein-1 for biomolecular diagnosis of Toxoplasmosis in Indonesia. Proceeding of
Internationl Conference on Animal Health and Human Safety. 6-8 Des.2009.
Kualalumpur Malaysia: 298-306.
Artama, W.T. 2009. Biologi Molekuler Toxoplasma dan Aplikasinya pada Penanggulangan Toxoplasmosis. Pidato Pengukuhan Jabatan Guru Besar dalam bidang Biokimia pada FKH-UGM: 1-25.
Bastien, P. 2002. Diagnosis. Molecular diagnosis of toxoplasmosis. Transactions of The Royal Society of Trop.Med.and Hyg. 96(1): 205-215.
Behnke, M.S.; Radke, J.B.; Smith, A.T.; Sullivan, W.J. and White, M.W. 2008. The transcription of bradyzoite genes in Toxoplasma gondii is controlled by autonomous promotor elements. Molecular Biology 68(6): 1502-1518.
Bonhomme, A; Maine, G.T.; Beorchia, A.; Burlet, H.; Aubert, D.; Villena, I.; Hunt, J.; Chovan, L.; Howard, L.; Brojanac, S.; Sheu, M.; Tyner, J.; Pluot, M. and Pinon, J.M. 1998. Quantitative immunolocalization of a P29 Protein (GRA7) a new antigen of Toxoplasma gondii. J.Histochem.and Cytochem. 46: 1411-1422. Brown, T. 2000. Hybridization Analysis of DNA Blots. Current Protocol in Molecular
100 Brown, T.A. 2006. The Basic Principles of Gene Cloning and DNA Analysis. In Gene
Cloning and DNA Analysis. An Introduction. Fifth Ed. Blackwell Publishing: 1 – 84
Budijanto, S.K. 1995. Antibodi IgA anti P30 sebagai petanda pada toksoplasmosis kongenital dan akut. Majalah Kedokteran Indonesia, 45(1): 61-65.
Burg, J.L.; Grover, C.M.; Poeletty, P. & Boothroyd, J.C. 1989. Direct and Sensitive Detection of a pathogenic protozoa Toxoplasma gondii by Polymerase chain Reaction. J.Clin.Microbiol. 27: 1787 – 1792
Burgess, G. W. dan Malcolm, K. M. 1995. ELISA untuk mendeteksi antigen. Dalam
Teknologi ELISA Dalam Diagnosis dan Penelitian. Terjemahan oleh
W.T.Artama. Gadjah Mada University Press. Cetakan Pertama : 252 – 257. Carruthers, V.B.; Sherman, G.D. and Sibley, L.D. 2000. The Toxoplasma adhesive
protein MIC2 is proteolytically processed at multiple sites by two parasite derived proteases. J.Biol.Chem. 275: 14346-14353.
Cesbron-Delauw, M.F.; Tomavo, S. and Beauchamp, P. 1994. Similarities between the primary structure of two distinct major surface protein of Toxoplasma gondii. J.Biol.Chem. 269(62): 17-22.
Chandra, G. 2001. Toxoplasma gondii : Aspek Biologi, Epidemiologi, Diagnosis dan Penatalaksanaannya. Medika XXVII (5): 297-304.
Chatterton, J.M.W. 1992. Pregnancy In: Ho-Yen DO, Joss AWL, Editor: Human Toxoplasmosis. Oxford: Oxford University Press: 144-184.
Chen, X.G.; Gong, Y.; Li, H.; Lun, Z.R.; Fung, M.C. 2001. High-level expression and Purification of Immunogenic recombinant SAG1 (P30) of Toxoplasma gondii in Escherichia coli. Protein Expression and Purification 23: 33-37.
Cheng, S; Fockler, C; Barnes, WM; Higuchi, R. 1994. Effective amplification of long target from cloned insert and human genomic DNA. Proceeding of the National Academy of Sciences. 91 (12): 5695-5699.
Chevalier, J.; Yi, J.; Michel, O. and Tang, X.M. 1997. Biotin and Digoxigenin as Labels for Ligth and Electron microscopy in situ hybridization probe : Where Do We Stand ?. J.Histochem.and Cytochem. 45: 481-492.
Chiabchalard, R.; Wiengcharoen, J.T. and Sukthana, Y. 2005. Sensitivity and Specificity of Polymerase Chain Reaction for Detection of Toxoplasma gondii DNA added to laboratory samples. Southest Asian J.Trop.Med.Public Health. 36(2): 408-411
101 Cornain, S.; Suryana, E.J.; Sugiharto; Jacoeb, T.Z.; Rahman, I.A.; Lubis, N.S. dan
Gusmiarti, N. 1991. Aspek immunolog dan pendekatan immunoterapi pada infeksi Toxoplasma. Majalah Kedokteran Indonesia. 41(7): 395-401.
Conraths, F.J. and Schares, G. 2006. Validation of Molecular diagnostic techniques in parasitological laboratory. Vet.Parasitol. 136: 91-98.
Clark, W.and Christopher, K. 2001. An Introduction to DNA: Spectrophotometry, Degradation and Frankengel experiment. University of Alberto.
Cristina, M.D.; Porto, P.D.; Buffolano, W.; Beghetto, E.; Spadoni, A.; Gaglietta, S.; Piccolella, E.; Felici, F. and Gargano, N. 2000. The Toxoplasma gondi
bradyzoite antigen BAG1 and MAG1 induce early humoral and cell-mediated immune responses upon human infection. Microbes and Infections. 6: 164-171. Curry, E.; Pratt, S.L.; Kelley, D.E.; Lapin, D.R. and Gibbons, J.R. 2008. Use of a
combined Duplex PCR/Dot blot assay sor more sensitive genetic characterization. Biochemistry Insights: 35-39.
Damriyasa,I.M.; Bauer, C.; Edelhofer, R; Failling, K; Lind, P; Peterson, E.; Schares, G.; Tenter, A.M.; Volmer, R. and Zahner, H. 2004. Cross Sectional study in pig breeding farm In Hesse, germany: Prevalence of antibodies to Toxoplasma gondii , Sarcocystis spp.,Neospora caninum in sows and analysis of risk factor. Vet.Parasitol. 126: 271-286.
Darcy, F and Santoro, P. 1994. Toxoplasmosis. Dalam Kierszen-baum, F (Ed). Parasitic Infection and the immune system. Academic Press, London: 163-201.
Darde, M.L. 2004. Genetic analysis of diversity in Toxoplasma gondii. Ann.Ist.Super Sanita. 40 (1): 57-63.
Daryani, A; Hosseini, A.Z.; Sharif, M.; Dalimi, A.; Dehghan, M.H. and Ziaei, H. 2006. Protective role of antigens from pritoneal exudates of infected mice against toxoplasmosis. Iran J.Immunol. 3(2): 78-85.
Darwich, L.; Cabezon, O.; Echeverria, I.; Pabon, M.; Marco, I.; Lopez, R.M.; Alarcia-Alejos, O.; Gatius, F.L.; Lavin, S. and Almeria, S. 2011. Presence of Toxoplasma gondii and Neospora caninum DNA in the brain of wild bird. Vet.Parasitol. 23: 21831525.
Desmonts, G. and Remington, J.S. 1980. Direct Agglutination test for Diagnosis of
Toxoplasma Infection : Method for Increasing sensitivity and Specificity. J. Clinical Microbiol. 11: 562-568.
102 Drennan, J.L.; Westra, A.A.G.; Slack, S.A.; Delserone, I.M. and Collmer, A. 1993.
Comparison of a DNA Hybridization Probe and ELISA for the Detection of
Clavibacter michiganensis subsp. sepedonicus in Fild-Grown Potatoes. Plant Dis. 77(12): 1243-1247.
Dubey, J.P.; Desmont, G.; McDonald, C.; and Walls, K.W. 1985.Serologic evaluation of Cattle inoculated with Toxoplasma gondii comparison of sabin-Fieldman dye test and other aglutination test. Am.J.Vet.Res. 46: 1085-1088
Dubey, J.P. 1986. : Riview of Toxoplasmosis in Pig. Vet.Parasitol: 19: 181-223.
_________ 1988. Long term persistence of Toxoplasma gondii in tissue of pigs inoculated with T.gondii ocyst and effect of freezing on viability of tissue cyst pork. Am.J.Vet.Res. 49(6): 910-913.
Dubey, J.P. and Beattle C.P. 1988. Toxoplasmosis of animal and man. Boca Raton, FL. CRC. Press: 69-80
Dubey, J.P. 1994. Toxoplasmosis. J.Am.Vet.Med.Assoc. 205: 1593-1598.
Dubey, J.P.; Thuliez, P.; Wegel, R.M.; Andrew,C.D.; Lind, P. and Powel, E.C. 1995. Sencitivity and Specificity of various serologic test for detection of Toxoplasma gondii infection in naturally infected sows. Am.J.Vet.Res. 56: 1033-1036. Dubey, J.P. 1996. Pathogenicity and Infectivity of Toxoplasma gondii oocyst for Rats.
J.Parasitol. 83(6): 95-956.
_________ 1997. Distribution of tissue cyst in organ of rats fed Toxoplasma gondii
oocysts. J.Parasitol. 83(4): 755-757.
_________ 1998. Refinement of Pepsin digestion method for isolation of Toxoplasma gondii from infected tissue. Vet.Parasitol. 74: 75-77.
Dubey, J.P.; Linsay, D.S. and Speer, A. 1998. Structure of Toxoplasma gondii
tachyzoites, bradizoites and spoozoites and biology and development of tissue cysts. Clin.Microbiol.Rev. 11(2): 267-299.
Dubey, J.P.; Graham, D.H.; Dahl, E.; Hilali, M.; El-Ghaysh, A.; Sreekumar, C.; Kwok,O.C.H. Shen, S.K. and Lehman, T. 2003a. Isolation and Moleculer Characterization of Toxoplasma gondii from Chickens and Ducks from Egypt. Vet.Parasitol. 114: 89-95
Dubey, J.P. ; Navaro, I.T.; Graham, D.H.; Dahl, E.; Hilali, M.; Freire, L.B.; Prudencio, L.B.; Sreekumar, C.; Viana, M.C.B. and Lehman, T. 2003b. Characterization of Toxoplasma gondii isolate from free range chickens from Parana, Brazil. Vet.
103 Dubey, J.P.; Venturini, M.C.; Venturini, L.; Piscopo, M.; Graham, D.H.; Dahl, E.;
Sreekumar, C.; Viana, M.C. and Lehmann, T. 2003c. Isolation and Genotyping ofToxoplasma gondii from Free Ranging Chickens from Argentina. J.Parasitol. 89(5): 1063-1064.
Dubey, J.P.; Graham, D.H.; Dahl, E.; Sreekumar, C.; Lehmann, T.; Davis, M.F. and Morishita, T.Y. 2003d. Toxoplasma gondii Isolates from Free Ranging Chickens from the United States. J.Parasitol. 89(5): 1060-1062.
Dubey, J.P.; Morales, E.S. and Lehman, T. 2004. Isolation and Genotyping of
Toxoplasma gondii from Free-Ranging Chickens from Mexico. J.Parasitol. 90(2): 411-412
Dubey, J.P.; Paula, L. and Lehmann, T. 2005. Characterization of Toxoplasma gondii
Isolates in free-ranging chickens from argentina. J.Parasitol. 91(6): 1335-1339. Dubey, J.P.; Su, C.; Oliviera, J.; Morales, J.A.; Bolanos, R.V.; Sundar, N.; Kwok,
O.C.H. and Shen, S.K. 2006. Biologic and Characterization of Toxoplasma gondii isolates in free-ranging chickens from Costa Rica, Central America. Vet. Parasitol. 139: 29-36
Dubey, J.P. 2007. The history and life cycle of Toxoplasma gondii. In : Toxoplasma gondii the model apicomplexa. Perspectives and methods. Weiss, L.M. and Kim, K (eds). Elsevier Ltd, Amsterdam.
Dubey, J.P. and Jones, J.L. 2008. Toxoplasma gondii Infection in Human and Animals in United State. Int.J.Parasitol. 38: 1257-1278
El-Massry, A.; Mahdy, O.A.; El-Ghaysh, A. and Dubey, J.P. 2003. Prevalence of
Toxoplasma gondii Antibodies in Sera of Turkey, Chicken and Duck from Egypt. J.Parasitol. 86(3): 627-628.
Evans, R. 1992. Life Cycle an animal infection. In Ho-Yen, DO and Joss, AWL (eds). Human Toxoplasmosis. Oxford Univ.Press, Oxford, GB.: 26-55.
Faria, E.B.; Gennari, M.S.; Pena, H.F.J.; Athayde, R.A.C.; Silva, M.L.C.R. and Azevado, S.S. 2007. Prevalence of anti-Toxoplasma gondii and anti Neospora caninum antibodies in Goats Slaughtered in The Public Slaughterhouse of Patos city, Paraiba State, Northeast region of Brazil. Vet.Parasitol. 149: 126-129 Feyer, R; Gamble, HR; Lichtenfels, JR and Bier, JW (1992). Food borne and water
bone Parasites. In Compendium of Methods for microbiological examination of food (ed Speck, ML). Washington DC. USA Am.Pub.Health Ass.: 789-809 Frenkel, J.K. 1990. Transmision of Toxoplasmosis and The Role of Immunity in
104 Filliseti, D. and Candolfi, E. 2004. Immune response to Toxoplasma gondii. Ann.Ist.
Super Sania. 40(1): 71-80.
Fusco, G.; Rinaldi, L; Guarino, A; Proroga, Y.T.R.; Pesce, A; Giuseppina, D.M. and Cringoli, G. 2007. Toxoplasma gondii in sheep from the Champania region (Italy). Vet.Parasitol. 149: 271-274
Furuya, H; Yamada, T; Ikezoe, K; Ohyagi, Y; Fukumaki, Y; Fujii, N. 2006. An improved method for Southern DNA and Northern RNA blotting using a Mupid-2 Mini-Gel electrophoresis unit. J.Biochem.Biophys.Methods. 68(2): 139-143 Garberi, J.C.; Angel, S.O.; Paulin, P.; Pszenny, V. And Romano, L. 1994. Use of a
monoclonal antibody and a DNA probe for diagnosing acute toxoplasmosis in ambiguous cases. J.Clin.Pathol. 47: 853-854
Ge, N.L.; Kocan, M.; Murphy, G.L. and Blouin, E.F. 1995. Detection of Anaplasma marginale DNA in Bovine erythrocyte by slot-blot and In Situ hybridization with a PCR-mediated digoxigenin-labeled DNA Probe. J.Vet.Diagn.Invest. 7: 465-472.
Goel, R.; Kumar, P.; Sinha, R.and Ambwani, S. 2004. Dot blot assay using reverse-probe genomic hybridization of repetitive DNA for environmental monitering of flourescent Pseudomonads. Indian J.Biotech. 3: 82-85.
Goodwin, MA; Dubey, JP and Hatkin, J. 1994. Toxoplasma gondi peripheral neuritis in chickens. J.Vet.Diagn.Invest. 6: 682-385.
Hanafiah, M.; Nurcahyo, W.; Kamarudin, M. dan Karmil, F. 2009. Produksi dan Isolasi Protein Membran Stadium Bradizoit Toxoplasma gondii : Suatu usaha untuk mendapatkan material diagnostik dalam mendiagnosa toksoplasmosis. Jur.Vet.
10(3): 156-164.
Hartati, S; Widada, S.J.; Sumartono dan Kusumawati, A. 2003. Cloning of gene encoding SAG1 of lokal isolate Toxoplasma gondii in Escherichia coli DH5α. J. Sain Vet. XX(2): 51-56.
Hartati, S.; Kusumawati, A.; Wuryastuti, H.and Widada, J.S. 2006. Primary structure of mature SAG1 gene of an Indonesian Toxoplasma gondii and comparison with other strains. J.Vet.Sci. 7(3): 263-270.
Hartono, T. (1990). Identifikasi kista Toxoplasma gondii pada kambing/domba di RPH Surabaya dan Malang. Cermin Dunia Kedokteran 61: 31-33.
105 Hayde, M. and Polack, A. 2000. A Clinical picture neonatal sign and symptoms. In:
Ambroise Thomas P; Peterson E editor. Congenital Toxoplasmosis: scientific background, Clinical Management and Control. Paris. Springer verlag. France: 153-164.
Held, P. 2001. The Importance of the 240 nm Absorbance Measurement. Biotek Instruments, Inc. Winooski, VT, USA. www.Biotek.com.: 1-3
Hendrix, C.M. 1998. Diagnostic Veterinary Parasitology. 2ndEd. Masby: 7-8.
Hermawan, P. 1988. Survey Serologis terhadap Toksoplamosis pada Ayam Buras di Kabupaten Lamongan dengan Uji Haemaglutinasi tak Langsung. Skripsi. FKH-UNAIR. Surabaya: 1-53.
Herzer, S and Englert, D.F. 2001. Nucleic Acid Hybridization. Molecular Biology Problem Solver: A Laboratory Guide. Willey-Liss, Inc.
Hitt, J.A. and Filice, G.A. 1992. Detection of Toxoplasma gondii parasitemia by gene amplification, cell culture and mouse inoculation. J.Clin.Microbiol. 30(12): 3181-3184.
Hohlfield, P.; Daffos, F.; Costa, J.M.; Thulliez, P.; Forestier, F. and Vidaud, M. 1994. Prenatal diagnosis of congenital Toxoplasmosis with Polymerase Chain Reaction test on amniotic fluid. The New England J.Med. 331 (11): 695-699.
Holec, L.; Hiszczynska-Sawicka, E.; Gasior, A.; Brillowski-Dabrowski, A. and Kur, J. 2007. Clinical and Vaccine.Immunol.14(3): 220-225.
Holliman, R.E. 2003. Toxoplasmosis. In: A manson,s tropical diseases. 21th ed. Cook, G.C. and Zumia(eds). Saunders Elsevier Science, London: 211-240
Ho-Yen, D.O.; Joss, A.W.; Balfour, A.H.; Smyth, E.T.; Baird, D. and Chatterton, J.M. 1992. Use of the polymerase chain reaction to detect Toxoplasma gondii in human blood samples. J.Clin.Path. 45: 910-913.
Howe, D..K and Sibley, L.D. 1995. Toxoplasma gondii comprises three clonal lineages corelation of parasites genotype with human diseases. J.Infect.Dis.172: 1561-1566.
Howe, D.K.; Mercier, C.; Messina, M. and Sibley, L.D. 1997. Expression of
Toxoplasma gondii in the closely related apicomplexan parasites Neospora caninum. Moleculer and Biochem.Parasitol. 86: 29-36.
Ibrahim, A.K.; Abeer, A.; Abdelall and Amin, A.S. 2012. Long-Term Diagnostic Studies for Detection of Brucella spp. in Milk Samples. Global Veterinaria. 8(1): 54-61
106 Indra, C. 2003. Epidemiologi Toxoplasma gondii. USU Digital Library: 1-13
Indri, S. 1999. Hibridisasi Asam Nukleat. Dalam Biologi Molekuler Kedokteran. Ed Suhartono Taat Putra. Airlangga University Press.: 168-172.
Iskandar, T. 1998. Pengisolasian Toxoplasma gondii dari Otot Diafragma Seekor Domba yang Mengandung Titer Antibodi Tinggi dan Tanah Tinja dari Seekor Kucing. Jurnal Ilmu Ternak dan Veteriner. 3(2): 111-116.
Jackson, M.H and Hutchinson, W.M. 1989. The prevalence and source of Toxoplasma
infection in the environtment. Adv.Parasitol. 28: 55-104.
Jacobs, I; Remington, JS. And Milton, MI. 1960. A Survey of meat samples from swine, cattle and sheep for the presence of encysted Toxoplasma. J.Parasitol. 46: 23-26 Jensen, L.; Heegaard, P.M.H. and Lind, P. 1998. A study of virulence parameters for
Toxoplasma gondii infections in mice. Parasitol.Res.84: 382-387.
Jin, Si ; Chang, Z.Y.; Ming, Xu; Min, C.L.; Wei, He; Sheng, L.Y. and Hong, G.X. 2005. Fast Dipstick Dye Immunoassay for Detection of Immunoglobulin G (IgG) and IgM Antibodies of Human Toxoplasmosis. Clin.Diagn.Lab.Immunol. 12(1) : 198-201.
Jittapalapong, S.; Nimsupan, B.; Pinyopanuwat, N.; Chimnoi, W.; Kabeya, H. and Maruyama, S. 2006. Seroprevalence of Toxoplasma gondii antibodies in stray cats and dogs in the Bankok metropolitan area. Thailand Vet.Parasitol. 10: 3833-3837.
Johnson, A.M.; Robert, H. and Tenter, A.M. 1992. Evaluation of recombinant antigen ELISA for the diagnosis of acute toxoplasmosis and comparison with traditional Antigen ELISAs. J.Med.Microbiol. 37: 404-409.
Joiner, I.A. and Roos, D.S. 2002. Secretory traffic in the Eukaryotic parasite
Toxoplasma gondii : Less is more. J.Cell Biol. 157(4): 557-563
Jones, D.D.; Okbravi, N.; Adamson, P; Tasker, S and Ligbtman, S. 2000. Comparison of PCR detection methods for B1, P30 and 18S rDNA genes of Toxoplasma gondii
in equeous humor. Int.Opthamol.Vis.Sci. 41(3): 634-644
Jungersen, G.; Bille-Hansen, V.; Jensen, L. and Lind, P. 2001. Tranplacental transmission of Toxoplasma gondii in minipig infected with strain of different virulence. J.Parasitol. 87(1): 108-113.
Kazemi, B.; Bandepour, M.; Maghen, L. and Solgi, G.H. 2007a. Gene Cloning of 30 kDa Toxoplasma gondii tachyzoite surface antigen (SAG1). Iranian J.Parasitol. 2(2): 1-8.
107 Kazemi, B.; Maghen, L.; Bandehpour, M.; Shahabi, S. and Haghighi, A. 2007b. Gene Cloning of 43 kDa surface protein of Toxoplasma gondii tachyzoite and bradyzoite (SAG3). Gene Ther.Mol.Biol. 11: 113-116.
Karkata, K. dan Suwardewa, T.G.A.. 2006. Infeksi TORCH pada ibu hamil di RSUP Sanglah Denpasar. Cermin Dunia Kedokteran. 151: 5-7.
Kasper,L.H. and Boothroyd, J.C. 1993. Toxoplasma gondii and Toxoplasmosis. In
Immunology and Moleculr Biology of Parasitic Infections. Ed by Kenneth S
Warren. Blackwell Scientific Publications. Oxford. London Edinburgh, Melbourne Paris Berlin Vienna: 269-301
Keller, G.H. and Manak, M.M. 1989. DNA Probe. Macmillan Publisher ltd.: 1-16. Khan, A.; Taylor, S.; Su, C.; Mackey, A.J.; Boyle, J.; Cole, R.; Glover, D.; Tang, K.;
Paulsen, I.T.; Berriman, M.; Boothroyd, J.C.; Pfefferkorn, E.R. Dubey, J.P.; Ajioka, J.W.; Roos, D.S.; Wootton, J.C. and Sibley, L.D. 2005. Composite genome map and recombination parameters derived from three archetypal lineages of Toxoplasma gondii. Nucleic Acid Res. 33(9): 2980-2992.
Koskiniemi, M.; Lappaiainen, M.; Hedman, K. 1989. Toxoplasmosis needs evaluation on : Overview and proposals. Am.J.Dis.Chid. 143: 724-728.
Kresno, S.B. 1996. Imunologi. Diagnosis dan Prosedur Laboratorium. Ed ketiga. Penerbit Fakultas Kedokteran UI-Jakarta: 1-336.
Kruchen, B. and Rueger, B. 2003. The Dig System – Nonradioactive and Highly Sensitive Detection of Nucleic Acids. Biochemica.3: 13-15.
Kusumawati, A.; Nafratilova, S. and Hartati, S. 2011. Digoxigenin(DIG) Labeled Probe Candidate of Surface antigen1 (SAG1) for Toxoplasma gondii Detection. Ind.J. Biotech. 16(1): 17-23.
Lehman, T.; Blacksten, C.R.; Parmiey, S.F.; Remington, J.S. and Dubey, J.P. 2000. Strain typing of Toxoplasma gondii: Comparison of antigen-coding and housekeeping genes. J.Parasitol. 8(5): 960-971.
Lehman, T.; Graham, D.H; Dahl, E.; Sreekumar, C.; Launer, F.; Corn, J.L.; Gamble, H.R and Dubey, J.P. 2003. Transmission dynamics of Toxolasma gondii on a pig farm. Infect.Genet.Evol. 3: 135-141.
Leitch, A.R.; Schwarzacher, T.; Jackson, D and Leitch, I.J. 1994. 1sted. In situ hybridization. A practical guide, BOS Sciencetific Publisher Limited: 4-5: 33-39 Levine, N.D. 1994. Buku Pelajaran Parasitologi Veteriner. Edisi Indonesia. Gadjah
108 __________ 1995. Protozoologi Veteriner. Edisi Indonesia. Gadjah Mada University
Press.: 1-585
Liesenfeld, O.; Montoya, J.G.; Tathinemi, N.J.; Davis, M.; Brown, Jr. B.W.; Cobb, K.L.; Parssonet, J. and Remington, J.S. 2001. Confirmatory serologic testing for acute toxoplasmosis and rate of induced abortions among women reported to have positive Toxoplasma immunoglobulin M antibody titer. Am.J.Obstet.Gynecol. 184: 140-145.
Lodish, H.; Berk, A.; Matsudaira, P.; Kaiser, C.A.; Krieger, M.; Scott, P.M.; Zipursky, L. and Darnell, J. 2006. Moleculer Cell Biology. 5th Ed. Media conected.: 40-408.
Lubis, N.K.; Gandahusada, S. dan Surjana, E.J. 1997. Peran antibodi IgA dan IgE pada diagnosis toksoplasmosis. Majalah Kedokteran Indonesia, 4(11): 563-567. Luft, B.J.; Haffler, M.D. and Korzun, A.H. 1993. Toxoplasmic encephalitis in patients
with the aquaired immunodeficiency syndrome.New England J.Med. 329: 995-1000.
Luft, BJ. and Remington, JS. 1988. AIDS commentary. Toxoplasmosis encephalitis. J.Infect.Dis. 157(1): 1-6
Lyons, R.E.; McLeod, R. and Robert, C.W. 2002. Toxoplasma gondii Tachyzite-bradyzoite interconversion. Trends in Parasitol. 18(5): 198-201.
Maganathan, P; Singh, S; Ling, LY; Singh, J; Subrayan, V and Nisapatorn, V. 2010. Detection of Toxoplasma gondii DNA by PCR following microwave treatment of serum and whole blood. Southeast Asian J.Trop.Med.Public Health. 41(2): 265-273.
Maroef, S. 1990. Toxoplasmosis di Indonesia. Cermin Dunia Kedokteran, 61: 34- 39. Martin, J.; Kwok, O.C.H. and Dubey, J.P. 2011. Seroprevalence of Neospora caninum in
free-range chickens (Gallus domesticus) from Americas. Vet.Parasitol. 27: 21676546.
McLeod, R.; Mack, D. and Brown, C. 1991. Toxoplasma gondii-New advance in Cellular and Moleculer Biology. Exp.Parasitol. 72: 109-121.
McPherson, M.J.; Quirke, P.; Taylor, G.R.1992. PCR. A practical Approach. IRL Press Milton, M.; McAllister, Stephen, F.; Parmiey; Weiss, L.M.; Weich, V.J. and McGuire,
A.M. 1996. An Immunohistochemical Method for detecting Bradyzoite antigen (BAG5) in Toxoplasma gondii-Infected tissue cross-reacts with a Neospora caninum bradyzoite antigen. J.Parasitol. 82(2): 354-355.
109 Montoya, J.G. and Liesenfeld, O. 2004. Toxoplasmosis. The Lancet. 363: 1965-1967. Mori, J.; Field, A.M.; Clewley, J.P. and Cohen, B.J. 1989. Dot Blot Hybridization Assay
of B19 Virus DNA i Clinical Specimens. J.Clin.Microbiol. 27(3): 459-464. Mudenda, H.B.; Willliam, U.; James, M.C.L.; Charles, M.; Nayuta, I.; Evans, M.;
Ladslav, M.; Hiroshi, I. And Emiko, I. 2011. Feasibility of using dot blot hybridization to detect Salmonella InvA, SpiC and SipC directly from clinical specimens. African J.Microbiol.Res. 5(6): 582-585.
Mufasirin 1999. Kloning dan Ekpresi cDNA yang menyandi Protein Membran Takizoit
Toxoplasma gondii Isolat Bogor. Tesis. Universitas Gadjah Mada, Yogyakara: 1-69
Mufasirin; Suprihati, E. dan Suwanti, L.T. 2003. Studi Toksoplasmosis pada Telur Ayam yang dijual sebagai campuran jamu di kota Surabaya dan Kabupaten Sidoarjo menggunakan uji Dot Blot. J.Penelitian Medika Eksakta. 4(2): 113-119.
Muller, N.; Zimmerman, V.; Hetrich, B. and Gottstein, B. (1996).Diagnosis of Neospora caninum and Toxoplasma gondii infection by PCR and DNA hybridization immunoassy. J.Clin.Microbiol. 34: 2850-2652.
Nardone, R.M. 1999. Overview of In Situ Hybridization. In Imunocytochemical Methods and Protocols. Second eds. Edited by Lorette C Javois. Humana Press.
Totowa, New Jersey: 357-363.
Owen, M.R.; Clarkson, M.J. and Trees, A.J. 1998a. Diagnosis of Toxoplasma abortion in ewes by polymerase chain reaction. Vet.Record. 142: 445-448.
__________ 1998b. Acute phase Toxoplasma abortion in sheep. Vet.Record. 142: 480-482.
Palmer, H.M.; Atkinson, H.J. and Perry, R.N. 1991. The Use of DNA probe to identify Ditylenchus dipsaci. Revue Nematol. 14(4): 625-628.
Patricia, M.; Craver, J. and Knoll, L.J. 2007. Increased efficiency of homologous recombination in Toxoplasma gondii dense granule protein 3 demontrates that GRA3 is not necessary in cell culture does contribute to virulence. Mol.and Biochem.Parasitol. 153: 149-157.
Pesic, Z. and Hiruki, C. 1988. Comparison of ELISA and dot-hybridization for of Alfalfa mosaic virus in alfalfa pollen. Can.J.Plant Pathol. 10: 116-122.
Polak, M.W.P.; Wojciech, R. and Zmudzinski, J.F. 2005. Implementation of Dot Blot in Rapid Diagnosis of BSE. Bull.Vet.Inst.Pulawy. 49: 263-266.
110 Powell, L.C.; Brewer, M. and Lappin, M.R. 2001. Detection of Toxoplasma gondii in
the milk of experientally infected lactating cats. Vet.Parasitol. 102: 29-33.
Pratama, D.A.O.A. 2009. Analisis Toxoplasma gondii repeat region 529 bp (NCBI Acc No AF146527) sebagai kandidat probe untuk diagnosis molekuler toksoplasmosis. Tesis Program Studi Bioteknologi. Pascasarjana – UGM. Yogyakarta.
Priadi, A. 2003. Prinsip Dasar Enzyme Linked Immunosorbant Assay (ELISA).
Dalam Whorkshop Pengembangan Diagnostik Fasciolosis dengan ELISA untuk Mendeteksi Cathepsin L(CatL). BPV. Bogor. 17-19 Februari 2003.
Primrose, S.B. 1995. Principles of genome analysis. A guide to mapping and sequencingDNA from different organism. Blackwell Science. Oxford.
Priyana, A. 2000. Antibodi Anti Toxoplasma pada Ayam Kampung (Gallus domestius) di Jakarta. Majalah Kedokteran Indonesia. 50(11): 504-507.
Priyowidodo. 2003. Kajian Metoda Diagnosis Toksoplasmosis secara Polymerase Chain Reaction (PCR) dan Pemeriksaan Histologis. Tesis. Universitas Gadjah Mada, Yogyakarta.: 1-51
Pruitt, K.D., Tatusova, T., Maglott, D.R. 2005. NCBI Reference Sequence. (RefSeq): a curated non-redundant sequence database of genomes, transcripts and proteins.
Nucleic Acids Res. 33, D501-D504
Purwanto, M.; Lusida, M.I. dan Handayani, R. 1997. Polymerase chain reaction. Dalam
Biologi Molekuler Kedokteran. Editor Suhartono Taat Putra. Edisi pertama.
Erlangga Universiy Press.: 150-167
Raizman, R.E. and Neva, F.A. 1975. Detection of circulating antigen in acute experimental Infection with Toxoplasma gondii. J.Infect.Dis. 122, 44-48.
Reischl, U., S. Bretagne, D. Kruger, P. Ernault, J.M. Costa. 2003. Comparison of Two DNA Targets for the Diagnosis of Toxoplasmosis by Real-time PCR using Fluorescence Resonance Energy Transfer Hybridization Probes. BMC. Infect.Dis. 3(1): 1-9.
Remington, J.S. and Destmon, G. 1990. In Remington, JS; Kleid GO (eds). Infection Diseases of the fetus and Newborn infant 4th.ed.Philadelphia WB. Saunders Comp.: 89-195.
Remington, J.S.; McLeod, R.; Destmont, G. 1995. In: Remington JS : Kleid JO (eds)Infection Diseases of the fetus and Newborn infant. 2 ed . Philadelphia WB Saunder Comp.: 140-257.
111 Remington, J.S.; Tulliez, P. and Montoya, J.G. 2004. Recent development for diagnosis
of toxoplasmosis. J.Microbiol. 42(3): 941-945.
Roche, P.J. 2006. Preparationof Template DNA and Labeling Techniques. From Methods in Molecular Biology, vol 326 : In Situ Hybridization Protocols : Third Edition. Edited by : I.A.Darby and T.D.Hewitson. Humana Press Inc, Totowa, NJ.: 9 – 16
Roche, 2009. DIG High Prime DNA Labeling and Detection Starter Kit I. WWW.roche-applied-science.com.
Rueue, K., 1998. mRNA Quantitation Techniques: Considerations for Experimental Design and Application. J.Nutrition. 128(11): 2038-2044.
Salehzada, T. and Taha, M.N. 1992. Licence de Biochemie. Travaux Practique de Biochemie. Biochemie des Proteine. Biochemie Moleculaire. Universitie Montpellier II. U.F.R-S. F.A.: 10-22.
Salis, AD. 2009. Application in Clinical Microbiology. Real time PCR: Current Technology and Application. Caister Academic Press. ISSN 978-1-90445539-4 Sambrook, J. and Russell, D.W. 2001. The Basic Polymerase Chain Reaction. In
Molecular cloning. A Laboratory manual. Third Ed. Cold Spring Harbor Laboratory Press, NewYork. Vol 2: 8.18 – 8.24
Samuelson, J.; Soto, R.A.; Reed, S.; Biage, F. and Wirth, D. 1989. DNA Hybridization Probe for Clinical Diagnosis of Entamoeba histolitica. J.Clin.Microbiol. 27(4): 671-676.
Sandi, E.A. and Brenes, O.V. 2005. Serological Prevalence of Toxoplasma gondii in Free-range Chickens from Costa Rica. Trop.Ann.Health Prod. 37: 369-372. Sarjono; Nurcahyo, W dan Hanafiah, M. (2004). Studi Produksi takizoit Toxoplasma
gondii dari pembiakan in vivo pada mencit (Mus musculus).Media Kedokteran Hewan. 20(2): 53-56
Sarovar, B. and Saigopal, D.V.R. 2010. Development of Probe-base blotting technique for the detection of Tobacco streak virus. Acta Virologica. 54: 221-234.
Sarva, U. and Holliman R.E. 1989. Diagnosis of Ovine Toxoplasmosis: an alternative to Serology. Vet.Record. 125: 212.
Sibley, D.; Howe, K.; Wan, K.L.; Khan, S.; Aslett, M.A.; Ajioka, J.W. 1996.
Toxoplasma as a model genetic system. In Molecular Biology of Parasitic Protozoa. Edited by Deborah F. Smith and Marilyn Parson. IRL Press.: 55 – 74.
112 Son, E.S. and Nam, H.W. 2001. Detection and Characterization of Excretory/Secretory
Protein from Toxoplasma gondii by Monoklonal Antibodies. Korean J. Parasitol. 39(1): 49-56.
Soulsby, E.J.L. 1982. Protozoa. In Helminth, Arthropods and Protozoa of domesticated animals. 7th Ed. Bailliere Tindall London: 507-759
Sreekumar, C.; Grahan, D.H.; Dahl, E.; Hilali, M.; Freire, L.B., Prudencio, L.B.; Viana, M.C.B. and Lehman, T.; Dubey, J.P. 2003. Genotyping of Toxoplasma gondii
isolates from Chickens from India. Vet.Parasitol.118: 186-194.
Steuber, V.S.; Niu, A.; Reetz, J.; Roth, A. and Janitschke, K. 1995. Der Nachweis von
Toxoplasma gondii in abortgeweben vom schaf mittels der polymerase-ketterreaktion. Dsch.Tierarztl.wschr. 102: 91-93.
Subekti, D.T.; Artama, W.T. dan Iskandar, T. 2005. Perkembangan kasus dan Teknologi diagnosis Toksoplasmosis. Lokakarya Nasional Penyakit Zoonosis.Bogor Sudjadi. 2008. Bioteknologi Kesehatan. Cetakan pertama. Penerbit Kanisius: 21-279 Sumartono; Nurcahyo, W. dan PriyoWidodo, D. 2005. Pengembangan Probe Molekuler
untuk Optimalisasi diagnosis Koksidiosis. J.Sain Vet. 23(2): 60-66.
Sumartono; Artama, W.T., Asmara, W. dan Tabbu, C.R. 2007. Analisis kandidat probe molekuler untuk diagnosis toksoplasmosis berdasarkan fragmen sekuen repetitif genom takizoit. Media Kedokteran Hewan23(1): 7-12.
Suratma, A. 2008. Sensitifitas dan Spesifisitas uji ELISA menggunakan antigen Protein 30 kDa untuk mendeteksi kista Toxoplasma gondii dalam jaringan Babi. Disertasi-Program Pascasarjana-UNUD.
Suryadi (2006). Bahan Genetik. Dalam Genetika Kedokteran. Fakultas Kedokteran. UGM: 7-20.
Susanto, L.; Supali, T. dan Gandahusada, S. 2002. Penentuan konsentrasi minimal Gen B1 dan Gen P30 Toxoplasma gondii yang masih terdeteksi dengan reaksi Rantai Polimerase. Makara Kesehatan 6(2): 64-70.
Susanto, L.; Gandahusada, S. dan Muljono, R. 1999. Invasi Toxolasma gondii ke dalam sel hospes serta deferensiasinya dari takizoit ke bradizoit. Majalah Kedokteran Indonesia. 49 (6): 208-211.
Suwanti, LT.; Suprihati, E.; Mufasirin. (2006). Prevalensi Toxoplasmosis pada Ayam di beberapa Pasar di kota Surabaya. Media Kedokteran Hewan. 22(1): 32-35.
113 Taylor, G.R. 1991. Polymerase Chain Reaction. Basic principles and automation. In
PCR a practical approach. Ed by M.J.Mepherson, P.Quirhe and GR.Taylor.
Oxford University Press.: 1-13
Tenter, A.M.; Vietmeyer, C. and Johnson, A.M. 1992. Development of ELISAs based on Recombinant antigen for the detection of Toxoplasma gondii-spesific in sheep and Cats . Vet.Parasitol. 43: 187-194
Tenter, A.M.; Seineke, P.; Simon, K. ; Heckerozh, A.R.; Damriyasa, I.M.; Bauer, C. and Zahner, H. 1999. Aktuelle Studien zur Epidemiologie von Toxoplasma
infectionen. Proc.German Vet.Med.Soc.1999: 247-264.
Tenter, A.M.; Heckeroth, A.R.; Weiss, L.M. 2000. Toxoplasma gondii : From Animals to humans. Int.J.Parasitol. 30: 1217-1258.
Tomavo, S.; Fortier, B; Soete, M.; Ansel, C.; Camus, D. and Dubremetz, J.F. 1991. Characterization of bradyzoite-specific antigens of Toxoplasma gondii. Infect. and Immunity. 59(10): 3750-3753.
Tomavo. 1996. The Major Surface Protein of Toxoplasma gondii : Structures and Functions. Toxoplasma gondii Gross, U (eds). Springer-Verlag. Berlin.
Waree, P.; Ferguson, D.J.P.; Pongponratn, E.; Chaisri, U. and Sukthana, Y. 2007. Immunohistochemical study of acute and chronic Toxoplasmosis in experimentally infected mice. Shouthest Asian J.Trop.Med.Helth. 38(2): 223-231.
Weiss, L.M; Ma, Y.F; Takvorian, P.M; Tanowitz, H.B and Wittner, M. 1998. Bradyzoite Development in Toxoplasma gondii and the hsp 70 Stress Response. Infect. Imun. 66(2): 3295-3302.
Weiss, L.M. and Kim, K. 2000. The development and Biology of Bradizoite of Toxoplasma gondii. Frontiers in Bioscience6: 391-405.
Weiss, J. 1995. DNA Probe and PCR for Diagnosis of Parasitic Infectious. Clin. Microbiol. 8(1): 113-130
Winarto. 2008. Peran Protein Rekombinan ROPTRI dalam Pengembangan Diagnostik secara Molekuler pada Infeksi Aktif Toxoplasma gondii. Disertasi. Universitas Diponogoro, Semarang: 1-227
Wu, K; Chen, X.G; Li, H.; Yan, H.; Yang, P.L.; Lun, Z.R; Zhu, X.Q. 2009. Diagnosis of Human toxoplasmosis by using the recombinant truncated surface antigen 1 of
114 Yang, H.; Wanner, I.B.; Roper, S.D. and Chaudhari, N. 1999. An Optimized Method
for In Situ Hybridization with signal amplification hat allows the detection of Rare mRNAs. J.Histochem.and Cytochem. 47: 431-446.
Yasodara, P.; Ramalakshmi, B.A.; Sarma, M.K.J. 2001. A New Approach to Defferentiate Recent VS Chronic Toxoplasma Infection : Avidity ELISA in
Toxoplasma serology. Indian J.Med.Microbiol. 19(3): 145-148
Yuwono, T. 2006. Teori dan Aplikasi Polymerase Chain Reaction. Edisi pertama. Penerbit Andi Yogyakarta: 1-237
Yuwono, T. 2008. Biologi Molekuler. Edisi pertama. Penerbit Erlangga: 1-258
Zhang, Y.W.; Kim, K.; Ma, Y.F.; Wittner, M; Tanowitz, H.B. and Weiss, L.M. 1999. Disruption of Toxoplasma gondii bradyzoite-specific gene bag-1 decreases in vivo cyst formation. Mol.Microbiol. 31(2): 691-701.