Contents lists available atScienceDirect
Phytomedicine
journal homepage:www.elsevier.com/locate/phymed
Original Article
Kaempferol in ameliorating diabetes-induced fibrosis and renal damage: An in vitro and in vivo study in diabetic nephropathy mice model
Dilip Sharma
a, Rakesh Kumar Tekade
b, Kiran Kalia
a,c,⁎aDepartment of Pharmacology and Toxicology, National Institute of Pharmaceutical Education and Research (NIPER)-Ahmedabad, Gandhinagar, 382355, Gujarat, India
bDepartment of Pharmaceutics, National Institute of Pharmaceutical Education and Research (NIPER)-Ahmedabad, Gandhinagar, 382355, Gujarat, India
cDepartment of Biotechnology, National Institute of Pharmaceutical Education and Research (NIPER)-Ahmedabad, Gandhinagar, 382355, Gujarat, India
A R T I C L E I N F O Keywords:
Diabetes Kaempferol Renal damage Glucagon-like Peptide-1 Insulin
A B S T R A C T
Background:Kaempferol is a natural polyflavonol that has gained considerable attention as antidiabetic ther- apeutics. Recent reports emphasize the role of hyperglycemia and RhoA/Rho Kinase activity in the pathogenesis of diabetic nephropathy (DN). This study aims to evaluate the GLP-1 and insulin release along with RhoA/Rho Kinase inhibition pertaining to the anti-fibrotic and reno-protective effects of Kaempferol in DN.
Methods:The effect of Kaempferol on GLP-1 and insulin release along with underlying mechanisms (Ca2+and cAMP levels) in GLUTag and MIN6 cells as well as in their co-culture has been evaluated. Further, the effect of Kaempferol on GLP-1 and insulin release was evaluated underin-vivocircumstances in the DN C57BL/6 mouse model. Histology and fibrosis specific staining was performed to study the renal injuries and fibrosis, while the expression of mRNA and protein of interest was evaluated by RT-PCR and western blot analysis.
Results:Kaempferol treatment promoted the GLP-1 and insulin release, which was accompanied by increased intracellular levels of cAMP and Ca2+in GLUTag and MIN6 cells. In agreement within vitrostudies, Kaempferol also increased the release of GLP-1 and insulin in the DN mouse model. Notably, Kaempferol showed the po- tential to ameliorate the histological changes as well as renal fibrosis while decreasing the expression levels of DN markers including TGF-β1, CTGF, fibronectin, collagen IV, IL-1β, RhoA, ROCK2, and p-MYPT1 in DN kidney tissues. A rise in the expression of E-cadherin and nephrin was also noted in the same study.
Conclusion:This study establishes that Kaempferol ameliorates renal injury and fibrosis by enhancing the release of GLP-1, insulin, and inhibition of RhoA/Rho Kinase. This study recommends Kaempferol for further clinical trials to be developed as novel therapeutics for improving the renal function in DN patients.
1. Introduction
Diabetes Mellitus (DM) is a metabolic disorder that affects millions of people worldwide (Fogelholm et al., 2017). Notably, almost 80% of the diabetic population is found in developing countries (Sharma et al., 2018a). According to a recent report by the International Diabetes Federation (IDF), the population of DM patients is expected to rise to 629 million by 2045 (https://www.idf.org/aboutdiabetes/what-is-
diabetes/facts-figures.html). It involves significant disturbances which lead to hyperglycemia, hyperlipidemia, and glycosuria (Bai et al., 2016). Among various diabetic complications, Diabetic nephropathy (DN) has the highest prevalence that accounts for almost 30 – 47% of cases of renal disorders (Nguyen et al., 2012). Ongoing therapies de- signed to lower the blood glucose levels do not prevent the eventual progression of DN. Currently, there is a strong need for the development of newer and improved therapeutic approaches for the treatment as
https://doi.org/10.1016/j.phymed.2020.153235
Received 22 October 2019; Received in revised form 3 March 2020; Accepted 24 April 2020
Abbreviations:ANOVA, Analysis of variance; BCA, Bicinchoninic Acid; cAMP, Cyclic adenosine monophosphate; CTGF, Connective tissue growth factor; DKD, Diabetic kidney disease; DM, Diabetes mellitus; DMEM, Dulbecco's modified eagle's medium; DMSO, Dimethyl sulfoxide; DN, Diabetic nephropathy; DPP-4, Dipeptidyl peptidase-4; DPX, Dibutyl phthalate polystyrene xylene; ECM, Extracellular matrix; ELISA, Enzyme-linked immunosorbent assay; FBS, Fetal bovine serum;
GFR, Glomerular filtration rate; GIP, Gastrointestinal peptide; GLP-1, Glucagon-like peptide-1; H&E, Hematoxylin-eosin; IAEC, Institutional animal ethical com- mittee; IDF, International diabetes federation; IL, Interleukins; KAM, Kaempferol; KRBB, Krebs–ringer bicarbonate buffer; LIRA, Liraglutide; MYPT1, Myosin phosphatase targeting subunit; NCCS, National centre for cell science pune; OGTT, Oral glucose tolerance test; PCR, Polymerase chain reaction; PMSF, Phenyl methylsulfonyl fluoride; RIPA, Radioimmunoprecipitation assay; ROCKs, Rho-associated kinases; SGLT2, Sodium-glucose co-transporter 2; STZ, Streptozotocin; TBS- T, Tris buffer saline-Tween-20; TE, Tris-EDTA; TGFβ1, Transforming growth factor β1; ZRC, Zydus research center
⁎Corresponding author.
E-mail address:[email protected](K. Kalia).
Phytomedicine 76 (2020) 153235
0944-7113/ © 2020 Elsevier GmbH. All rights reserved.
T
well as prevention of DN. Renin-angiotensin system inhibitors have been persistently used in the clinics for the treatment of diabetic kidney disease (DKD) (Xie et al., 2016). Sodium-glucose co-transporter 2 (SGLT2) inhibitors are yet another class of anti-diabetic drug that are being used in the treatment of DN. These drugs act by enhancing the urinary excretion of glucose as well as by impeding glucose reabsorp- tion in the kidney to decrease the blood glucose levels. Some of the metabolic effects of this medication involve reduction in blood pres- sure, weight loss and improving lipid profiles (Maki et al., 2019). Some clinical studies suggest the effect of SGLT2 inhibitors on kidney disease in patients with diabetes (Neal et al., 2017;Wanner et al., 2016). Since the past few decades, and, no new therapeutic molecule has gained regulatory approval to assist the treatment of DN.
A number of clinical trials suggest anti-hyperglycemic drugs (such as Glucagon-like peptide-1 (GLP-1) agonists, dipeptidyl peptidase 4 (DPP4) enzyme inhibitor, etc.) to restore the glomerular filtration rate and delay the onset of microalbuminuria in type 2 patients with DN (Mann et al., 2017). The clinical trials conducted in regards to cardio- vascular satiety in patients with type 2 diabetic have shown the benefits of GLP-1 agonists, and nowadays researchers are exploring them for the treatment of DN. The clinical findings also infer a significant reduction in DN progression in patients treated with GLP-1 agonists including exenatide, liraglutide, lixisenatide, and semaglutide (Greco et al., 2019;
Marso et al., 2016a,b).
A number of studies confirm the activation of Rho-associated pro- tein kinase (RhoA/ROCK) pathway that contributes to renal pro-fi- brosis, enhances extracellular matrix (ECM) production and in- flammation in DN (Komers, 2013;Rao et al., 2017). The inhibition of the RhoA/ROCK pathway by ROCK inhibitors (Y27632 or fasudil) and RhoA small interfering RNA have been reported to reduce the effect of high glucose in diabetes (Kolavennu et al., 2008;Peng et al., 2008). The protective effect of ROCK inhibitors in attenuating the progression of tubulointerstitial, glomerulosclerosis and proteinuria fibrosis (by de- creasing level of diabetes-induced CTGF, TGF-β1, and ECM protein expression) has been reported. Such inhibitors counter the GFR and increased the expression levels of nephrin mRNA and proteins (Komers et al., 2011). These studies concluded the activation of the RhoA/Rho Kinase pathway in DN, and hence signified the development of a suitable RhoA/Rho Kinase inhibitor in the treatment of DN.
In this context, Kaempferol represents a natural flavonol (Source:
tea, strawberries, grapes, Ginkgo biloba and cruciferous vegetables) has been reported for wide range of pharmacological activities including antioxidative, anticancer, anti-inflammatory and cardioprotective ac- tivity (Zhou et al., 2015;Jo et al., 2015). Considerable volume of lit- erature is available that advocates the use of Kaempferol as an anti- diabetic agent; however, the mechanism of action for anti-diabetic ef- fect or in diabetic complications including DN is lacking in the litera- ture. This creates a void gap in the understanding of the readers as well Fig. 1. (A, B, C) Chemical structures of Kaempferol, Forskolin, and H89. (D) Effect of Kaempferol (10 and 50 μM) and Forskolin (10 μM) treatment on GLP-1 release from GLUTag cells under NG conditions. (E) Cells pretreated with H89 (10 μM) followed by incubation with Forskolin (10 μM) and Kaempferol (10 and 50 μM).
(F)Kaempferol (10 and 50 μM) treatment on in- sulin release from MIN6 cells under NG conditions.
(G)Effects of acute HG exposure, vehicle (0.1%
DMSO), Forskolin (10 μM) and Kaempferol (50 μM) with acute HG exposure and pretreated H89 (10 μM) in MIN6 cells.(H)Effect of Kaempferol on insulin release from the co-culture of GLUTag and MIN6 cells. One-way and Two-way ANOVA with Bonferroni post hoc test. All values were expressed in mean ± SEM (n ==3). *p < 0.05, **p <
0.01, ***p< 0.001vs. NG;#p< 0.05,##p<
0.01 vs. HG; @ p < 0.05, @ @ p < 0.01 vs.
Kaempferol (50 μM) and Forskolin (10 μM).
as explorer's works in this field. Hence, this investigation aims to figure out the probable mechanism of action of Kaempferol that could prevent or slow down the progression of diabetes and complications associated;
i.e. DN.
On the scientific grounds of literature, survey, authors hypothesized that the Kaempferol can work as GLP-1, insulin release enhancer and RhoA/Rho Kinase inhibitor which may attenuate the progression of diabetic complications with specific emphasis on DN. A recent report published by our group infers the potential of Kaempferol as RhoA/
Rho-kinase inhibitor to offer a renoprotective effect in vitro (Sharma et al., 2019). This study is a follow-up investigation that aims to evaluate the molecular mechanisms behind the renoprotective ac- tivity of Kaempferol in DN. To study the effects of Kaempferol on hy- perglycemia mediated regulation of GLP-1 and insulin releasein vitro andin vivocircumstances is yet another goal of this investigation to add upon its reno-protective effect.
2. Materials and methods 2.1. Materials
GLUTag cell line was obtained as a generous gift sample from Dr.
Noriyasu Hirasawa, Tohoku University, and Sendai, Japan. Mouse pancreatic MIN6 β-cells were purchased from National Centre for Cell Science Pune (NCCS), India. Cell culture media including Dulbecco's Modified Eagle's Medium (DMEM) were acquired from Gibco, Life technologies. β-mercaptoethanol, poly-L lysine, Krebs-Ringer bicarbo- nate buffer, Kaempferol (> 90%, purity), 3-[4, 5-dimethylthiazol-2-yl]
- 2, 5-diphenyltetrazolium bromide (MTT), Fura-2 AM dye, Forskolin (> 98%, purity), H89 (> 98%, purity), GLP-1 ELISA kit, streptozotocin (STZ), TRIZOL reagent were procured from Sigma-Aldrich and insulin ELISA kit was product of Millipore. Agarose and ECL (chemilumines- cent agent) were purchased from Invitrogen®.Fig. 1(A, B, C)presents the chemical structures of Kaempferol, Forskolin, and H89.
2.2. Cell culture: enteroendocrine L-cells (GLUTag cells) and pancreatic β- cells (MIN6 cells)
GLUTag cells are well reported as prototype cells for studying GLP-1 release in response to glucose and various nutrients (Reimann and Gribble, 2002). Another cell type, MIN6 has also been extensively ex- plored for studying the pattern of insulin release in response to endo/
exogenous factors like glucose, nutrition, active pharmaceutical in- gredients, etc. (Li et al. 2011). Both GLUTag cells and MIN6 cells were cultured in 25/75cm2flasks using DMEM media with 10% fetal bovine serum (FBS), penicillin/streptomycin and NaHCO3under 5% CO2at 37
°C. Additionally 72 μM β-mercaptoethanol was used for MIN6 cells only. Both the cell lines have almost similar growth patterns and cel- lular culture requirements (Hayashi et al., 2014). Two days before the experiment, cells were splinted into the fresh medium containing 6, 12 or 96-well poly-L lysine coated plates.
2.3. Co-culturing of MIN6 and GLUTag cells
The co-culturing experiments were performed following the pro- tocol reported by Green et al. with applicable modifications (Green et al., 2016). Co-culture studies were conducted to evaluate the effect of Kaempferol on GLP-1 mediate insulin release from MIN6 cells.
Briefly, GLUTag cells were seeded at a cell density of 5 × 104cells per insert (0.4 μM semi-permeable membranes; Becton Dickson, United States). The inserts were then placed into a flat-bottom 12 well plates seeded with MIN6 cells at a cell density of 1 × 105cells per well. These hanging inserts co-culture permitted a separate culture of MIN6 and GLUTag cells while permitting free exchanges of hormones and other cell secretions between compartments. Cells were co-cultured using DMEM with supplements and without β-mercaptoethanol for 24 h to
normalize the cell conditions.
2.4. Estimation of cell viability
The cell viability and proliferation were measured using tetrazolium salt 3-[4, 5-dimethylthiazol-2-yl] - 2, 5-diphenyltetrazolium bromide (MTT) assay which is based upon analysis of reduced MTT by live cells.
The cell viability was measured by determining the effect of high glu- cose (30 mM) with/without Kaempferol (in 0.1 % DMSO) on GLUTag and MIN6 cells. Similarly, the effect of Kaempferol on normal GLUTag and MIN6 cells was also evaluated. For this, 1 × 104cells were seeded in each well of 96 wells plate and incubated overnight. After incuba- tion, cells were treated with different concentration of Kaempferol and incubated for 72 h in 5% CO2at 37 °C. To each well, 20 μl of MTT solution (5 mg/ml) was added and further incubated for 4 h. The media was replaced with 200 μl DMSO, and the plates were placed on an automatic shaker (Rockmax, Tarsons) for 30 min to allow complete solubilization of formazan crystals (Sharma et al., 2016). The absor- bance was determined at 570 nm using a microplate reader (Mul- tiskan™ GO, Thermo Scientific, Finland).
2.5. Calcium assay
The triggered action potentials and increased levels of cytoplasmic Ca2+in GLUTag cells are previously reported for GLP-1 secretagogues (Lan et al., 2012). GLUTag and MIN6 cells (density of 3 × 104cells/
well) were seeded into poly-L-lysine coated 96-wells black plates and cultured at 37 °C in 5% CO2for 48 h. After replacing media with PBS, Fura-2 AM dye was added and incubated for 30 min. The changes in calcium influx were measured with or without different concentrations of Kaempferol (1, 5, 10 and 50 μM) at time intervals of 10 seconds up to 100 seconds using excitation and emission wavelengths of 335 nm and 505 nm respectively using varioskan LUX Multimode Microplate Reader (Thermo Scientific Multiskan™ GO, Finland) (Kim et al., 2015).
2.6. cAMP ELISA
The cAMP is a prime factor that controls the release of GLP-1 and insulin. Forskolin (cyclic AMP activator) and H89 (selective inhibitor of cAMP-dependent protein kinase A) were used as a positive and negative control, respectively. Briefly, 2.5 × 106cells/well treated with either Kaempferol (in the concentration of 1, 5, 10 and 50 μM) or Forskolin (10 µM) or H89 (10 µM) for 15 min. Cells were treated with 0.1 M HCl to avoid cAMP degradation and cell lysate was collected by cen- trifugation (Simpson et al., 2007). The cAMP was quantified using a cAMP ELISA kit (Cayman Chemical, AnnArbor, MI USA) according to the manufacturer's protocol.
2.7. Determination of GLP-1 release from GLUTag cells
The cells (2 × 106cells/well) were seeded in coated (poly-L-lysine) 6-wells plate and incubated in an atmosphere containing 5% CO2at 37
°C for 48 h. The cells were washed twice with Krebs–Ringer bicarbonate buffer (KRBB) and media were replaced either by KRB buffer or KRB buffer containing different concentrations of Kaempferol (1, 5, 10 and 50 μM). In this study, Forskolin (10 µM) and H89 (10 µM) treated cells were also incorporated as a positive and negative control, respectively.
After respective treatments (Kaempferol, Forskolin or H89), the cells were incubated for 2 h in a 5% CO2atmosphere at 37 °C. The media was collected and GLP-1 levels were determined using GLP-1 ELISA kit (Sigma-Aldrich) following the manufacturer's protocol (Yu et al., 2010).
2.8. Estimation of insulin release from MIN6 cells
For the estimation of insulin release from MIN6 cells, cells were seeded in 6-wells plate at a density of 1.2 × 106 cells/well and
incubated in 5% CO2at 37 °C for 48 h. The cells were washed two times with KRB buffer and incubated for 2 h in KRBB containing different concentrations of Kaempferol (1, 5, 10 and 50 μM) at 37°C, 5% CO2. The supernatants were collected, and insulin concentration was de- termined using the insulin ELISA kit (Millipore, U.S) according to the manufacturer's instructions (Itoh et al., 2003). Absorbance was taken using a microplate reader (Multiskan™ GO, Thermo Scientific, Finland).
2.9. Determination of insulin release in co-cultured cells
As mentioned above GLUTag and MIN6 cells were co-cultured to elucidate the effect of Kaempferol on GLP-1 mediated insulin release.
Briefly, the cells were incubated for 40 min in Krebs-Ringer bicarbonate buffer (KRBB) and treated with various concentrations of Kaempferol (1, 5, 10 and 50 µM) and further incubated for 60 min at 37 °C, 5% CO2. The samples were stored at -20 °C until the commencement of insulin analysis.
2.10. In-vivo studies
All the experiments were conducted by following the guidelines and regulations of the Institutional Animal Ethical Committee (IAEC) of the National Institute of Pharmaceutical Education and Research – Ahmedabad (NIPER-A), India, Institutional Animal Care, and Use.
Experimental procedures were approved by the ethical committee of NIPER-A (NIPER-A/IEAC/2017/018). Eight-week-old C57BL/6 mice were purchased from Zydus Research Centre (ZRC), Ahmedabad, Gujarat, India and were acclimatized for 7 days prior to the experiment.
The animals were kept in groups (in a cage) and at a temperature maintained at 25 ± 2 °C with a relative humidity of 55 ± 5% during housing. The light/dark cycle of 12 h was assured and all the animals were given standard pellet diet and water ad libitum(Sharma et al., 2018b).
2.11. Oral glucose tolerance test (OGTT)
Eight-week-old C57BL/6 mice were fasted overnight before per- forming the OGTT. Glucose levels in fasted animal's blood were de- termined using a glucometer (Accu® Check Performa system, Roche Diagnostics, Germany). The control group received 5% DMSO as a plain vehicle, while test groups were administered with a single dose of Kaempferol orally, 100 and 200 mg/kg in 5% DMSO. A glucose load of 2 g/kg was given to each group and blood glucose levels were measured at 6 different time points as 0 min before glucose gavage; 30 min at the time of glucose gavage and at 45, 60, 120, and 240 min after glucose gavage (Liu et al., 2013).
2.12. Estimation of Plasma GLP-1 and Insulin
Analysis of GLP-1 and insulin in plasma was done before and after the treatment of Kaempferol. Blood samples were collected from retro- orbital plexus and immediately transferred to heparin-coated Eppendorf tubes containing DPP-4 inhibitor (10 μl/ml). The blood samples were centrifuged at 2,000 X g for 20 min at 4 °C and separated plasma was stored for estimation of GLP-1 and insulin using ELISA.
Data acquisition was carried out using a multimode microplate reader (Multiskan™ GO, Thermo Scientific, Finland) (Kim et al., 2015).
2.13. Animal treatment and defining groups
Animals were divided into eight groups where each group contained 6-10 animals.Group-1: control (C, n ==6);group-2: C + Kaempferol (KAM, 200 mg/kg/day body weight) (n ==6);group-3: diabetic ne- phropathy (DN, n ==10), administered single dose of streptozotocin (STZ, 180 mg/kg body weight);group-4: DN + Liraglutide (LIRA. 200 μg/kg/ twice a day body weight, subcutaneous) (n ==8); group-5:
DN + insulin (5 IU/kg/day body weight, subcutaneous) (n ==8);
group-6: DN + KAM (50 mg/kg/day body weight) (n ==8);group-7:
DN + KAM (100 mg/kg/day body weight) (n ==8) and group-8:
DN + KAM (200 mg/kg/day body weight) (n ==8). Kaempferol was dissolved in 5% DMSO, and predetermined doses were given by oral route as per the body weight.
2.14. Induction of model
Diabetes in animals was induced by a single i.p. injection of STZ (180 mg/kg) by solubilizing it in freshly prepared ice-cold 10 mM ci- trate buffer (pH 4.4) (Diab et al., 2015). The glucose level in blood was measured after 2 days of STZ administration using a commercially available glucometer (Accu® Check Performa system, Roche Diag- nostics, Germany). Animals with fasting plasma glucose level of ≥ 250 mg/dl were considered to be diabetic and used in further studies.
2.15. Estimation of biochemical parameters
Animals were held in the metabolic cages and a urine sample was collected after 24 h to determine various biochemical parameters.
Blood was collected from all the animals by retro-orbital plexus. To study the levels of glucose, creatinine level, and urea (BUN) levels in both serum and urine samples by commercially available kits through semiautomatic analyzer STAT FAX 3300.
2.16. Determination of GLP-1 and insulin levels in the DN mice
After confirmation of the STZ-induced DN phenotype, Kaempferol was administered to DN mice at a dose of 50, 100 and 200 mg/kg in 5%
DMSO for 21 days. Simultaneously, blood was also collected from mice on the 10thand 21st-day post-dosing. The mice were euthanized at the end of the experiment. Levels of GLP-1 and insulin in plasma were evaluated using GLP-1 ELISA kit and insulin ELISA kit, respectively following the manufacturer's protocol (Lee et al., 2007).
2.17. Reverse transcription-polymerase chain reaction (RT-PCR) RNA was extracted from homogenize tissue samples using TRIZOL reagent (Sigma-Aldrich, United State). Homogenize tissue samples in 1 ml, TRIZOL reagent per 100 mg of tissue using a power homogenizer and 0.3 ml chloroform were done before keeping samples at -20 °C for 20 min. The samples were then centrifuged at 12,000 × g for 20 min at 4 °C and the RNA precipitation was done by mixing the aqueous phase with isopropanol. The samples were incubated at -20 °C temperature overnight and on a subsequent day, they were centrifuged again at 12,000 × g for a period of 20 min at 4 °C. The supernatant was re- moved, and the RNA pellet was washed once with 95% ethanol. The pellet was air-dried and dissolved in TE (Tris-EDTA) buffer. Total RNA was quantified by 260/280, 260/270 ratios using Nanodrop spectro- photometer 2000C (Thermo-scientific) and quality was confirmed by agarose gel electrophoresis (Simms et al., 1993).
The RNA having a 260/280 ratio in the range of 1.9-2.1 (quantity – 1 μg) was then subjected to cDNA synthesis by an iscript cDNA synth- esis kit (Bio-rad). RNA templates and cDNA were stored at −20 °C for subsequent analysis. Primers directed against fibronectin (F, 5’ACCTG CAAGCCAATAGCTGGA 3’, R, 5’ CCAGCCTTGGTAGGCTTTT 3’), Connective tissue growth factor (CTGF) (F, 5’ TGGCCCTGACCCAACT ATGA 3’, R, 5’ CTTAGAACAGGCGCTCCACTCT 3’), nephrin (F, 5’ GCT CCCACCATCCGTGC 3’, R, 5’ GACTATGTCCACACAACCCCCA 3’), E- cadherin (F, 5’ AACGAGGGCATTCTGAAAACA 3’, R, 5’ CACTGTCACG TGCAGAATGTACTG 3’) and collagen IV (F, 5’ AAAGGGAGATCAAGG GATAG 3’, R, 5’ TCACCTTTTTCTCCAGGTAG 3’) were purchased from Sigma-Aldrich. PCR reaction products were resolved on 1% agarose (Invitrogen®, United State) gels, and the identities of the product were confirmed using the respective ladder (50 bp). Observation and image
collection was done with ChemiDocTM Touch imaging system (Qing- Hua et al., 2008).
2.18. Western blot analysis
The western blot analysis was conducted using tissue lysate which was prepared with lysis buffer. Bicinchoninic Acid (BCA) method was utilized to determine protein concentrations of samples. After loading an equal amount, proteins were separated using SDS-PAGE and trans- ferred to PVDF membranes. Blocking was done using 3% BSA solution prepared in TBS-T (tris buffer saline-Tween-20) for 2 h and was in- cubated with primary antibodies of E-cadherins (ab76055, dilution: 1/
500 μl), nephrin (ab 58968, dilution: 1 μg/ml), IL-1β (ab 9787, dilution:
2/5000 μl), fibronectin (ab2413,dilution: 1 μg/ml), GAPDH (ab 8245, dilution: 1/1000 μl), RhoA (ab187027, dilution: 1/5000 μl), TGF-β1 (ab92486, dilution: 4 μg/ml) and collagen-IV (ab6568, dilution: 1/1000 μl) ROCK II (ab71598, dilution: 1 μg/ml) and p- myosin phosphatase targeting subunit (MYPT1) (pThr853) (SAB4503944, dilution: 1/500 μl) at 4 °C for overnight. After incubating with primary antibodies, membranes were washed with TBS-T and were incubated with their respective secondary antibodies for 1 h. The immune complexes formed were detected using ECL (chemiluminescent agent) (Invitrogen, United State). Bands were visualized in a Bio-Rad gel documentation system (Chem-doc, Bio-rad) and quantified using Image J software (Sharma et al., 2019).
2.19. Histological examination
Tissues were fixed in 10% formalin and slides were prepared as per the standardized protocol (Yadav et al., 2014). Before analysis, the slides were deparaffinized with xylene and processed by a series of alcohol dilutions. Following this step of rehydration sections were stained either using hematoxylin-eosin (H&E) or Masson's trichrome staining kit (ab150686). Slides were mounted with DPX and observed under the microscope at different resolutions. Alterations in tissue structure such as capsular space and glomerular volume were assessed and quantified using Image J software (Khan et al., 2015).
2.20. Statistical analysis
Software Graph Pad Prism (version 5.01) was utilized for all the statistical analyses. Assessment of significance for the difference be- tween the two groups was done using Student's t-test. For comparisons in multiple groups, one-way and two-way analysis of variance (ANOVA) was used and post hoc analysis was done using the Bonferroni test.p<
0.05 was considered a statistically significant figure. Results were ex- pressed as mean ± SEM.
3. Results
3.1. Effect of Kaempferol on cell viability of GLUTag and MIN6 cells This study was performed to determine the effect of Kaempferol on cell viability of GLUTag and MIN6 cells. It was noted that the treatment of Kaempferol up to a concentration of 50 μM did not show any sig- nificant changes in the cell viability of either GLUTag or MIN6 cells.
However, when the cells were treated with Kaempferol at higher con- centrations (100 and 300 μM) significant reduction of % cell viability was observed(p< 0.01 and 0.001;Data in supplementary file).After that when we cultured both cells in HG condition for a long time and evaluated and compared % cell viability in both conditions (NG and HG) then result was found that under HG condition % cell viability of both cells decreased compared to NG condition but didn't found sig- nificant changes. While we treated both cells from the different con- centrations of Kaempferol (1, 5, 10 and 50 μM) during HG condition then the higher concentration of Kaempferol (10 and 50 μM) restored %
cell viability of both cells which decreased by HG(Data in supple- mentary file).
3.2. Effect of Kaempferol on GLP-1 release from GLUTag cells
The positive control Forskolin (10 μM) significantly increases the release of GLP-1 (by 2.3-fold; p < 0.001) as compared to NG. The treatment of Kaempferol at concentrations of 10 and 50 μM lead to an increase in GLP-1 release by 1.92-fold (p< 0.05) and 1.95-fold (p<
0.05), respectively as compared to NG (Fig. 1D). The HG treatment was also found to significantly increase the GLP-1 release by 1.77-fold (p<
0.05) as compared to NG exposure (Fig. 1E). Interestingly, the treat- ment of Kaempferol (10 and 50 μM) with HG in GLUTag cells was found to further increase the GLP-1 release by 1.61-fold (p< 0.01) and 1.58- fold (p< 0.01) respectively as compared to HG. Moreover, the pre- treatment of GLUTag cells with H89 (10 μM) completely abolished the Kaempferol and Forskolin-induced GLP-1 release (Fig. 1E).
3.3. Effect of Kaempferol on insulin release from MIN6 cells
Further, the direct effect of Kaempferol on insulin release from MIN6 cells was evaluated. Our observation suggests that the treatment of Kaempferol at concentrations of 10 and 50 μM lead to an increase in insulin release by 1.40-fold (p< 0.05) and 1.43-fold (p< 0.05) re- spectively as compared to NG (Fig. 1F). In MIN6 cells, HG treatment stimulated insulin release by 1.9-fold (p< 0.05) as compared to cells cultured under NG condition. The treatment of Kaempferol (50 μM) with HG further enhanced the insulin release by 1.59-fold (p< 0.05) in MIN6 as compared to HG-treated cells (Fig. 1G). The positive control Forskolin (10 μM) was also tested in HG-treated cells. It was found that Forskolin significantly increased the insulin release by 1.53-fold (p<
0.05) in MIN6 as compared to the HG group.
Moreover, the pretreatment of MIN6 cells with H89 (10 μM) sig- nificantly decreased the Kaempferol and Forskolin-induced insulin re- lease (Fig. 1G).
3.4. Effect of Kaempferol on insulin release in GLUTag and MIN6 co- culture
The co-culture of GLUTag and MIN6 cells lead to a 2.5-fold (p<
0.05) increase in insulin release as compared to MIN6 cell culture alone.
The insulin release in GLUTag and MIN6 co-culture was found to be increased by 1.58-fold (p< 0.05) and 1.62-fold (p< 0.05) following the treatment of Kaempferol at 10 and 50 μM concentrations, respec- tively(Fig. 1H).
3.5. Assessment of Kaempferol mediated calcium influx in GLUTag and MIN6 cells
The role of Kaempferol treatment on intracellular calcium levels was monitored by using calcium-sensitive dye (Flura 2-AM).
Kaempferol treatment resulted in a dose-dependent (1 – 50 μM) in- crease in Ca2+influx in both GLUTag and MIN6 cells(Fig. 2A, B, C, and D).The HG treatment alone was found to elevate the Ca2+influx in GLUTag and MIN6 cells. Notably, the Kaempferol treatment in HG- treated GLUTag and MIN6 cells further elevated the Ca2+influx in a dose-dependent manner.
3.6. Effect of Kaempferol on cAMP levels in GLUTag and MIN6 cells Kaempferol treatment significantly increased the intracellular cAMP levels by 1.33-fold (p < 0.05) and 1.45-fold (p< 0.01) at a con- centration of 10 μM and 50 μM, respectively compared to control group in GLUTag cells (Fig. 2E). In MIN6 cells, the effect was found to be almost similar wherein almost 1.6-fold (p < 0.05) enhancement in intracellular cAMP level was seen vs control group following the
treatment of Kaempferol (10 and 50 μM;Fig. 2G). It was observed that Forskolin increase the intracellular cAMP level by 1.47-fold (p< 0.01) as compared control group. This effect elicited by Forskolin (10 μM) was found to be almost similar to that exhibited by Kaempferol (50 μM) in GLUTag cells.
On the other hand, in MIN6 cells Forskolin elevated the cAMP level by 1.86-fold (p< 0.01) as compared to Kaempferol (50 μM) that pro- duced a comparatively low elevation in cAMP level by 1.64-fold (p<
0.05). Interestingly, when the GLUTag, as well as MIN6 cells, were treated with a combination of Forskolin (10 μM) and Kaempferol (50 Fig. 2. (A, B)Calcium influx in GLUTag cells at both condition (NG and HG exposure) and further treated with Kaempferol (1, 5, 10 and 50 μM).(C, D)Calcium influx in MIN6 cells at both condition (NG and HG exposure) and further treated with Kaempferol (1, 5, 10 and 50 μM) (n
==3).(E, G)Effect of Kaempferol (1, 5, 10 and 50 μM), Forskolin (10 μM) and combination of Kaempferol (50 μM) and Forskolin (10 μM) on cAMP levels in both cells under NG condition.(F, H) Treated of both cells with acute HG exposure and from Kaempferol (50 μM) and Forskolin (10 μM) with HG exposure (n ==4). One-way and Two-way ANOVA with Bonferroni post hoc test. All values were expressed in mean ± SEM. *p< 0.05, **p<
0.01, ***p< 0.001vs. NG;#p< 0.05,##p< 0.01vs.
HG.
μM), no significant rise in the intracellular cAMP levels was noticed as compared to Forskolin as well as Kaempferol alone (Fig. 2E and G).
In GLUTag and MIN6 cells, HG treatment stimulated cAMP levels by 1.49-fold (p< 0.05) and 1.67-fold (p< 0.05), respectively as com- pared to cells cultured under NG condition. The treatment of Kaempferol (50 μM) with HG, further enhanced the cAMP levels by 1.51-fold (p< 0.05) in GLUTag and 1.33-fold (p< 0.05) in MIN6 as compared to HG-treated cells (Fig. 2F and H). The positive control Forskolin (10 μM) was also tested in HG-treated cells. It was found that Forskolin significantly increased the cAMP levels by 1.53-fold (p <
0.01) in GLUTag and 1.45-fold (p< 0.05) in MIN6 as compared to HG group. (Fig. 2F and H).
3.7. Effect of Kaempferol on GLP-1, insulin release and glucose level in C57BL/6 mice
The effect of Kaempferol on the regulation of blood glucose level was evaluated by GLP-1 and insulin release during OGTT in C57BL/6 mice. It was found that the administration of a single dose of Kaempferol (100 and 200 mg/kg) resulted in a dose-dependent increase in the release of GLP-1. This event was marked by a progressive ele- vation in the levels of GLP-1 up to 60 min of treatment, but, the highest levels of GLP-1 release was achieved 45 min post-administration of Kaempferol. This elevation in GLP-1 release was found to be 1.33-fold (p < 0.05) and 1.43-fold (p < 0.01) following the treatment of Kaempferol 100 and 200 mg/kg, respectively as compared vehicle (Fig. 3A).
Further, the effect of Kaempferol on the release of insulin was stu- died at doses of 100 and 200 mg/kg. Both the doses of Kaempferol progressively elevated the release of insulin with maximal secretion level at 45 min time point. Notably, the rise in insulin release was 1.39- fold (p< 0.01) and 1.5-fold (p< 0.001) as compared to vehicle, re- spectively (Fig. 3B).
Further, the Kaempferol administration also reduced the blood glucose level in acute hyperglycemic animals. At 60 min time point, the Kaempferol doses (100 and 200 mg/kg) reduced the glucose levels more significantly by 0.8-fold (p< 0.001) and 0.82-fold (p< 0.001), respectively as compared to vehicle group (Fig. 3C).
3.8. Effect of Kaempferol on the release of GLP-1 and insulin in DN mice The study was done to examine the effects of Kaempferol on the release of GLP-1 and insulin in the DN mice after 10 and 21 days of treatment. After confirmation of DN in mice, Kaempferol (50, 100 and 200 mg/kg) was administered and the levels of GLP-1 and insulin were determined at 10 and 21 days. A non-significant change in the level of GLP-1 in DN mice was observed as compared to the control group. On the other hand, the insulin levels get significantly decreased by 4.1-fold (p< 0.001) in DN mice as compared to the control group. After 10 days of treatment of Kaempferol, no significant changes in GLP-1 and insulin levels were observed. However, after 21 days of treatment, Kaempferol (200 mg/kg) significantly increased the GLP-1 and insulin levels by 1.5- fold (p< 0.05) and 2.5-fold (p< 0.05), respectively as compared to DN group (Fig. 3D, E, F, and G). At the point on insulin release effect of Kaempferol (200 mg/kg) as similar from standard GLP-1 agonist Lir- aglutide (by 2.7-fold;p< 0.05 as compared to the DN group).
3.9. Effect of Kaempferol treatment on serum and urinary biomarkers of renal function
To assess the effect of Kaempferol on the kidney function and high glucose levels; various biomarkers were evaluated in DN mice viz.
serum glucose, creatinine, urea (BUN) along urine creatinine and urea.
Observations suggested an increase in glucose levels by 2.53-fold (p<
0.001) for DN mice as compared to the control group. Further, the serum creatinine and urea levels also got elevated by 1.67-fold (p<
0.05) and 3.4-fold (p < 0.001), respectively. Similarly, the urine creatinine and urea levels were decreased by 6.6-fold (p< 0.001) and 2.5-fold (p< 0.001), respectively as compared to the control group.
Notable change in the levels of the above-mentioned biomarkers was observed following the treatment of Kaempferol and Liraglutide for 10 days (Table 1). However, a significant decrease in glucose levels by 1.45-fold (p< 0.05) and 1.5-fold (p< 0.05), respectively was observed as compared to DN mice after 21 days of Kaempferol treatment (100 and 200 mg/kg, respectively). Interestingly, the effect of Kaempferol was of a similar level that of Liraglutide (p < 0.05). Alterations in serum and urinary biomarkers were found to be inhibited by higher doses of Kaempferol and Liraglutide. Serum creatinine and urea levels were decreased whereas urine creatinine or urea levels were increased by the treatment of Kaempferol in DN mice (Table 1).
3.10. Effect of Kaempferol on activation of RhoA/ROCK in STZ-induced DN mice
The RhoA/ROCK signaling pathway was evaluated by assessing the protein expression of markers including RhoA, ROCK2 and MYPT1- phosphorylation in kidneys of DN mice by western blotting analysis. As shown inFig. 4A, B and C, the significantly roused expression of RhoA and ROCK2 signifies the activation of the RhoA/ROCK pathway in DN mice. The levels of RhoA and ROCK2 was increased by 1.75-fold (p<
0.01) and 1.6-fold (p< 0.01) in the DN group as compared to the control mice. It was found that the treatment of Kaempferol to DN mice could decrease the expression of RhoA and ROCK2. Notably, the effect of Kaempferol on RhoA and ROCK2 protein expression was comparable to that of Liraglutide treated groups.
The MYPT1 is considered a downstream target of ROCK2 as shown inFig. 4C. The phosphorylated-MYPT1 was found to get significantly elevated by 1.63-fold (p < 0.05) in the DN group compared to the control group. It may be noted that an insignificant change in the ex- pression of phosphorylated-MYPT1 was observed in the case of Lir- aglutide treated DN mice. However, the treatment of Kaempferol sig- nificantly decreased the expression of phosphorylated-MYPT1 as compared to the DN group. The results demonstrate that the RhoA/
ROCK signaling pathway is activated in DN kidneys and that Kaemp- ferol has the ability to potentially downregulate the activation of RhoA/
ROCK signaling to possibly offer therapeutic effect to DN kidneys, which was evaluated in further studies.
3.11. Effects of Kaempferol on mRNA expression of collagen-IV, CTGF, fibronectin, nephrin and E-cadherin in DN mice
The expression of mRNA corresponding to collagen-IV, CTGF and fibronectin were found to be enhanced in kidney tissues of DN mice as compared to control mice by 1.6-fold, 1.74-fold, and 1.65-fold, re- spectively. The administration of Kaempferol inhibited the expression of collagen-IV, CTGF and fibronectin mRNA in the kidney of DN mice (Fig. 5A, B and C). The effect of Kaempferol was found to be similar to that of standard Liraglutide. Nephrin and E-cadherin mRNA expression levels get significantly reduced in the case of DN mice by 1.62-fold (p<
0.05) and 2.11-fold (p< 0.05, respectively as compared to the control group. The Kaempferol administration in DN mice restored the mRNA expression levels of E-cadherin and nephrin with a comparable effi- ciency that of Liraglutide (Fig. 5D and E).
3.12. Effect of Kaempferol on the protein expression of collagen-IV, TGF- β1, IL-1β, Fibronectin, Nephrin and E-cadherin in DN mice
The overexpression of inflammatory and fibrotic markers including
collagen- IV, TGF-β1, IL-1β, Fibronectin, Nephrin, and E-cadherin are involved in the progression and development of DN. Our results showed that the treatment of Kaempferol significantly reduced the expression of collagen-IV, TGF-β1, IL-1β and fibronectin in STZ induced DN mice in a dose-dependent manner (Fig. 5F), TGF-β1(Fig. 5G), IL-1β (Fig. 5I) and
fibronectin (Fig. 5J). Further, the Kaempferol treatment was also found to assist in the restoration of nephrin and E-cadherin expression in the DN mice. Interestingly, Liraglutide showed an insignificant restoration in the expression of the aforementioned proteins in DN mice, while, Kaempferol elicited a significant restoration (p< 0.05;Fig. 5H and K).
Fig. 3.Effect of Kaempferol on glucose level, GLP-1 and insulin release in C57BL/6 mice.(A) The effect on plasma GLP-1 levels in C57BL/6 mice during OGTT. (B) The effect on plasma insulin levels in C57BL/6 mice during OGTT.
(C) The effect on plasma glucose levels in C57BL/6 mice during OGTT. (D, F)Effect of Kaempferol on GLP-1 and insulin release in DN mice after treatment of 10 days.(E, G)Effect of Kaempferol on GLP-1 and insulin release in DN mice after treatment of 21 days. One-way and Two-way ANOVA with Bonferroni post hoc test.
All values were expressed in mean ± SEM (n
==6). *p< 0.05, **p< 0.01, ***p< 0.001 vs. control;#p< 0.05vs. DN.
Table1 Effectoftreatmentonglucose,waterintake,urination,ureaandcreatinineinDNmice. ParametersGroups Following10daystreatment ControlC+KAM(200mg/ kg)DNDN+LIRA(200μg/kg)DN+Insulin(5IU/kg)DN+KAM(50mg/kg)DN+KAM(100mg/kg)DN+KAM(200mg/kg) Glucose(mg/dl)176.71±10.08163±13.53447.57±34.82***333.14±24.59332.28±21.90437.42±38.12378.57±22.94378±31.68 Waterintake(ml)6.21±0.965.78±1.0315.42±1.21***10.42±1.0812.85±1.2911.14±1.1810.71±0.7410±1.34# Urination(ml)1.62±0.442.15±0.5812.57±1.15***9.71±0.9410.07±1.3012.64±1.7010.85±1.1610±1.11 Ureainserum(mg/dl)17.5±1.4320.71±1.8259.72±7.49***34.64±2.1755.21±7.8147.43±8.7338.88±4.6834.67±2.96 Ureainurine(mg/dl)1931.14± 249.701911.1±199.5757.28±89.79***1039.14±119.78963.28±134.52703.85±80.52972.71±172.46943.58±166.13 Creatinineinserum(mg/ dl)0.93±0.0700.93±0.0811.56±0.17*1.02±0.17#1.08±0.110.98±0.061.08±0.110.96±0.040# Creatinineinurine(mg/ dl)156.2±21.70103.85±12.9823.51±3.53***33.45±4.5224.37±4.4024.14±4.5031.28±5.7036.65±6.43 Following21daystreatment Glucose(mg/dl)159.71±11.44166.42±11.41439.42± 31.58***295.28±20.73#290.28±33.78#449.85±46.60302.71±24.41#295.14±22.38# Waterintake(ml)5.5±0.545.22±0.6417.21±1.81***10.72±1.41##11.12±1.41#16.92±1.0611.22±0.78#10.01±0.89## Urination(ml)1.67±0.391.25±0.2618.07±1.97***10.38±2.23#10.75±1.5614.71±2.1210.41±1.38#10.04±1.63# Ureainserum(mg/dl)18.48±1.2916.64±1.1759.75±4.73***34.21±4.39##37.45±5.34#58.17±6.3237.88±4.33#33.21±3.54## Ureainurine(mg/dl)2630.00± 392.053004.85±461.12738.42± 108.43**2457.85±383.67#1878.28±338.15965±179.382186±398.252519.85±278.09# Creatinineinserum(mg/ dl)0.76±0.080.79±0.081.26±0.14**0.85±0.05#0.82±0.08#1.06±0.060.82±0.03#0.81±0.10# Creatinineinurine(mg/ dl)113.94±10.16112.34±9.5031.82±4.98***74.71±4.76##68.17±10.2442.62±6.3665.74±6.7572.91±6.96# Resultsareexpressedasmean±SEM,(n==6-7),*p<0.05,**p<0.01and***p<0.001vs.Control,#p<0.5and##p<0.01vs.DN.
3.13. Effect of Kaempferol on histological alterations during DN
Kaempferol treatment notably ameliorated the histological changes induced by DN in the kidney viz. decreased capsular space (by 1.86- fold; p < 0.05) and glomerular volume (by 2.3-fold; p< 0.05) as compared to the DN group. The quantitative assessment of histological changes shown enhancement in the glomerular volume (by 2.65-fold;p
< 0.01) and capsular space (by 2.58-fold;p< 0.001) for DN condition (Fig. 6A-I). Further, the Kaempferol treatment led to a significant re- duction in the deposition of DN-associated collagen (% fibrotic area; by 1.72-fold;p< 0.05) as evident by Masson trichrome staining (Fig. 6J- Q). The aforementioned histological assessment unveiled that treatment with the Kaempferol ameliorates the structural changes in the DN kidney tissues.
4. Discussion
Kaempferol is a flavonol, which has been widely in use for decades for its anti-inflammatory, antioxidant, lipolytic and anticancer effects (Chen and Chen, 2013). Considerable volume of literature is available that advocates the use of Kaempferol as an anti-diabetic agent and to best of author's knowledge; the mechanism of action for anti-diabetic effect or in diabetic complications including DN is lacking in the lit- erature. This creates a void gap in the understanding of the readers.
This investigation aims to figure out the probable mechanism of action of Kaempferol that could prevent or slow down the progression of diabetes and complications associated; i.e. DN. On the scientific grounds of literature, survey, authors hypothesized that the Kaempferol can work as GLP-1, insulin release enhancer and RhoA/Rho Kinase inhibitor which may attenuate the progression of diabetic complica- tions with specific emphasis on DN.
The present study is the first to reports the anti-fibrotic and
renoprotective effect of Kaempferol in DN mice kidney through RhoA/
ROCK signaling inhibition and allied mechanisms, thereby enhancing the GLP-1 or insulin release. It was found that the Kaempferol treatment boosts the GLP-1 and insulin release in a dose-dependent manner in both GLUTag and MIN6 cells, respectively. The co-culture of both cells demonstrated a remarkable increase in insulin release as compared to MIN6 cells alone. The GLUTag and MIN6 co-culture studies further confirmed the synergetic potential of Kaempferol to increase insulin release from MIN6 cells as compared to co-culture alone. Our findings are supported by a study ofGreen et al. (2016)which has shown that GLP-1 stimulators release insulin from MIN-6 cells when added to the co-culture of GLUTag and MIN6 cell lines (Green et al., 2016). The effect of Kaempferol in the acute regulation of insulin releasein vivo was examined by observing the effect of Kaempferol using OGTT in C57BL/6 mice. We observed a significant amelioration in the glycemic control, increased plasma insulin and GLP-1 levels in the mouse after treatment with Kaempferol.
GLP-1 is an incretin hormone that is produced and release from gut enteroendocrine L-cells and used to overcome hyperglycemia by in- creasing insulin release from β-cells and β-cell mass of pancreas and reduces glucose excursion (Sharma et al., 2018a). The insulin level selectively get decreased in STZ induced DN mice because of the da- mage and injuries in pancreatic β -cells. The Kaempferol treatment significantly increased the release of GLP-1 and insulin in STZ induced DN mice.
Most importantly, both the cAMP and calcium influx are the two most important mediators accountable for GLP-1 and insulin release (Reimann et al., 2006). With this viewpoint as well as to further confirm the possible mechanism of Kaempferol action, we have examined the effect of Kaempferol on calcium and cAMP levels in both GLUTag and MIN6 cells. Thein-vitrostudies demonstrated an increased (Ca2+) influx and increment in the cAMP levels following acute exposure to high Fig. 4.Protein expression(A)of RhoA(B),ROCK2(C)and p-MYPT1(D)in mice kidney tissue. One-way ANOVA with Bonferroni post hoc test. All values were expressed in mean ± SEM (n=4). *p< 0.05, **p< 0.01vs. control;#p< 0.05vs. DN.
glucose, which interestingly further gets potentiated by Kaempferol treatment in both GLUTag and MIN6 cells. These outcomes are sup- ported by the results reported by Lee and his coworkers, wherein they also suggested an enhancement in intracellular Ca2+levels in response to Kaempferol in Human umbilical vein endothelial cells (HUVECs) (Lee et al., 2016).
The treatment of Kaempferol in DN mice significantly ameliorated the levels of serum and urinary biomarkers of renal function (viz creatinine and BUN) by reducing the blood glucose. The results ob- tained by analyzing biochemical parameters show Kaempferol to im- prove the compromised renal function allied to diabetic nephropathy (DN).
On the basis of results obtained from the RhoA/ROCK signaling pathway study, it can be concluded that Kaempferol downregulates the RhoA/ROCK activity in the kidneys of STZ-induced DN mice, resulting in the inhibitions of RhoA membrane translocation, ROCK2 expression, and phosphorylation of MYPT. One of the major causative factors for excess matrix synthesis in DN is the up-regulation of collagen-IV, CTGF, TGF-β1, and fibronectin mRNA as well as protein in the kidney (Mason and Wahab, 2003). Hence, in order to establish the mechanism of action for Kaempferol in more detail and to deduce its effect on the expression of collagen-IV, CTGF, fibronectin, TGF-β1, E-cadherin, and nephrin; these were analyzed as well.
E-cadherin and nephrin mRNA expression, as well as protein, were chosen as markers of glomerular injury for this study because decreased levels of these markers have been linked to the development of glo- merulosclerosis in experimental and human diabetic renal disease (Wang et al., 2010). In one report published recently by our group, the
potential of Kaempferol in inhibiting RhoA/ROCK activity in human and rat renal proximal tubular cells has been reported (Sharma et al., 2019). The present study defines that the expression of collagen-IV, CTGF, TGF-β1, and fibronectin get up-regulated in kidneys of DN mice as compared to the control group.
The administration of Kaempferol, as well as Liraglutide standard, remarkably reduced the expression of collagen-IV, CTGF, TGF-β1 and fibronectin in kidneys of DN mice. The treatment of Kaempferol sig- nificantly increased the expression of E-cadherin and nephrin which was down-regulated in kidneys of DN mice. This effect of Kaempferol was found comparable to that of the marketed reference standard, Liraglutide used in this study. The histological assessment established that Kaempferol significantly ameliorates structural damage allied to DN.Results obtained from the present study revealed that the compound of interest shows an anti-fibrotic and renoprotective effect in renal damage allied to diabetes at the molecular as well as structural level.
Further, treatment with Kaempferol showed its anti-inflammatory property in the DN by significantly diminished expression of IL-1β. It might be concluded from the results that reduction in the inflammation by Kaempferol is one of the possible mechanisms for its renoprotective and anti-fibrotic efficacy.
5. Conclusion
To the best of author's knowledge, this is the first investigation that reports Kaempferol as GLP-1 secretagogue and anti-fibrotic activity that offers renoprotective actovityin-vitroandin-vivo. The results obtained Fig. 5.RT-PCR determination of the effect of Kaempferol on mRNA expression of collagen(A),CTGF(B)fibronectin(C),E-cadherin(D)and nephrin(E)in DN mice.
Effect of Kaempferol on protein expression of collagen IV(F),TGF-β1(G),nephrin(H),IL-1β(I),fibronectin(J)and E-cadherin(K)in DN mice. One-way ANOVA with Bonferroni post hoc test. All values were expressed in mean ± SEM (n ==4). *p< 0.05, **p< 0.01vs. control;#p< 0.05vs. DN.
Fig. 6.Representative photomicrographs and quantitative evaluation. Histological alterations in the kidney tissue of different experimental groups(A-G)stained with H & E staining (100x). Evaluated Capsular space(H)and Glomerular volume(I).Determined fibrosis in kidney tissue with masson trichome staining(J-P)and evaluated percentage fibrosis(Q)(100 x). One-way ANOVA with Bonferroni post hoc test. All values were expressed in mean ± SEM (n ==4), scale (100 μM). *p<
0.05, **p< 0.01vs. control;#p< 0.05vs. DN.
in this study emphasized the involvement of Ca2+and cAMP as in- tracellular signals that mediated the GLP-1 and insulin release by Kaempferol. The expression of profibrotic, inflammatory and anti-fi- brotic proteins, histological evaluation as well as fibrosis specific staining confirmed renoprotective benefits offered by Kaempferol. It may be noted that hyperglycemia is one of the prime factors involved in DN. Kaempferol mediated decrease in blood glucose levels by in- creasing the GLP-1 or insulin release help in restoring the imbalanced glucose level. Further, the Kaempferol accounts for its anti-fibrotic ac- tivity in DN by inhibiting the fibrogenesis through RhoA/Rho Kinase.
On the basis of results obtained in this study advocates the development of Kaempferol as a potential candidate in the intervention of DN. A comprehensive investigation is further warranted to elucidate the un- derlying molecular mechanisms for its renoprotective and anti-fibrotic action to make its entry into further clinical trials.
Funding
This work is supported by the Department of Pharmaceuticals, Ministry of Chemicals and Fertilizers, Government of India, National Institute of Pharmaceutical Education and Research (NIPER) Ahmedabad, Gandhinagar, Gujarat, India.
Author statement
Dilip Sharma: Designing concept, conducting experiments, result interpretation and manuscript writing and revising.
Kiran Kalia: Designing concept, supervision throughout experi- mentation, result interpretation and manuscript revising.
Rakesh Tekade: Data interpretation, manuscript writing and re- vising.
Declaration of Competing Interest None.
Acknowledgment
This work was supported by the Department of Pharmaceuticals, Ministry of Chemical and Fertilizers, Government of India and National Institute of Pharmaceutical Education and Research (NIPER) Ahmedabad, Gandhinagar, Gujarat, India.
Supplementary materials
Supplementary material associated with this article can be found, in the online version, atdoi:10.1016/j.phymed.2020.153235.
References
Bai, D., Zhang, Y., Shen, M., Sun, Y., Xia, Q., Zhang, Y., Liu, X., Wang, H., Yuan, L., 2016.
Hyperglycemia and hyperlipidemia blunts the Insulin-Inpp5f negative feedback loop in the diabetic heart. Sci. Rep. 6, 22068.
Chen, A.Y., Chen, Y.C., 2013. A review of the dietary flavonoid, kaempferol on human health and cancer chemoprevention. Food Chem. 138, 2099–2107.
Diab, R.A.H., Fares, M., Abedi-Valugerdi, M., Kumagai-Braesch, M., Holgersson, J., Hassan, M., 2015. Immunotoxicological effects of streptozotocin and alloxan: in vitro and in vivo studies. Immunol. Lett. 163, 193–198.
Fogelholm, M., Larsen, T.M., Westerterp-Plantenga, M., Macdonald, I., Martinez, J.A., Boyadjieva, N., Poppitt, S., Schlicht, W., Stratton, G., Sundvall, J., 2017. PREVIEW:
prevention of diabetes through lifestyle intervention and population studies in Europe and around the world. design, methods, and baseline participant description of an adult cohort enrolled into a three-year randomised. Clin. Trial. Nutr. 9, 632.
Greco, E.V., Russo, G., Giandalia, A., Viazzi, F., Pontremoli, R., De Cosmo, S., 2019. GLP-1 receptor agonists and kidney protection. Medicina (B. Aires). 55, 233.
Green, A.D., Vasu, S., Moffett, R.C., Flatt, P.R., 2016. Co-culture of clonal beta cells with GLP-1 and glucagon-secreting cell line impacts on beta cell insulin secretion, pro- liferation and susceptibility to cytotoxins. Biochimie 125, 119–125.
Hayashi, H., Yamada, R., Das, S.S., Sato, T., Takahashi, A., Hiratsuka, M., Hirasawa, N., 2014. Glucagon-like peptide-1 production in the GLUTag cell line is impaired by free
fatty acids via endoplasmic reticulum stress. Metabolism 63, 800–811.
https://www.idf.org/aboutdiabetes/what-is-diabetes/facts-figures.html.
Itoh, Y., Kawamata, Y., Harada, M., Kobayashi, M., Fujii, R., Fukusumi, S., Ogi, K., Hosoya, M., Tanaka, Y., Uejima, H., 2003. Free fatty acids regulate insulin secretion from pancreatic β cells through GPR40. Nature 422, 173–176.
Jo, E., Park, S.J., Choi, Y.S., Jeon, W.-K., Kim, B.-C., 2015. Kaempferol suppresses transforming growth factor-β1–induced epithelial-to-mesenchymal transition and migration of A549 lung cancer cells by inhibiting Akt1-mediated phosphorylation of Smad3 at threonine-179. Neoplasia 17, 525–537.
Khan, S., Jena, G., Tikoo, K., Kumar, V., 2015. Valproate attenuates the proteinuria, podocyte and renal injury by facilitating autophagy and inactivation of NF-κB/iNOS signaling in diabetic rat. Biochimie 110, 1–16.
Kim, K.-S., Yang, H.J., Lee, I.-S., Kim, K.-H., Park, J., Jeong, H.-S., Kim, Y., Ahn, K.S., Na, Y.-C., Jang, H.-J., 2015. The aglycone of ginsenoside Rg3 enables glucagon-like peptide-1 secretion in enteroendocrine cells and alleviates hyperglycemia in type 2 diabetic mice. Sci. Rep. 5, 18325.
Kolavennu, V., Zeng, L., Peng, H., Wang, Y., Danesh, F.R., 2008. Targeting of RhoA/ROCK signaling ameliorates progression of diabetic nephropathy independent of glucose control. Diabetes 57, 714–723.
Komers, R., 2013. Rho kinase inhibition in diabetic kidney disease. Br. J. Clin. Pharmacol.
76, 551–559.
Komers, R., Oyama, T.T., Beard, D.R., Tikellis, C., Xu, B., Lotspeich, D.F., Anderson, S., 2011. Rho kinase inhibition protects kidneys from diabetic nephropathy without reducing blood pressure. Kidney Int. 79, 432–442.
Lan, H., Lin, H., Wang, C., Wright, M., Xu, S., Kang, L., Juhl, K., Hedrick, J., Kowalski, T., 2012. Agonists at GPR119 mediate secretion of GLP‐1 from mouse enteroendocrine cells through glucose‐independent pathways. Br. J. Pharmacol. 165, 2799–2807.
Lee, C.-F., Yang, J.S., Tsai, F.-J., Chiang, N.-N., Lu, C.C., Huang, Y.-S., Chen, C., Chen, F.- A., 2016. Kaempferol induces ATM/p53-mediated death receptor and mitochondrial apoptosis in human umbilical vein endothelial cells. Int. J. Oncol. 48, 2007–2014.
Lee, Y.-S., Shin, S., Shigihara, T., Hahm, E., Liu, M.-J., Han, J., Yoon, J.-W., Jun, H.-S., 2007. Glucagon-like peptide-1 gene therapy in obese diabetic mice results in long- term cure of diabetes by improving insulin sensitivity and reducing hepatic gluco- neogenesis. Diabetes 56, 1671–1679.
Li, D., Chen, S., Bellomo, E.A., Tarasov, A.I., Kaut, C., Rutter, G.A., Li, W.-h., 2011.
Imaging dynamic insulin release using a fluorescent zinc indicator for monitoring induced exocytotic release (ZIMIR). Proc. Natl. Acad. Sci. 108, 21063–21068.
Liu, C., Zhang, M., Hu, M.-y., Guo, H.-f., Li, J., Yu, Y.-l., Jin, S., Wang, X.-t., Liu, L., Liu, X.- d., 2013. Increased glucagon-like peptide-1 secretion may be involved in anti-dia- betic effects of ginsenosides. J. Endocrinol JOE-12-0502.
Maki, T., Maeno, S., Maeda, Y., Yamato, M., Sonoda, N., Ogawa, Y., Wakisaka, M., Inoguchi, T., 2019. Amelioration of diabetic nephropathy by SGLT2 inhibitors in- dependent of its glucose-lowering effect: a possible role of SGLT2 in mesangial cells.
Sci. Rep. 9, 1–8.
Mann, J.F., Ørsted, D.D., Brown-Frandsen, K., Marso, S.P., Poulter, N.R., Rasmussen, S., Tornøe, K., Zinman, B., Buse, J.B., 2017. Liraglutide and renal outcomes in type 2 diabetes. N. Engl. J. Med. 377, 839–848.
Marso, S.P., Bain, S.C., Consoli, A., Eliaschewitz, F.G., Jódar, E., Leiter, L.A., Lingvay, I., Rosenstock, J., Seufert, J., Warren, M.L., 2016a. Semaglutide and cardiovascular outcomes in patients with type 2 diabetes. N. Engl. J. Med. 375, 1834–1844.
Marso, S.P., Daniels, G.H., Brown-Frandsen, K., Kristensen, P., Mann, J.F., Nauck, M.A., Nissen, S.E., Pocock, S., Poulter, N.R., Ravn, L.S., 2016b. Liraglutide and cardiovas- cular outcomes in type 2 diabetes. N. Engl. J. Med. 375, 311–322.
Mason, R.M., Wahab, N.A., 2003. Extracellular matrix metabolism in diabetic nephro- pathy. J. Am. Soc. Nephrol. 14, 1358–1373.
Neal, B., Perkovic, V., Mahaffey, K.W., De Zeeuw, D., Fulcher, G., Erondu, N., Shaw, W., Law, G., Desai, M., Matthews, D.R., 2017. Canagliflozin and cardiovascular and renal events in type 2 diabetes. N. Engl. J. Med. 377, 644–657.
Nguyen, D.V., Shaw, L., Grant, M., 2012. Inflammation in the pathogenesis of micro- vascular complications in diabetes. Front. Endocrinol. 3, 170.
Peng, F., Wu, D., Gao, B., Ingram, A.J., Zhang, B., Chorneyko, K., McKenzie, R., Krepinsky, J.C., 2008. RhoA/Rho-kinase contribute to the pathogenesis of diabetic renal disease. Diabetes.
Qing-Hua, G., Ju-Ming, L., Chang-Yu, P., Zhao-Hui, L., Xiao-Man, Z., Yi-Ming, M., 2008.
The kidney expression of matrix metalloproteinase-9 in the diabetic nephropathy of Kkay mice. J. Diabetes Compl. 22, 408–412.
Rao, J., Ye, Z., Tang, H., Wang, C., Peng, H., Lai, W., Li, Y., Huang, W., Lou, T., 2017. The RhoA/ROCK pathway ameliorates adhesion and inflammatory infiltration induced by AGEs in glomerular endothelial cells. Sci. Rep. 7, 39727.
Reimann, F., Gribble, F.M., 2002. Glucose-sensing in glucagon-like peptide-1-secreting cells. Diabetes 51, 2757–2763.
Reimann, F., Ward, P.S., Gribble, F.M., 2006. Signaling mechanisms underlying the re- lease of glucagon-like peptide 1. Diabetes 55, S78–S85.
Sharma, D., Gondaliya, P., Tiwari, V., Kalia, K., 2019. Kaempferol attenuates diabetic nephropathy by inhibiting RhoA/Rho-kinase mediated inflammatory signalling.
Biomed. Pharmacother. 109, 1610–1619.
Sharma, D., Singh, J.N., Sharma, S.S., 2016. Effects of 4-phenyl butyric acid on high glucose-induced alterations in dorsal root ganglion neurons. Neurosci. Lett. 635, 83–89.
Sharma, D., Verma, S., Vaidya, S., Kalia, K., Tiwari, V., 2018a. Recent updates on GLP-1 agonists: current advancements & challenges. Biomed. Pharmacother. 108, 952–962.
Sharma, K., Sharma, D., Sharma, M., Sharma, N., Bidve, P., Prajapati, N., Kalia, K., Tiwari, V., 2018b. Astaxanthin ameliorates behavioral and biochemical alterations in in-vitro and in-vivo model of neuropathic pain. Neurosci. Lett. 674, 162–170.
Simms, D., Cizdziel, P.E., Chomczynski, P., 1993. TRIzol: A new reagent for optimal single-step isolation of RNA. Focus 15, 532–535.