IDENTIFICATION OF PATHOGEN OF WILT DISEASE IN STRAWBERRY (FRAGARIA SP.)
AND THE CONTROL POTENTIAL OF
MICROBIAL ANTAGONISTS
Tim Peneliti :
Dr. Gusti Ngurah Alit Susanta Wirya, SP., M.Agr.
I Putu Sudiarta, SP., M.Si, Ph.D
Prof. Dr. Ir. I Gede Rai Maya Temaja, M.P.
Gusti Ayu Devi Valenia Sari
Ciwidey
Batu Berastagi
Purbalingga
Bedugul
Production of Strawberries in Indonesia
Strawberries in Indonesia since 1980
Bedugul, 1983
Wilt Disease on Strawberry
2016
Reduce
strawberry production
80%
Symptoms of strawberry wilt disease
Control of Disease on Strawberry is highly
dependent on the use of synthetic chemical
pesticides
Purposes
1. To know the species of pathogen of wilt disease on strawberry, based on morphological and molecular analysis
2. To know the antagonistic microbe that potential against the causal agent of
strawberry wilt disease in Bali.
RESEARCH
METHODS
The research was conducted at Plant Disease Laboratory, Faculty of Agriculture
Udayana University, and
Pancasari Village, Sukasada District, Buleleng Regency.
From April to September
2017
Identification of fungi based on
morphological structure
Phylogeny analisis Sequencing
DNA extraction 4 days old of Miselium kit Wizard Genomic purification, Promega Corp
PCR Amplification
Primer Internal Transkript Spacer (ITS) 1 (5- TCCG TAGGTGAACC GCGG-3) dan ITS 4 (5- TCCTCCGC TTATTGATATGC-3)
+ 800bp
Identification of fungi based on molecular analysis
12
level of homology or alignment with the gene sequence (BLAST)
software Molecular Evolutionary Genetics Analysis (MEGA 5.05).
Isolation of Microbial Antagonists
The antagonistic microbial candidate of the fungus group is cultured from the 10-3-10-4 dilution level, while the
bacterial group is cultured from 10-5-10-6 dilution.
1 ml
1 ml 1
ml 1
ml 1
ml
1 ml
500 ml + 50 gr soil
9 ml
Dilution Method
The antagonistic microbial candidate of the fungus group is cultured from the 10-3-10-4 dilution level, while the
bacterial group is cultured from 10-5-10-6 dilution.
In Vitro Test of Antagonistic Activity of Biocontrol Agent Againts Pathogen.
A : Pathogen of wilt disease, B : Antagonist microbe, L1 : area of pathogen on treatment (cm2) L0 : area of
pathogen on control (cm2)
P = L0-L1 x 100%
L0
Control
L0
L1
Dual culture
RESULT AND DICUSSION
Percentage of wilt disease on strawberry production centers
No Village
Percentage of Disease
(%) 1 Pancasari village,
Sukasada District, Buleleng Regency
90 2 Candikuning village,
Baturiti District, Tabanan Regency
82
Symptoms of
strawberry wilt disease on the roots
Symptoms of
strawberry wilt disease
on stems and leaves
The growth of the fungi isolated from symptomatic strawberries wilt on the PDA medium
A B
C D
3 dai
7 dai
Macroconidia and microconidia.
The macroconidia are hyaline, septate, and sickle or banana shaped. microconidia small, unicellular
or bi-cellular, spherical or oval.
Microscopic obseravtion
Structure of F.
oxysporum. CMI. (1979).
The main branches of conidiofor which produce conidia are
called fialids. Fialid oval shaped. microcidia small,
unicellular or bi-cellular, spherical or oval. Sizes vary
from 5 x 15μm x 2-4 μm.
Macroconidia long, crescent- shaped, pointed tip multi-
septate (3-5 septa)
To test if isolates obtained from infected strawberry plants are pathogenic strains of F. oxysporum, the
isolate can be subjected to pathogenicity tests to
satisfy Koch's postulates
Pathogenicity tests
a b
(a) Symptomatic plants wilt disease in the field. (b) Control, plants inoculated with water. (c) Symptomatic plants inoculated with pathogens of wilt disease.
Internal Transcribed Spacer
22
ITS1 : 5' TCCGTAGGTGAACCTGCGG 3' ITS4 : 3' TCCTCCGCTTATTGATATGC 5'
Polymerase Chain Reaction
Visualization of PCR Product on Agarose Gel electrophoresis
23
544 bp
M 1
M: Marker DNA 1 kb (Promega USA); 1, Pathogen isolate
No Isolat Homologi
1 2 3 4 5 6 7 8 9 10 11 12
1. PLSPs_01 ID 99% 90% 90% 85% 84% 91% 91% 91% 92% 90% 57%
2. DQ452448 99% ID 90% 91% 85% 84% 91% 92% 91% 93% 91% 57%
3. U61679 90% 90% ID 99% 83% 82% 89% 90% 85% 91% 86% 60%
4. U34580 90% 91% 99% ID 84% 83% 90% 91% 86% 91% 86% 59%
5. NR121457 85% 85% 83% 84% ID 96% 84% 85% 81% 90% 81% 52%
6. NR121203 84% 84% 82% 83% 96% ID 83% 83% 80% 86% 80% 53%
7. NR120263 91% 91% 89% 90% 84% 83% ID 99% 86% 88% 86% 56%
8. NR120262 91% 92% 90% 91% 85% 83% 99% ID 87% 88% 87% 56%
9. NR111142 91% 91% 85% 86% 81% 80% 86% 87% ID 88% 99% 58%
10. AY213655 92% 93% 91% 91% 90% 86% 88% 88% 88% ID 89% 57%
11. AY213654 90% 91% 86% 86% 81% 80% 86% 87% 99% 89% ID 58%
12. AB585937 57% 57% 60% 59% 52% 53% 56% 56% 58% 57% 58% ID
PLSPs01 = Fungi Pancasari; DQ452448 = F. oxysporum; U61679 = F. concolor; U34580 = F.
polyphialidicum; NR121457 = F. equiseti; NR121203 = F. boothii; R120263 = F. circinatum;
NR120262 = F. bactridioides; NR111142 =F. acutatum; AY213655 = F. chlamydosporum AY213654 = F. annulatum; AB585937 = Verticillium dahlia var.longisporum
Homology of Internal Transcribed Spacer nucleotide of
pathogen causes wilt disease with other fungi
Phylogeny of ITS gene of strawberry wilt
disease pathogen
26
This result is the first report on F. oxysporum as a pathogen of wilt disease in strawberries
in Bali
The result of Internal Transcribed Spacer sequence (ITS) from F. oxysporum is the first
report of ITS nucleotide from pathogen
causing strawberry wilt disease in Indonesia.
No Isolat Percentage
1 PsA1 42% Rhizosphere banana Baturiti, Bacteria 2 PsA2 39% Rhizosphere banana Baturiti, Bacteria 3 StP1 48% Rhizosphere strawberry Pancasari, Fungi 4 StP2 51% Rhizosphere strawberry Pancasari, Fungi 5 StP3 25% Rhizosphere strawberry Pancasari, Fungi 6 StP4 37% Rhizosphere strawberry Pancasari, Bacteria 7 StP5 24% Rhizosphere strawberry Pancasari, Bacteria
8 KrB1 48% Rhizosphere Botancal Garden, Fungi
9 KrB2 34% Rhizosphere Botancal Garden, Fungi
10 KrB3 60% Rhizosphere Botancal Garden, Fungi
11 KrB4 18% Rhizosphere Botancal Garden, Fungi
12 CkG1 86% Rhizosphere Clove, Gitgit, Fungi
13 CkG2 40% Rhizosphere Clove, Gitgit, Fungi
14 CkG3 38% Rhizosphere Clove, Gitgit, Fungi
15 CkG4 35% Rhizosphere Clove, Gitgit, Fungi
16 SpP1 52% Kotoran Sapi, Pancasari, Fungi
17 SpP2 54% Kotoran Sapi, Pancasari, Fungi
18 SpP3 42% Kotoran Sapi, Pancasari, Fungi
19 SpP4 20% Kotoran Sapi, Pancasari, Fungi
20 SpP5 28% Kotoran Sapi, Pancasari, Bacteria
The ability of antagonistic microbes against the causes of strawberry wilt disease on PDA media
Colony color begins with white, then whiteish green, light green, green and dark green after 7 days old on
PDA media
Microscopic observation bentuk spora serta fialid Trichoderma menurut Gusnawaty, 2014
1
2
1
2
1. Conidiophore 1. Conidiophore
2. Fialid 2. Fialid
Conidia form:semi-round, conidiofor branched like a pyramid, has a fialid
Conidia and fialid form of Trichoderma according to Gusnawaty, 2014
CkG1 isolate, obtained from the Clove plant rhizosphere has the highest inhibitory capacity of 86% in 7dai..
Dual culture of microbial antagonist isolates against pathogen of wilt disease. (a)
Fusarium (b) Trichoderma.
a b
Trichoderma is able to suppress the development of pathogens:
microparasites and produce some inhibiting compounds.
Trichoderma spp. also produce various compounds or enzymes that serve to inhibit or degrade the cell walls of plant
pathogens.
Trichoderma has the ability to induce plant resistance
Kesimpulan
Based on the morphological and molecular identification:
The causal agent of strawberry wilt disease in Bedugul area is F.
oxysporum. This pathogen causes wilt disease in strawberry in Pancasari Village, Sukasada District, Buleleng Regency and Candikuning Village, Baturiti District, Tabanan Regency of 90%
and 82%.
Trichoderma sp. CkG1 isolated from the Clove plant was able to suppress the growth of F. oxysporum, the causes of strawberry wilt disease. Suppression mechanisms of Trichoderma sp. CkG1
to F. oxysporum through its micro-parasitic properties and its ability to produce antifungal compounds.