2S.3 The number of CCS reads generated by a single SMRT cell 53 2S.4 Negative correlation between sequence quality and sequence length in raw. 2S.6 Positive correlation between homopolymer length and raw CCS read length 56 2S.7 Base position GC content of CCS reads before (black) and after quality control. 3S.3 Spatial genetic relatedness of seedlings to the subgroup of female and male trees 134 3S.4 Posterior distribution of mating neighborhood size 135 3S.5 Validation of ABC inference of median seed dispersal distance 136.
3S.7 SGS as a function of mean seed and pollen dispersal distance 138 4.1 Frequency distribution of seed dispersal distances based on provenance. 4S.2 Estimated Parameters of Seed Dispersal Models–GSMi, GSM, SSMi, and SSM 189 4S.3 Estimated Parameters of CSMi Pollen Dispersal Model 190 4S.4 Simulated Genetic Influences of Near vs. Forest Trees. and pollen is critical for tracking changing climate zones and for maintaining the genetic variation needed to adapt to changing environments.
This dissertation aims to quantify the spatial extent and extent of seed and pollen dispersal and their genetic influences in a comparative context, focusing on four Neotropical tree species that have distinct dispersal and pollination syndromes and life history strategies. Furthermore, simulations with realistically represented gene dispersal distances show that limitation of seed and pollen dispersal can lead to loss of genetic diversity in tropical tree populations.
Introduction
Seed- and pollen-mediated gene spread affects the ecological and evolutionary dynamics of forest trees (Levin et al. 2003; Kremer et al. 2012). Our empirical knowledge of the ecological processes of seed and pollen dispersal and their relative genetic importance in tree populations comes mainly from temperate species. In light of the sparse but growing evidence of long-distance seed dispersal by vertebrate frugivores in the tropics (e.g. Sezen et al. 2005;
Hardesty et al. 2006; Russo et al. 2006), we can expect an increased importance of seed-mediated gene dispersal in many animal-dispersed tropical trees. My dissertation quantitatively examines seed and pollen dispersal processes and their genetic influences in four tropical tree species with distinct seed dispersal and pollination syndromes and lifestyle strategies growing in the mature moist forests of Barro Colorado Island (BCI), Panama. Recognizing the challenges of measuring animal-driven seed and pollen dispersal in natural populations, particularly long-distance events, I use genetic approaches to match dispersed seedlings to their mother and father.
The third chapter examines the genetic consequences of seed and pollen dispersal, with regard to how these two processes determine the distribution of genetic variation within populations. The fourth chapter quantifies the spatial scale and extent of seed and pollen dispersal, especially long-distance events, and simulates how populations respond to potential perturbations in seed and pollen dispersal.
The effects of read length, quality and quantity on microsatellite discovery and primer development: from Illumina to PacBio
I use modeling approaches to integrate seed and pollen flows of immigrants that cannot be estimated using provenance inference. The second chapter focuses on the discovery of genetic markers for these non-model plant species and discusses the general principles of using next-generation sequencing for marker development. Selection and validation of specific microsatellite markers are briefly described in Appendix A-C. These new markers will be used as part of the dissertation's aim to understand the ecological processes and genetic influences of gene dispersal in tropical forests, which includes tree species with distinct pollination and dispersal syndromes.
APPENDIX B Characterization of twenty-six microsatellite markers for the tropical pioneer tree species Cecropia insignis Liebm. Twenty-six microsatellite markers were characterized for this species, of which eleven loci with high polymorphism will be used to study genetic dispersal in C. Triplaris cumingiana is an insect-pollinated and wind-dispersed midstory tree species (croat m tall and 12-30 m) cm in dbh at maturity.
Unlike most dioecious tree species, which have inconspicuous unisexual flowers (Bawa & . Opler 1975), floral sexual dimorphism is pronounced in T. Twelve microsatellite producers were screened and validated, of which nine markers consistent with Hardy-Weinberg expectations, will be used.
Seed dispersal drives spatial genetic patterns in tropical trees
Several other factors may also affect the strength of SGS in wild populations, such as variation in individual reproductive success, non-random spatial distribution, and mortality (Hamrick et al. Because different ecological processes and demographic characteristics can are included, determining the extent to which seed and pollen dispersal affects SGS, independent of other confounding factors, is challenging, so it is difficult to attribute differences in SGS intensity among taxa to their differences in distance seed and pollen distribution.
Even though the effects of other factors can be teased apart, the respective contributions of seed vs. In the cases where theoretical population genetic models, such as island model (Wright 1965) or isolation by distance, separate (Slatkin 1991; Rousset at evolutionary equilibrium, are assumed to hold, the relative size of seed vs. To overcome these empirical and theoretical limitations , I developed a new analytical framework to quantify the respective roles of seed and pollen dispersal.
This approach has several advantages: (1) it does not rely on theoretical population models or uniparental markers; (2) confounding factors such as spatial structure, population density, and reproductive variance are taken into account; (3) it separates the contributions of seed and pollen dispersal to SGS. Overall, the results suggest that seed dispersal is the main mechanism driving SGS in these tropical trees, at least during the early stages of life history.
Frequent long-distance seed and pollen dispersal and their genetic impacts in tropical trees
GCTGTCATTGTGCATCTTCCT
TCGTGCGAAATTCCCTTCTA
TTCAGCATATTCTCATGTTCCA
CCAAAGAAGTGCTCCTCAGC
CCAGTGTTTCTTCTCTTGCATC
CGGAGCACAGGAATGAAATC
TGCTTAACAGCATGGAATGG
Separation of seed and pollen dispersal from genetic structure at large geographic scales has been. Third, we infer the seed and pollen dispersal distance from the SGS seedling using the ABC method. Hatched bars represent the pollen dispersal (average distance) that occurred in the original ABC simulations (n = 400 000 or 200 000; see main text).
In this study, we quantified effective seed and pollen dispersal (referred to as seed and pollen dispersal for simplicity) in four sympatric tropical dioecious tree species that differ in seed dispersal and pollination syndromes. Our study represents one of the few empirical estimates of effective seed and pollen dispersal in tropical trees (e.g. Hardesty et al. 2006; Gaino et al. 2010), through. The near and far tail of the core of seed and pollen dispersal exhibit different influences on population genetic variation.
