Illegitimacy Testing of Elaeis guineensis Population Based on Simple Sequence Repeat Markers

INTRODUCTION

As the main source of vegetable oil, oil palm supplies most of the demand in the world (Shahbandeh, 2019). It is possible that the oil palm demand is still increasing in the future. To meet the demand for oil palm which may reaches 240 x 10⁶ tons (Barcelos et al., 2015; Corley, 2009), the supply will require more productive oil palm varieties. The improved oil palm varieties can only be developed through structured breeding program.

Illegitimacy is not desirable in a controlled pollination in breeding programs of oil palm (Elaeis guineensis). The percentages of illegitimacy in breeding of oil palm is affected by many factors, such as the flower biology (the presence of hermaphrodite flowers), errors in pollen collection, and damages by animals and the environment

factors of the bags used to cover oil palm flowers.

The damage cover bags allow illegitimate pollination by the Elaeidobius kamerunicus weevil (Corley, 2005). Previously, it was very difficult to identify the illegitimate oil palm seedlings. However, with the advanced of molecular biology techniques and the development of co-dominant markers (i.e. simple sequence repeat markers - SSR), such undertaking has become much easier at present.

The SSRs are repeated DNA sequences with a repeat unit of two to four nucleotides. It has been reported that the SSRs are presence and distributed widely in genomes of many plant species (Billotte et al., 2001; Delseny, Laroche, &

Penon, 1983; Tautz, 1989; Tautz & Renz, 1984).

Simple sequence repeat markers are developed by amplifying the targeted SSR sequences using PCR.

ARTICLE INFO Keywords:

African oil palm Dura oil palm Legitimacy testing Pisifera oil palm SSR markers Article History:

Received: August 1, 2018 Accepted: September 6, 2019

*⁾ Corresponding author:

E-mail: s_sudarsono@ymail.com

ABSTRACT

Illegitimacy is a factor negatively affecting controlled pollination in Elaeis guineensis breeding programs and it may happen in any step of hybridization processes, starting from early stages of parent selection and labeling to the last stage of the replicated field trial. Availability of method for testing the existence of illegitimacy among progenies of oil palm is beneficial. Four half-sib family populations consisted of 83 individuals were evaluated. Sixteen loci of SSR markers were utilized to genotype plant materials and identify illegitimate individuals. The legitimate parents and illegitimate progenies were evaluated using CERVUS and COLONY softwares. The results showed that the 16 SSR marker loci evaluated were having medium to high PIC values and they were both informative and suitable for parent-offspring analysis. The results also showed that the 16 SSR markers were sufficient for the illegitimacy testing using the COLONY software.

Moreover, this study did not find any illegitimate individual among the four progeny populations. The generated SSR marker data were also successfully used to assign and to reconstruct the expected pedigree of the progenies. This can be used as an example of molecular marker utilization to improve the integrity of breeding program of oil palms.

ISSN: 0126-0537Accredited First Grade by Ministry of Research, Technology and Higher Education of The Republic of Indonesia,

Illegitimacy Testing of Elaeis guineensis Population Based on Simple Sequence Repeat Markers

Lalu Firman Budiman¹⁾, Ardha Apriyanto¹⁾, Adi Pancoro²⁾ and Sudarsono^3*)

1) PT. Astra Agro Lestari Tbk., East Jakarta, Jakarta, Indonesia

2) School of Life Sciences & Technology, Institut Teknologi Bandung, West Java, Indonesia

3) PMB Lab., Department of Agronomy and Horticulture, Bogor Agricultural University, West Java, Indonesia

allelic variation among different plant populations (Illahi, Wiendi, & Sudarsono, 2016; Larekeng, Purwito, Mattjik, & Sudarsono, 2018; Oktavia, Kuswanhadi, Dinarty, Widodo, & Sudarsono, 2017;

Purwoko, Cartealy, Tajuddin, Dinarti, & Sudarsono, 2019; Sulistiyorini, Rubiyo, & Sudarsono, 2018).

The SSR markers are used as powerful tools for supporting plant breeding of many perennial crops, including oil palm (Ajambang, Sudarsono, Asmono,

& Toruan, 2012; Budiman, Apriyanto, Pancoro, &

Sudarsono, 2019; Larekeng, Maskromo, Purwito, Matjik, & Sudarsono, 2015; Maskromo, Larekeng, Novarianto, & Sudarsono, 2017; Natawijaya et al., 2019; Tinche, Asmono, Dinarti, & Sudarsono, 2014).

Plant genetic analysis using the SSR markers are preferable (Saghai Maroof, Biyashev, Yang, Zhang, & Allard, 1994) because the SSR loci are abundant and widely distributed across the plant genome. Simple sequence repeat markers are co-dominant markers and the allele variations in the population are very high. To generate SSR marker is fast and easy to perform since it belongs to PCR based markers. Allele configurations of the SSR marker are easy and relatively simple to interpret. Finally, if the primer sequences are available – the generated SSR markers are easily transferable to other laboratories. Because it is a co-dominant marker; plant geneticists can use the SSR marker to differentiate between heterozygous from homozygous individuals (Akkaya, Bhagwat, &

Cregan, 1992).

The power of SSR marker in the genetic analysis also lies in its high discriminative ability to differentiate accessions among closely related individuals in a plant population (Ferreira &

The SSR marker is also more reproducible than other dominant markers, its implementation requires low cost, low training level and capable of analyzing large number of samples through automatization since it should be possible to automate SSR marker genotyping (Hayden, Nguyen, Waterman, &

Chalmers, 2008).

In this study, we have evaluated techniques to identify illegitimate seedlings within the Dura (D)

× Pisifera (P) oil palm half-sib families using simple sequence repeat (SSR) marker. This procedure is useful for ensuring identification of correct seedlings in the breeding programs and seed production of oil palm. The application of SSR markers in this study for identifying illegitimate seedlings has proven the beneficial use of molecular markers to improve oil palm breeding program integrity.

MATERIALS AND METHODS Plant Materials

The studies were conducted at the Biotechnology Lab., PT. Astra Agro Lestari (AAL) Tbk., Pangkalan Bun, Central Kalimantan, Indonesia during the period of April 2014 – April 2015. The oil palm leaf samples were taken from nursery garden of PT. AAL. As many as 83 progenies from four families of half-sib populations were used in this research. The four progeny families were originated from crossing among Dura (D) × Pisifera (P) oil palm types. There were four D types of oil palms as the female parents and a single P type of oil palm as the male parent (Table 1). Each of the evaluated progeny family consisted of 20–21 individuals per population.

Table 1. The four oil palm (Elaeis guineensis) progeny families tested in the study. The four populations consisted of progenies derived from hybridization of E. guineensis Pisifera × Dura types.

No ID of the population

Number of individuals in each population

Genetic backgrounds

Male Male Type Female Female Type

1 13060356 20 OE 13/KM011/63-13P PISIFERA OE 13/KM002/03-14D DURA

2 13060405 21 OE 13/KM011/63-13P PISIFERA OE 13/KM004/13-02D DURA

3 13060409 21 OE 13/KM011/63-13P PISIFERA OE 13/KM002/06-01D DURA

4 13060417 21 OE 13/KM011/63-13P PISIFERA OE 13/KM006/20-05D DURA

Table 2. The SSR (simple sequence repeat) primers utilized in the study. Sixteen primer pairs to generate the marker loci were reported by and available in the CIRAD TropGENE Data Base (http://tropgenedb.cirad.fr/) ID of SSR primer pairs Position of SSR loci in chromo

- somesSequences of oligonucleotide Primers (5’- 3’)Motif of the SSRExpected size of the allele (bp) Annealing temperature

mEgCIR0802 1FCTCCTTTCGGCGTATCCTTTA (GA)1221752ºC RTACGTGCAGTGGGTTCTTTC mEgCIR3282 2FGTAACAGCATCCACACTAAC (GA)2024552ºC RGCAGGACAGGAGTAATGAGT mEgCIR0173 3FTGAACAAGAAGGCGGAAAGAGA (GA)1813252ºC RTGCGGGCGAGGAAAGGT mEgCIR3533 4FTCTATGGCTCTGTCGTGTAT (GA)1813952ºC RCGAGCCGGTAGAAACTAT mEgCIR2813 5FGCTTTGTTGCAGTTTGACTA (GT)7 (GA)11 21052ºC RGTTTAGGATGTTGCGTGAT mEgCIR3543 6FGTTCCCTGACCATCTTTGAG (GA)1723252ºC RGTCGGCGATTGATTAGATTC mEgCIR0894 7FTGCTTCTTGTCCTTGATACA (GA)8TA(GA)918652ºC RCCACGTCTACGAAATGATAA mEgCIR0886 8FGATCTGCCGGTGCTCCTA (GA)915752ºC RCTCAGTTTAGTCGATCCTTCCATTG mEgCIR38869FTTCTAGGGTCTATCAAAGTCATAAG (GA)5GT(GA)2018752ºC RAGCCACCACCACCATCTACT mEgCIR3785 10FAAGCAATATAGGTTCAGTTC (GA)2128452ºC RTCATTTTCTAATTCCAAACAAG mEgCIR3362 11FCCCATCATCTGCTCAGGATAGAC (GA)1915152ºC RACCCTCTCCTCTTGGGAAGA mEgCIR2414 12FCAATCATTGGCGAGAGA (GA)1019552ºC RCGTCACCTTTCAGGATATG mCnCIR003813FCAAGTATATGTGTGTGTATGC (GA)811352ºC RATCTGCTGTTGATTATGG mEgCIR3546 14FGCCTATCCCCTGAACTATCT (GA)1528652ºC RTGCACATACCAGCAACAGAG mEgCIR3292 15FAGCCATGAGTGAATCATATC (GA)2017352ºC RACCACGATGTCAATCTCTAT mEgCIR035316FATTTCGTAAGGTGGGTGT (GT)11(GA)1510252ºC RCCTCCAAACTCCTCTGT

Total oil palm nucleic acid was extracted from leaf samples (100 mg) using plant DNA extraction kit, that commercially available from Geneaid company.

The RNAs were degraded using RNAse treatments (Sambrook, Fritsch, & Maniatis, 1989). The total DNA quality and their quantity were evaluated using Nanodrop spectrophotometer (ND-1000 Nano-Drop Tech. Inc.). The amount of DNA was confirmed by electrophoresis of 2 ml of total DNAs in an agarose (1%) gel electrophoresis and GelRed was used to stain and visualize the DNA.

The primer pairs used to generate sixteen loci of SSR markers were reported by CIRAD. The primers were obtained from TropGENE Data Base (http://tropgenedb.cirad.fr/). The list of 16 pairs of SSR primers used to generate the SSR markers are presented in Table 2. The designed SSR primers were used to figure out all of oil palm individual genotypes. The selected SSR primers have been used by Ajambang, Sudarsono, Asmono, & Toruan (2012), Billotte et al. (2005), and Tinche, Asmono, Dinarti, & Sudarsono (2014) and are able to generate informative and polymorphic oil palm markers.

The fragment sizes of PCR amplified products were detected automatically using capillary electrophoresis. To facilitate automatic detection, each SSR marker loci was amplified using fluorescent labelled reversed primer with either FAM, HEX, ROX, or TAMRA (Hayden, Nguyen, Waterman, & Chalmers, 2008; Schuelke, 2000).

Each SSR marker locus was PCR amplified using protocols for PCR amplification as stated in Kapa 2G Fast Polymerase^TM PCR Kit (Kapa Biosystems).

The steps of amplification profiles consisted of: one time of DNA denaturation (95°C for 3 minutes), followed by 35 cycles of denaturation (95°C for 15 seconds), primer annealing at an appropriate annealing temperature for each SSR primer pairs for 15 seconds, and primer extension (72°C for 5 seconds). At the end of the steps, one cycle of final primer extension at 72°C for 10 minutes was added.

The PCR amplification reactions were done in a Veriti 96 wells Applied Biosystems thermal cycler.

Fragment analysis of PCR amplicons for each of the SSR locus was done by First Base Lab., Malaysia. The fragment separation was done using an ABI Prism 3730 XL 96-capillary Applied Biosystem DNA Analyzer (Applied Biosystems Inc, USA). Subsequently, genotyping based on

GENESCAN-500 (Liz) standard.

Data Analysis

Scoring of SSR alleles and genotyping data were supplied by First Base Laboratories, Malaysia.

The raw data were generated using Geneious Software – Basic Version (Biomatters Ltd., Kearse et al., 2012) and exported to Microsoft Excel software. Subsequently, the data files were used for genetic diversity and population parameter analysis using the appropriate softwares. The parameters for population genetics were determined using CERVUS software ver. 3.0 (Kalinowski, Taper, &

Marshall, 2007) while the illegitimate individuals existence among the studied oil palm progeny populations were validated using CERVUS and COLONY softwares (Jones & Wang, 2009;

Kalinowski, Taper, & Marshall, 2007).

RESULTS AND DISCUSSION

The allele numbers per locus for 16 SSR loci across the parental palms and the progeny populations ranged from 3 – 8 alleles. The Hobs (observed heterozygosity) values ranged from 0.34 – 1.00. The Hexp (expected heterozygosity) was from 0.38 – 0.78 and the PIC was from 0.33 – 0.73 (Table 3). The average of non-exclusion probability for a single candidate parent (NE-1P) were 0.63 – 0.93, the average of non-exclusion probability for a single candidate parent given a known parent genotype of the opposite sex (NE-2P) were 0.45 – 0.82. Meanwhile, the average of non-exclusion probability for a candidate parent pair (NE-PP) were 0.27 – 0.71 (Table 3).

The SSR markers had been widely used for genetic diversity analysis of perennial estate crops (Ajambang, Sudarsono, Asmono, & Toruan, 2012;

Budiman, Apriyanto, Pancoro, & Sudarsono, 2019;

Cochard et al., 2009; Larekeng, Maskromo, Purwito, Mattjik, & Sudarsono, 2015; Maskromo, Larekeng, Novarianto, & Sudarsono, 2017; Natawijaya et al., 2019; Tinche, Asmono, Dinarti, & Sudarsono, 2014). SSR loci are co-dominant and are spreaded within the plant genome. Moreover, SSR markers are also highly polymorphic (Fujimori et al., 2003). In this study, we used the SSR markers for evaluating the presence of illegitimate progenies in four populations of elite Dura × elite Pisifera oil palm (E. guineensis Jacq.) progenies.

Tabel 3. The observed allele numbers and other parameters calculated based on the individual SSR marker locus of the total 16 loci across the four population of oil palm progenies LocusChrkNHobsHexpPICNE-1PNE-2PNE-PPNE-INE-SIHWF(Null) mEgCIR0802Chr15830.6180.5380.4790.8520.7070.5490.2720.551NS-0.1068 mEgCIR3282Chr26830.9890.6670.6160.7490.5770.3930.160.458***-0.2485 mEgCIR0173Chr33830.8720.6350.5590.8010.6550.5050.2080.486***-0.1863 mEgCIR3533Chr45830.8450.6840.6180.750.590.4230.1640.451*-0.1151 mEgCIR2813Chr54830.7470.5380.4760.8560.7150.5650.2760.552***-0.2006 mEgCIR3543Chr66830.9080.7390.6930.6670.4910.3030.1120.411**-0.1185 mEgCIR0894Chr77830.9890.7570.7160.6440.4640.2760.0980.398***-0.1527 mEgCIR0886Chr85830.7730.6590.5950.7670.6080.4380.1790.467***-0.1106 mEgCIR3886Chr96830.9330.6820.6430.7230.5390.340.1380.446***-0.2176 mEgCIR3785Chr106830.7530.7530.7030.6670.4920.3150.1090.403***-0.0034 mEgCIR3362Chr1188310.6820.6360.7290.5520.3610.1450.447***-0.247 mEgCIR2414Chr125830.9150.7760.7340.6280.4490.2680.090.387*-0.0912 mCnCIR0038Chr138830.820.7310.6790.690.5160.3370.1220.417***-0.1337 mEgCIR3546Chr1448310.6080.5250.8130.680.530.2360.507***-0.2707 mEgCIR3292Chr155830.5480.7310.6720.70.5290.3540.1280.421ND0.1218 mEgCIR0353Chr163830.3420.3830.3330.9270.8180.7050.4310.667ND0.0427 Average5.38830.8160.660.6050.7480.5860.4160.1790.467-- Remarks: k = allele numbers; N = typed individual number per locus; Hobs = observed heterozygosity; Hexp = expected heterozygosity; PIC = polymorphic information content; NE-1P = average non-exclusion probability for one candidate parent; NE-2P = average non-exclusion probability for one candidate parent given the genotype of a known parent of the opposite sex; NE-PP = average non-exclusion probability for a candidate parent pair; NE-I = average non-exclusion probability for the identity of two unrelated individuals; NE-SI = average non-exclusion probability for the identity of two siblings; HW = significance of deviation from Hardy-Weinberg equilibrium; NS = not significant; ND = not different; * = significant at the 5% level; ** = significant at the 1% level; *** = significant at the 0.1% level; These significant levels include a Bonferroni correction, F(Null) = estimated null allele frequency.

Fig. 1. The pedigree construction based on output of COLONY analysis. The top bar indicates identified parent IDs while the bottom bar indicates progeny IDs. The female parent contributions are indicated by red lines that emanated downwards while those of male parents by yellow lines. The 13060356, 13060405, 13060409, and 13060417 were population ID; the KM011/63-13P was predicted correctly as the male parent of all individuals. The KM002/03-14D, KM004/13-02D, KM002/06-01D and KM006/20-05D were predicted correctly as the female parents of the four progeny populations.

The SSR genotyping data analysis using CERVUS software resulted in the existence of significant deviations from Hardy Weinberg Equilibrium (HWE) for 13 SSR marker loci.

Moreover, null alleles were also existed across the evaluated populations with the estimated frequency ranged from -0.27 to 0.12 for each of the individual locus (Table 3). The existence of null alleles was also validated by the departure from Mendelian segregation ratio which were determined for each locus and in each progeny population.

Paternity analysis of 83 half sib progenies from four female parents and a single male parent using 16 SSR marker loci showed all of the evaluated progenies belonged to the respective family and they were appropriately assigned to the expected Pisifera and Dura parents (Fig. 1). Results of the analysis also showed there was no illegitimate individual among the evaluated oil palm progeny populations.

This study also proved that eventhough without the genetic information of parents, analysis of the legitimate individuals is still possible using Colony Software. The Colony Software have been used to conduct parental reconstruction and to predict genotype of the parents based on the genotype of its progeny arrays (Jones & Wang, 2009).

In breeding programs of oil palm, it is necessary to ensure that the individuals and the families used in the oil palm varietal development are originated from legitimate parents. Oil palm breeders use the family performance extensively.

Subsequently, oil palm breeders also select the best individual within the best family of oil palms.

Therefore, the existence of illegitimate progenies hampers the oil palm breeding progress. We can perform effective individual palm selection if family of the progenies are identified correctly and they are having the legitimate parentages. Oil palm breeding relies on progeny testing. In this scheme, individual oil palm parent performance is evaluated based on their offspring performance. Such progeny testing is not effective if some of the evaluated offsprings either are not the legitimate progenies or are the selfing- derived progenies (Luyindula, Mantantu, Dumortier,

& Corley, 2005; Thongthawee, Tittinutchanon, &

Volkaert, 2010).

To make sure that oil palm parents used for production of oil palm seeds are not related genetically, breeders of oil palm depend on the recorded pedigrees. Meanwhile, to generate a proper pedigree, the hybridizations need to be done

correctly. Unfortunately, there are some technical difficulties to make precise and controlled pollination of oil palm. The cross pollination also prone to some potential errors. All of those errors may result in illegitimate oil palm progenies. The potential problems in conducting control pollination of oil palm include the pollination bag damages by animals or by oil palm spines, which result in the entrance through the damaged bags of pollen-bearing weevils and cause pollination contamination. Such pollination contaminations result in hybridization by illegitimate pollens.

Moreover, the male flowers may also exist in some female inflorescences and yield viable pollens. Subsequently, the pollens may self- pollinate the female flowers and produce illegitimate progenies. Potential hybridization errors may also occur because of the mistakes during collection or storage of oil palm pollens, at the time of female bunch labeling, during the seed storage or seed germination stages and within the seedling nursery. Mislabelling may also happen during the field planting in the progeny trials (Corley, 2005).

Because of those potential problems, pollination and subsequent seed production in oil palm breeding is usually subject to careful supervision.

CONCLUSION

The 16 SSR markers evaluated in this research show the PIC (polymorphic information content) values of 0.33 – 0.73, which belong to medium – high. Therefore, majority of the SSR markers are informative and suitable for the parentage analysis.

Based on our study, we are unable to find any illegitimate individual in the evaluated progeny populations. The use of SSR markers in this study is also successful in assigning and reconstructing the expected pedigree of the progenies. The evaluated SSR markers used in the study will continually be utilized to support improvement of oil palm breeding program and seed production management.

ACKNOWLEDGEMENT

The authors would like to thank PT. Astra Agro Lestari, Tbk for the financial support in conducting this work. The author wishes to convey our special thanks to Mr. Santosa and Mr. M. Hadi Sugeng, CEO and R&D Director of PT. Astra Agro Lestari, Tbk, respectively.

Ajambang, W., Sudarsono, Asmono, D., & Toruan, N.

(2012). Microsatellite markers reveal Cameroon’s wild oil palm population as a possible solution to broaden the genetic base in the Indonesia- Malaysia oil palm breeding programs. African Journal of Biotechnology, 11(69), 13244–13249.

https://doi.org/10.5897/ajb11.3897

Akkaya, M. S., Bhagwat, A. A., & Cregan, P. B. (1992).

Length polymorphisms of simple sequence repeat DNA in soybean. Genetics, 132(4), 1131–

1139. Retrieved from https://www.ncbi.nlm.nih.

gov/pmc/articles/PMC1205234/

Barcelos, E., de Almeida Rios, S., Cunha, R. N. V., Lopes, R., Motoike, S. Y., Babiychuk, E., … Kushnir, S. (2015). Oil palm natural diversity and the potential for yield improvement. Frontiers in Plant Science, 6, 190. https://doi.org/10.3389/

fpls.2015.00190

Billotte, N., Marseillac, N., Risterucci, A.-M., Adon, B., Brottier, P., Baurens, F.-C., … Charrier, A. (2005).

Microsatellite-based high density linkage map in oil palm (Elaeis guineensis Jacq.). Theoretical and Applied Genetics, 110(4), 754–765. https://

doi.org/10.1007/s00122-004-1901-8

Billotte, N., Risterucci, A. M., Barcelos, E., Noyer, J. L., Amblard, P., & Baurens, F. C. (2001).

Development, characterisation, and across- taxa utility of oil palm (Elaeis guineensis Jacq.) microsatellite markers. Genome, 44(3), 413–

425. Retrieved from https://www.ncbi.nlm.nih.

gov/pubmed/11444700

Budiman, L. F., Apriyanto, A., Pancoro, A. D. I., &

Sudarsono, S. (2019). Genetic diversity analysis of Tenera × Tenera and Tenera × pisifera crosses and D self of oil palm (Elaeis guineensis) parental populations originating from Cameroon.

Biodiversitas Journal of Biological Diversity, 20(4), 937–949. https://doi.org/10.13057/biodiv/

d200402

Cochard, B., Adon, B., Rekima, S., Billotte, N., De Chenon, R. D., Koutou, A., … Noyer, J. L. (2009).

Geographic and genetic structure of African oil palm diversity suggests new approaches to breeding. Tree Genetics and Genomes, 5(3), 493–504. https://doi.org/10.1007/s11295-009- 0203-3

Corley, R. H. V. (2005). Illegitimacy in oil palm breeding – A review. Journal of Palm Oil Research, 17, 64–

69. Retrieved from http://palmoilis.mpob.gov.my/

publications/joprv17june-ms64.pdf

Environmental Science & Policy, 12(2), 134–139.

https://doi.org/10.1016/j.envsci.2008.10.011 Delseny, M., Laroche, M., & Penon, P. (1983). Detection

of sequences with Z-DNA forming potential in higher plants. Biochemical and Biophysical Research Communications, 116(1), 113–120.

https://doi.org/10.1016/0006-291X(83)90388-1 Ferreira, M. E., & Grattapaglia, D. (1998). Introdução ao uso

de marcadores moleculares em análise genética (3rd ed.). Brasília: EMBRAPA—CENARGEN.

https://doi.org/10.13140/2.1.3757.8881

Fujimori, S., Washio, T., Higo, K., Ohtomo, Y., Murakami, K., Matsubara, K., … Tomita, M. (2003). A novel feature of microsatellites in plants: A distribution gradient along the direction of transcription.

FEBS Letters, 554(1–2), 17–22. https://doi.

org/10.1016/S0014-5793(03)01041-X

Hayden, M. J., Nguyen, T. M., Waterman, A., & Chalmers, K. J. (2008). Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping. BMC Genomics, 9, 80. https://doi.org/10.1186/1471- 2164-9-80

Illahi, Z., Wiendi, N. M. A., & Sudarsono. (2016).

Keragaman genetik kacang Bogor (Vigna subterranea L. Verdc.) berdasarkan marka SSR (Simple Sequence Repeat). Jurnal Agronomi Indonesia, 44(3), 279–285. Retrieved from https://

journal.ipb.ac.id/index.php/jurnalagronomi/article/

view/12787

Jones, O. R., & Wang, J. (2009). COLONY: A program for parentage and sibship inference from multilocus genotype data. Molecular Ecology Resources, 10, 551–555. https://doi.org/10.1111/j.1755- 0998.2009.02787.x

Kalinowski, S. T., Taper, M. L., & Marshall, T. C. (2007).

Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Molecular Ecology, 16(5), 1099–1106. https://doi.

org/10.1111/j.1365-294X.2007.03089.x

Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., … Drummond, A.

(2012). Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data.

Bioinformatics, 28(12), 1647–1649. https://doi.

org/10.1093/bioinformatics/bts199

Larekeng, S. H., Maskromo, I., Purwito, A., Mattjik, N. A., & Sudarsono, S. (2015). Penyebaran polen berdasarkan analisis SSR membuktikan

penyerbukan. Buletin Palma, 16(1), 77–92.

https://doi.org/10.21082/bp.v16n1.2015.77-92 Larekeng, S. H., Purwito, A., Mattjik, N. A., & Sudarsono,

S. (2018). Microsatellite and SNAP markers used for evaluating pollen dispersal on Pati tall coconuts and Xenia effect on the production of

“Kopyor” fruits. IOP Conference Series: Earth and Environmental Science, 157, 012042. https://

doi.org/10.1088/1755-1315/157/1/012042 Luyindula, N., Mantantu, N., Dumortier, F., & Corley, R.

H. V. (2005). Effects of inbreeding on growth and yield of oil palm. Euphytica, 143(1–2), 9–17.

https://doi.org/10.1007/s10681-005-6735-1 Maskromo, I., Larekeng, S. H., Novarianto, H., &

Sudarsono, S. (2017). Xenia negatively affecting kopyor nut yield in Kalianda Tall kopyor and Pati Dwarf kopyor coconuts. Emirates Journal of Food and Agriculture, 28(9), 644–652. https://

doi.org/10.9755/ejfa.2015-07-552

Mohammadi, S. A., & Prasanna, B. M. (2003). Analysis of genetic diversity in crop plants - Salient statistical tools and considerations. Crop Science, 43(4), 1235–1248. https://doi.org/10.2135/

cropsci2003.1235

Natawijaya, A., Ardie, S. W., Syukur, M., Maskromo, I., Hartana, A., & Sudarsono, S. (2019). Genetic structure and diversity between and within African and American oil palm species based on microsatellite markers. Biodiversitas, 20(5), 1233-1240. https://doi.org/10.13057/biodiv/

d200501

Oktavia, F., Kuswanhadi, Dinarty, D., Widodo, &

Sudarsono. (2017). Genetic diversity and population structure of IRRDB 1981 and Wickham rubber germplasm based on EST- SSR. AGRIVITA Journal of Agricultural Science, 39(3), 239–251. https://doi.org/10.17503/

agrivita.v39i3.881

Purwoko, D., Cartealy, I. C., Tajuddin, T., Dinarti, D., &

Sudarsono, S. (2019). SSR identification and marker development for sago palm based on NGS genome data. Breeding Science, 69(1), 18061. https://doi.org/10.1270/jsbbs.18061 Saghai Maroof, M. A., Biyashev, R. M., Yang, G. P.,

Zhang, Q., & Allard, R. W. (1994). Extraordinarily polymorphic microsatellite DNA in barley:

Species diversity, chromosomal locations, and population dynamics. Proceedings of the National Academy of Sciences of the United States of America, 91(12), 5466–5470. https://

doi.org/10.1073/pnas.91.12.5466

Sambrook, J., Fritsch, E. F., & Maniatis, T. (1989).

Molecular cloning: A laboratory manual (2nd ed.).

New York, USA: Cold Spring Harbor Laboratory Press. Retrieved from https://www.cabdirect.org/

cabdirect/abstract/19901616061

Schuelke, M. (2000). An economic method for the fluorescent labeling of PCR fragments. Nature Biotechnology, 18, 233–234. https://doi.

org/10.1038/72708

Shahbandeh, M. (2019). Palm oil consumption worldwide from 2015/2016 to 2019/2020 (in 1,000 metric tons). Statista. Retrieved from https://www.

statista.com/statistics/274127/world-palm-oil- usage-distribution/

Sulistiyorini, I., Rubiyo, R., & Sudarsono, S. (2018).

Evaluation of clonal uniformity in six superior cacao clones based on SSR marker. Jurnal Tanaman Industri Dan Penyegar, 5(3), 135–144.

https://doi.org/10.21082/jtidp.v5n3.2018.p135- 144

Tautz, D. (1989). Hypervariabflity of simple sequences as a general source for polymorphic DNA markers.

Nucleic Acids Research, 17(16), 6463–6471.

https://doi.org/10.1093/nar/17.16.6463

Tautz, D., & Renz, M. (1984). Simple sequences are ubiquitous repetitive components of eukaryotic genomes. Nucleic Acids Research, 12(10), 4127–4138. https://doi.org/10.1093/

nar/12.10.4127

Thongthawee, S., Tittinutchanon, P., & Volkaert, H.

(2010). Microsatellites for parentage analysis in an oil palm breeding population. Thai Journal of Genetics, 3(2), 172–181. https://doi.

org/10.14456/tjg.2010.1

Tinche, Asmono, D., Dinarti, D., & Sudarsono. (2014).

Keragaman genetik kelapa sawit (Elaeis guineensis Jacq.) populasi Nigeria berdasarkan analisis marka SSR (Simple Sequence Repeats).

Buletin Palma, 15(1), 14–23. Retrieved from http://ejurnal.litbang.pertanian.go.id/index.php/

palma/article/view/5326