Efficacy of an Oral Suspension Containing Xyloglucan and Pea Proteins on a Murine Model of Gastroesophageal Reflux Disease

(1)

R E S E A R C H A R T I C L E

Efficacy of an oral suspension containing xyloglucan and pea proteins on a murine model of gastroesophageal reflux disease

Alessio Ardizzone | Deborah Mannino | Giovanna Casili | Michela Campolo | Irene Paterniti | Marika Lanza | Alessia Filippone | Alberto Repici |

Valentina Bova | Anna Paola Capra | Salvatore Cuzzocrea | Emanuela Esposito

Department of Chemical, Biological, Pharmaceutical and Environmental Sciences, University of Messina, Messina, Italy

Correspondence

Emanuela Esposito, Department of Chemical, Biological, Pharmaceutical and Environmental Sciences. University of Messina, Viale Ferdinando Stagno D'Alcontres, 31, 98166 Messina, Italy.

Email:[email protected]

Abstract

Gastroesophageal reflux disease (GERD) is the most common foregut disease, affect- ing about 20% of the adult population. Esophageal epithelial barrier plays a funda- mental role in the pathophysiology of GERD; however, pharmacological therapies mainly aim to reduce the acidity of the gastroesophageal environment rather than to protect esophageal tissue integrity. This study aims to evaluate the efficacy of an oral solution containing xyloglucan and pea proteins (XP) in reestablishing gastroesopha- geal tissue integrity and biochemical markers. To induce GERD, C57BL/6 mice were alternatively overfed and fasted for 56 days and then treated with XP, sodium algi- nate, omeprazole, or omeprazole

+

XP twice daily for 7 days. Gastric pain and inflam- matory markers were evaluated after 3 and 7 days of treatment. After sacrifice, the esophagi and stomachs were surgically removed for macroscopic and histological examination. Gastric pain was significantly reduced at days 3 and 7 by XP, omepra- zole, and omeprazole

+

XP, while alginates were ineffective at day 3. XP was able to diminish gastric macroscopic damage and demonstrated the same efficacy as omep- razole in reducing esophageal damage. XP significantly reduced histological damage, with an efficacy comparable to that of omeprazole, but superior to alginates. Inflam- matory markers were significantly reduced by XP, with superior efficacy compared with alginates at day 7. Interestingly, XP was also able to significantly increase gastric pH. This study demonstrated that XP restored gastric homeostasis, improved esopha- geal integrity, and decreased inflammation and pain with a similar efficacy to omepra- zole and greater than alginates.

K E Y W O R D S

esophageal epithelial barrier, gastroesophageal reflux disease (GERD), pea protein, xyloglucan

Abbreviations:GERD, gastroesophageal reflux disease; IL, Interleukin; iNOS, inducible nitric oxide synthase; LES, lower esophageal sphincter; LPR, laryngopharyngeal reflux.; PAF, platelet- activating factor; PP, pea protein; PPIs, proton pump inhibitors; ROS, reactive oxygen species; TNF-α, tumor necrosis factor-α; XG, xyloglucan; XP, xyloglucan and pea proteins.

This is an open access article under the terms of theCreative Commons Attribution-NonCommercial-NoDerivsLicense, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.

1610 wileyonlinelibrary.com/journal/ptr Phytotherapy Research.2024;38:1610–1622.

(2)

1 | I N T R O D U C T I O N

Gastroesophageal reflux disease (GERD) is one of the most diagnosed pathologies of the upper gastrointestinal tract and is characterized by the presence of symptoms deriving from an abnormal ascent of gastric contents into the esophagus (Fuchs et al.,2014). GERD symptomatology include heartburn and regurgitation of liquids or food, but patients can also present extraesophageal manifestations like cough, laryngopharyngeal inflammation, swallowing dysfunction, anginal-like chest, and epigastric pain (Gyawali et al.,2023). Approximately 20%

of adults in Western countriesare affected by GERD, with a higher prevalence in females, and a growing incidence due to changes in die- tary lifestyle in industrialized countries (Nirwan et al.,2020).

Although GERD etiopathogenesis is not fully understood, several risk factors, like impairment in the tone of the lower esophageal sphincter (LES), have been identified in the development of defective esophageal clearance and impaired anterograde flow of gastric contents (Sharma & Yadlapati,2021). Moreover, mucosal hypersensitivity seems to be associated with the upregulation of peripheral nociceptors, prolonged esophageal contractions due to psychological and genetic factors, and especially, with structural alterations of the esophageal epithelial barrier (Herregods et al.,2015; Hsu et al.,2015). In this context, in GERD patients, acid reflux impairs esophageal barrier function facilitating the activation of gastroesophageal nociceptors, leading to abdominal epigastric pain and pathological clinical manifestations (Tack & Pandolfino,2018). Although first-line GERD treatments such as proton pump inhibitors (PPIs) and alginates have shown to be very effective in reducing gastric hyperacidity and impeding acid refluxate to reach the esophagus, respectively, they partially fail to restore esophageal mucosa integrity (van Rhijn et al.,2014). These results confirmed that factors other than acidity are implicated in the progression of the disease, providing an explanation as to why some patients exhibit PPI refractoriness, despite months of therapy (Cicala et al.,2013). There- fore, the restoration of the esophageal epithelial barrier might represent a successful therapeutic strategy to reduce GERD features and prevent the manifestation of chronic states.

Nowadays, non-pharmacological treatment options have proven to be of great support to traditional therapy, effectively managing the symptoms of various gastrointestinal disorders (Alecci et al.,2016). For instance, myrtle seeds protect the stomach mucosa by acting as an anti- ulcer agent, reducing morphological and histological damage, lowering oxidative stress, and enhancing the antioxidant defense system (Giampieri et al.,2020). Similarly, aloe vera is well-known for its healing properties in treating mucosal injury and revealed to be a valuable therapeutic agent in GERD (Panahi et al.,2015). As well, plant-derived compounds such as xyloglucan and pea proteins have gained interest thanks to their protective effects over the gastrointestinal tract and their optimal safety profile. Xyloglucan (XG) is a polysaccharide found in the seeds of the tamarind tree (Tamarindus indica). Since it is present in the primary cell walls of all vascular plants, it constitutes a natural part of the human diet and it was approved by the FDA as a food addi- tive and as an excipient for drug delivery (Dutta et al.,2020). The chemical structure of this polysaccharide with mucoadhesive and

mucoprotective properties could therefore be potentially useful for various human pathologies (Pique et al.,2018). Pea protein (PP) derived from thePisum sativum plant is an important source of high-quality plant proteins that exert emollient and soothing actions in the digestive tract thanks to its high fiber content (Ge et al.,2020). We previously demonstrated that XG and PP exert a synergistic effect in restoring the integrity of mucosal tissues by creating a mechanical barrier over the epithelia of the target tissues. In fact, XG and PP were able to preserve the integrity of tight junctions proteins such as Zonula Occludens-1 (ZO-1) and occludin thus enhance the barrier integrity of intestinal mucosae in different preclinical models of gastrointestinal symptoms (Filippone et al.,2022; Scuderi et al.,2022). Moreover, these ingredi- ents proved to be effective for the management of skin pathologies while preserving the physiological integrity and function of the skin barrier (Campolo et al.,2020; Filippone et al.,2023). Considering the beneficial effects shown by these natural compounds, this study aims to evaluate the efficacy of XP in restoring gastroesophageal homeostasis in a mouse model of GERD induced by alternated fasting and overeating. Furthermore, the ability of XP to counteract acid reflux was compared with that of alginates and PPIs.

2 | M E T H O D S 2.1 | Materials

All compounds were obtained from Sigma–Aldrich (Milan, Italy), and all the chemicals were of the highest commercial grade. All stock solu- tions were prepared in non-pyrogenic saline (0.9% NaCl; Baxter, Liver- pool, UK). The oral solution containing xyloglucan and pea protein was kindly provided by DEVINTEC SAGL (Lugano, Switzerland).

2.2 | Experimental design

C57BL/6 female mice (5 weeks; 20–25 g; Envigo, Italy) were housed in a controlled environment (22 ± 2C, 55 ± 15% relative humidity, 12 h light/dark cycle). After one-week acclimatization, mice were fed with a standard diet and water. Animal experiments were conducted in compliance with Italian regulations on the protection of animals used for experimental and other scientific purposes (D.Lgs 2014/26) and EU regulations (EU Directive 2010/63). The animals used for this study were selected from those available at that time.

To induce GERD, mice were alternatively fed and fasted for 56 consecutive days (Im et al.,2021). After GERD establishment, the oral treatments were administered twice daily for 7 days. Sodium alginate 250 mg/kg and omeprazole 20 mg/kg doses were chosen according to previous scientific studies (Costa et al.,2020; Yamamoto et al., 2014). For XP administration, the dose was converted from human use based on mouse body surface formulation (Nair &

Jacob, 2016) (mouse dose: 2 mL/kg containing 53 mg of PP and 27 mg of XG). Mice were sacrificed on day 7 after oral administrations. Esophagi and stomachs were surgically removed and evaluated

(3)

macroscopically. Subsequently, the esophagus was embedded in paraffin and used for histological examinations. Moreover, blood and other biological fluids were collected for further biochemical analyses.

Mice were randomly divided into the following experimental groups:

Group 1 Sham+vehicle: healthy mice treated with vehicle (saline) twice daily, for seven consecutive days (N=10).

Group 2 Sham+XP: healthy mice treated with XP twice daily, for seven consecutive days (N=10).

Group 3 Sham+Sodium Alginate: healthy mice treated with sodium alginate twice daily, for seven consecutive days (N=10).

Group 4 Sham+Omeprazole: healthy mice treated with omeprazole, twice daily, for seven consecutive days (N=10).

Group 5 GERD+vehicle: mice with GERD treated with vehicle (saline) for seven consecutive days (N=10).

Group 6 GERD+XP: mice with GERD treated with XP twice daily, for seven consecutive days (N=10).

Group 7 GERD+Sodium Alginate: mice with GERD treated with sodium alginate twice daily, for seven consecutive days (N=10).

Group 8 GERD+Omeprazole: mice with GERD treated with omeprazole twice daily, for seven consecutive days (N=10).

Group 9 GERD+Omeprazole+XP: mice with GERD treated with omeprazole plus XP, twice daily, for seven consecutive days (N=10).

2.3 | Assessment of epigastric pain by using von Frey method

Epigastric pain was determined by calibrated von Frey hairs (Ardizzone et al., 2023) that allowed the detection of a mechanical stimulus–response as a sign of hyperalgesia related to GERD. The mechanical threshold (expressed in grams) corresponding to the pres- sure that stimulated a behavioral reaction (withdrawal of the abdo- men) was recorded automatically by the electronic device. The stimulation was applied three times, and the mean value was calculated as the mechanical threshold for each mouse. Briefly, mice were allowed to acclimate to behavioral chambers for 15 min prior to measuring the mechanical abdominal withdrawal thresholds (AWT, expressed in grams) using an electronic Von Frey test (dynamic plantar aesthesiometer, model 37,450; Ugo Basile, Italy) with the cutoff set at 50 g. Mechano-allodynia was defined by a significant (p< 0.05) reduction in mechanical mean absolute AWT (g) (Campolo, Lanza, et al.,2021). Abdominal pain was assessed at the beginning of the GERD induction (day 0), after GERD establishment (day 56), on day 3 of treatment (day 59), and at the end of the experiment (day 63).

2.4 | Macroscopic evaluation and histological analyses

After sacrifice, macroscopical assessment of stomachs was performed using the following scale score: 0=No macroscopical

alteration of the stomach; 1=slight distension and engorgement of the stomach; 2=mild distension and engorgement of the stomach; 3=severe distension and engorgement of the stomach. Like- wise, at the end of the experiment, macroscopical damage of esophagi was measured using the following scale score: 0=no macroscopical alteration of the esophagus; 1=slight discoloration of the esophagus; 2=mild discoloration of the esophagus;

3=severe discoloration of the esophagus. After macroscopic analysis, esophagi were prepared for histological evaluation.

Briefly, esophagi were fixed with 10% paraformaldehyde, then embedded in paraffin for sectioning into 7-μm-thick slices for microscopic analyses as previously indicated (Campolo, Casili, et al.,2021). The paraffin was removed using xylol and then pro- gressive hydration was induced using a decreasing scale of alcohol (100%, 95%, 70%, 50%). Then, histological staining was performed via Hematoxylin and Eosin (H/E) (H&E, Bio-Optica, Milan, Italy) to highlight any morphological changes. Finally, the sections were progressively dehydrated and mounted with coverslips. All sections were examined using a Nikon Eclipse Ci-L microscope. The results of the histological evaluations were displayed at 20mag- nification (50μm scale bar).

2.5 | Immunohistochemical analyses of GERD biomarkers

At the end of the experiment, the presence of GERD markers in the esophageal tissues, specifically iNOS and substance P, was investigated by immunohistochemistry. Paraffin-embedded tissue samples were sectioned (7μm), deparaffinized, and processed following the immunohistochemical protocol previously reported (Campolo et al., 2020). The sections were incubated overnight at 4C with inducible nitric oxide synthase (iNOS) antibody (1:200, Invitrogen, Cal- ifornia, USA) or substance P antibody (1:200, Abcam, Cambridge, UK), and were incubated with secondary antibody (Vector Laboratories).

Then, antigen–antibody complexes were detected using an avidin– biotin complex detection system (Vectastain ABC Kit, Vector Labora- tories) and a 3,3⁰-diaminobenzidine (DAB) Substrate Kit (Vector Labo- ratories). After counterstaining with Nuclear Fast Red, sections were analyzed using a Nikon Eclipse Ci-L microscope, figures are shown at 20.

2.6 | Assessment of the antiacid properties

At the end of the experiment, gastric secretions were collected using gastric lavage according to Crowe et al. (Crowe & Kinsey, 2017).

Briefly, after sacrifice, the stomach was clamped at the lower esophageal sphincter and at the pyloric region to prevent stomach empty- ing, and 200μL of normal saline was injected into the stomach. The stomach was then removed, and its contents were collected in a test tube. Samples were centrifuged for 7 min at 13,000g, and the

(4)

supernatant was aliquoted and assessed for pH using a pH microelectrode.

2.7 | Evaluations on laryngopharyngeal reflux

A laryngopharyngeal lavage was performed three times via the tra- cheal tube with a total volume of 0.7 mL of phosphate-buffered saline (PBS; Thermo Fisher Scientific, Waltham, MA, USA). Using Wright's Giemsa stain (Nanjing Jiancheng, Nanjing, China), neutrophils and macrophages present in the laryngopharyngeal lavage were counted. Briefly, the cell smear was stained with Wright-Giemsa solution for 1–2 min, and rapidly dipped in PBS for 5 min, then rinsed with running distilled water for 30 min to decolor, and finally air-dried (Peritore et al.,2021). Differential cell counting was performed on each slide.

Total RNA was isolated from esophageal mucosal tissue for quan- titative reverse transcription PCR (RT-qPCR) analysis using a Trizol Reagent Kit (Life Technologies, Monza, Italy). The first strand of cDNA was synthesized from 2.0μg total RNA using a high-capacity cDNA Archive kit (Applied Biosystems, Carlsbad, CA, USA). β-actin mRNA was used as an endogenous sham to allow for the relative quantification. RT-qPCR was made for the evaluation of Mucin 5 AC (MUC5AC) gene expression (5⁰CCAGCACCATCTCTACAACCC 3⁰and 3⁰ GCAAAGCTCCTGTTTGCACTC 5⁰) using Power Up Sybr Master Mix (Applied Biosystems, Carlsbad, CA, USA) and a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA) (Lanza et al.,2021). The amplified PCR products were quantified by measuring the calculated cycle thresholds (CT) of target genes and β-actin mRNA. After normalization, the mean value of the normal sham target levels was chosen as the calibrator and the results were expressed according to the 2^ΔΔCtmethod as a fold change relative to normal shams.

2.8 | Evaluations of inflammatory markers

The quantifications of cytokines such as interleukin (IL)-8, IL-1β, IL-6, tumor necrosis factor (TNF)-α, IL-10, IL-4 as well as platelet-activating factor (PAF) and reactive oxygen species (ROS) were measured in the serum after GERD establishment (day 56), after 3 days of treatment (day 59), and after 7 days of treatment (day 63). Enzyme-linked immu- nosorbent assay (ELISA) kits were used according to the manufac- turer's instructions.

2.9 | Statical analysis

Experimental data are expressed as mean ± standard deviation (SD) of N observations, in which N represents the number of animals studied.

Data analysis was performed with one-way and two-way ANOVA fol- lowed by a Bonferroni post-hoc test for multiple comparisons. Only a p-value less than 0.05 was considered significant.

3 | R E S U L T S

3.1 | Efficacy of XP administration on epigastric pain induced by GERD

Effects of XP on gastric pain associated with gastroesophageal reflux were evaluated by applying von Frey filaments in the epigastric region of each mouse and detecting the mechanical stimulus– response. At day 0 (start of GERD induction), no significant differences were found among the experimental groups (Figure1, day 0).

By contrast, at day 56 (GERD establishment), a significant decrease in withdrawal threshold values was observed in all GERD-induced mice compared with the Sham groups (***p< 0.001) (Figure1, day 56), indicating epigastric hypersensitivity. Following 3 days of oral treatments (day 59), XP (# p< 0.05), omeprazole alone (###

p< 0.001) and in combination with XP (###p< 0.001) were able to notably reduce epigastric hyperalgesia compared with vehicles (Figure1, day 59), while a three-day treatment with sodium alginate did not reach any significant result (Figure 1, day 59). However, 7 days after oral administrations (day 63), all compounds were able to considerably improve pain in the epigastric region compared with the GERD+vehicle group (###p< 0.001) (Figure1, day 63). Interest- ingly, XP-treated mice reached values statistically comparable to that of omeprazole (Figure1, day 63).

3.2 | Efficacy of XP administration in reducing macroscopical and histopathological damage induced by GERD

At the end of the experiment (day 63), the macroscopical appearance of the stomachs and esophagi was examined in all experimental groups. The stomachs of the GERD+vehicle group were more distended and engorged compared with the Sham groups, highlighting a severe macroscopic damage (***p< 0.001) (Supplementary Figure1, macroscopic score 2A). However, XP administration considerably moderated stomach enlargement (##p< 0.01) compared with GERD +vehicle animals (Supplementary Figure1, macroscopic score 2A).

Likewise, sodium alginate 250 mg/kg treatment was able to slightly reduce macroscopical damage (# p< 0.05) (Supplementary Figure1, macroscopic score 2A). Oral administrations of omeprazole as well as the co-administration of omeprazole and XP significantly reduced gastric distension (###p< 0.001) (Supplementary Figure1, macroscopic score 2A). The ascent of stomach contents into the gastroesophageal tract is a characteristic feature of GERD; this process triggers severe esophageal damage due to the corrosive action of gastric juices (Oh et al.,2006). According to this, the macroscopical evaluation of esophagi revealed a high grade of tissue discoloration in GERD+vehicle mice compared with the Sham groups (***p< 0.001) (Supplementary Figure2, macroscopic score 2B). Sodium alginate administration for 7 days reduced esophageal damage (# p< 0.05) (Supplementary Figure2, macroscopic score 2B). Oral treatments with XP, omeprazole, and their combination showed comparable efficacy in

(5)

diminishing the degree of esophageal discoloration caused by gastric reflux (### p< 0.001) (Supplementary Figure 2, macroscopic score 2B). H/E staining was performed to examine the histopathological alterations in the esophageal tissues of each experimental group following overeating-induced GERD. Samples from GERD+vehicle mice showed altered tissue architecture accompanied by inflammatory cell infiltration and the exfoliation of keratin layers in the lower esophageal epithelium (Figure2g, histological score 2 L) compared with the Sham animals (*** p< 0.001) (Figure 2c–f, histological score 2 L).

Alternatively, following 7 days of XP oral treatment, a significant ame- lioration of tissue integrity associated with a reduction in neutrophil infiltration was observed (###p< 0.001) (Figure2h, see histological score 2 L); XP efficacy was comparable to that of omeprazole alone and in combination with XP (###p< 0.001) (Figure2j,k, respectively, histological score 2 L). The histomorphological alterations induced by GERD were also slightly reversed after sodium alginate administration (#p< 0.05) (Figure2i, histological score 2 L). Interestingly, XP showed a statistically significant superiority in reducing histological damage compared to alginate (p< 0.001).

3.3 | Efficacy of XP administration in restoring gastric pH and esophageal mucus secretion impaired by GERD

Gastric secretions changes were evaluated by using a pH microelectrode. Gastric secretions from the GERD+vehicle group revealed a

significant decrease in pH values compared with the Sham groups (***

p< 0.001) (Figure3a). Following XP (##p< 0.01) and sodium alginate (#p< 0.05) treatments, an increase in the pH values of gastric secretions was observed, which was even more marked following omeprazole and omeprazole plus XP (###p< 0.001) (Figure3a). Moreover, MUC5AC expression, a reliable marker of mucus production in esophageal mucosa samples, was analyzed.

RT-qPCR analysis highlighted a marked increase in MUC5AC content after overeating-induced GERD compared with Sham groups (***

p< 0.001) (Figure 3b). MUC5AC overexpression in the esophageal mucosa was significantly decreased by XP treatment (###p< 0.001) (Figure3b) and alginate treatment (##p< 0.01) (Figure3b). Notably, omeprazole alone and in co-administration with XP was able to decrease MUC5AC expression with a superior efficacy compared with XP and alginate treatments (###p< 0.001) (Figure3b).

3.4 | Efficacy of XP administration to manage extraesophageal symptoms caused by GERD

GERD patients often experience extraesophageal symptoms caused by the retrograde flow of gastric contents into proximal organs such as the larynx (Lai et al.,2008). Chronic laryngeal signs and symptoms associated with GERD are often referred to as reflux laryngitis, which in the long-term may compromise epithelial restoration favor- ing the infiltration of inflammatory cells (Lai et al.,2008). Here, the infiltration of neutrophils and macrophages populations in the F I G U R E 1 Evaluation of epigastric pain by using von Frey stimulation. After 56 days of alternated overeating and fasting, a notable increase in gastric hyperalgesia was found in all GERD groups. After 3 days of treatment (day 59), XP, omeprazole, and omeprazole+XP favorably increased the withdrawal threshold, while sodium alginate was ineffective. Notably, after 7 days (day 63), all compounds significantly decreased abdominal hypersensitivity. Two-way ANOVA test. ***p< 0.001 versus Sham+vehicle; #p< 0.05 versus GERD+vehicle; ###p< 0.001 versus GERD+vehicle;

++p< 0.01 versus GERD+XP;p< 0.05 versus GERD+Sodium Alginate 250 mg/kg;p< 0.001 versus GERD+Sodium Alginate 250 mg/kg.

(6)

laryngopharyngeal lavage was assessed through Giemsa staining. At GERD establishment, a significant rise in neutrophils and macrophages numbers in GERD+vehicle laryngopharyngeal lavages was observed compared with the Sham groups (*** p< 0.001) (Figure4a,b). Following XP administration, a considerable decrease in neutrophils and macrophages in the laryngopharyngeal lavage was detected, suggesting that the beneficial effect of XP in the gastric environment decreased the presence of acid reflux in the upper air- ways (## p< 0.01) (Figure 4a,b). Similar results were obtained following sodium alginate administration (## p< 0.01) (Figure 4a,b).

However, the reduction of immune cells was considerably more effective in the omeprazole and in omeprazole plus XP-treated mice (###p< 0.001) (Figure4a,b).

3.5 | Evaluation of serum inflammatory markers following overeating-induced GERD

3.5.1 | Efficacy of XP in decreasing serum cytokines overexpression caused by GERD

Several proinflammatory mediators such as cytokines have been shown to be involved in the development of GERD: TNF-α, IL-1β, IL-6, IL-8, IL-10, and IL-4. Here, this panel of cytokines was quantified in serum, during the establishment of GERD (day 56) as well as after 3 and 7 days of treatment (days 59 and 63 respectively). At day 56, ELISA revealed a considerable increase in all cytokines in the GERD groups compared with the Sham groups F I G U R E 2 Macroscopical and histological examinations. Macroscopic score of stomachs (a) and esophagi (b) GERD+vehicle samples showed a considerable enlargement of stomach compared with sham groups. XP treatment and sodium alginate decreased gastric macroscopical alteration. Omeprazole alone and in combination with XP greatly decreased distension and engorgement of the stomach (A). Overeating-induced GERD caused a severe discoloration of esophagi compared with sham groups, which was partially reversed by sodium alginate. XP, omeprazole, and omeprazole+XP reduced esophageal damage with comparable efficacy (B). Microscopically, a considerable alteration of the morphological structure of the esophagus was detected in the GERD+vehicle group (G, L) compared with the Sham groups (C–F, L). Following sodium alginate administration, a slight improvement in the esophageal architecture as well as a reduction of neutrophils was observed (I, L). Treatments with XP, omeprazole (H, J, L), and omeprazole+XP (K, L) had similar efficacy in reversing morphological alterations and neutrophilic infiltration induced by GERD, with a superior efficacy compared with sodium alginate 250 mg/kg. One-way ANOVA test. ***p< 0.001 versus Sham+vehicle; #p< 0.05 versus GERD+vehicle; ###p< 0.001 versus GERD+vehicle;p< 0.001 versus GERD+Sodium Alginate 250 mg/kg.

(7)

F I G U R E 3 Evaluation of gastric pH and MUC5AC expression. GERD induction lowered gastric pH compared with the Sham groups (a). XP treatment considerably increased pH values, improving gastric conditions (a). Omeprazole and omeprazole+XP significantly increased the levels of gastric pH, almost restoring the physiological conditions (a). An increase in MUC5AC levels was observed in the GERD+vehicle group compared with Sham groups (b). Sodium alginate and XP considerably reduced MUC5AC level (b). Omeprazole alone or in combination with XP was significantly superior to the other treatments in reducing MUC5A expression (b). One-way ANOVA test. ***p< 0.001 versus Sham+vehicle;

#p< 0.05 versus GERD+vehicle; ##p< 0.01 versus GERD+vehicle; ###p< 0.001 versus GERD+vehicle;++p< 0.01 versus GERD+XP;+++

p< 0.001 versus GERD+XP;p< 0.001 versus GERD+Sodium Alginate 250 mg/kg.

F I G U R E 4 Assessment of inflammatory cells in laryngopharyngeal lavage. A considerable increase in both neutrophils and macrophages was detected in GERD mice compared with Sham animals (a, b). XP and sodium alginate administrations equally decreased immune cells population in the laryngopharyngeal lavage (a, b). A strong but overlapped reduction of inflammatory cells was estimated in laryngopharyngeal lavages of omeprazole and omeprazole+XP groups (a, b). One-way ANOVA test.

***p< 0.001 versus Sham+vehicle; ##

p< 0.01 versus GERD+vehicle; ###

p< 0.001 versus GERD+vehicle;+++

p< 0.001 versus GERD+XP;

p< 0.001 versus GERD+Sodium Alginate 250 mg/kg.

(8)

(*** p< 0.001) (Supplementary Figures3 and4); these data confirmed the induction of an important inflammatory response caused by gastroesophageal reflux. Following 3 days of oral treatments (day 59), all inflammatory markers were significantly reduced following XP administration (# p< 0.05) (Supplementary Figures 3and4). However, omeprazole alone and in combination with XP were able to further reduce inflammatory markers already at day 3 (###p< 0.001) (Supplementary Figures3and4).

On the contrary, alginate treatment was able to reduce levels of TNF-α, IL-1β, and IL-6 (# p< 0.05) but not IL-8, IL-10, and IL-4 levels after 3 days (Supplementary Figures 3and 4). Seven days of treatment (day 63) with XP led to a further decrease in serum titers of all inflammatory markers (###p< 0.001), (Supplementary Figures 3 and 4). At day 7, XP was significantly superior to sodium alginate in reducing the levels of all cytokines analyzed (p< 0.001).

3.5.2 | Efficacy of XP in reducing PAF and ROS levels induced by GERD

During GERD, a release of several mediators from epithelial cells is observed, among these, platelet-activating factor (PAF) and reactive oxygen species (ROS) have been shown to contribute to the worsening of esophageal epithelial injury (Paterson et al., 2007; Rieder et al.,2010).

At day 56, concordant results were obtained from the analyses of PAF and ROS levels, highlighting a significant upregulation of inflammation and oxidative stress in all GERD groups (*** p< 0.001) (Supplementary Figure5). After 3 days of treatments, data showed an appreciable attenuation of PAF and ROS in the serum of XP and sodium alginate-treated mice (# p< 0.05) (Supplementary Figure5).

Nevertheless, omeprazole and omeprazole+XP groups effectively decreased PAF and ROS presence (### p< 0.001) (Supplementary Figure5).

Interestingly, 7 days of XP and omeprazole, alone or in combination with XP, further decreased serum PAF and ROS levels (###

p< 0.001), all with a superior efficacy compared with sodium alginate (p< 0.001) (Supplementary Figure5).

3.5.3 | Efficacy of XP in lessening GERD-specific markers in the esophagus

The overexpression of iNOS and substance P has been previously reported in inflamed esophageal tissue (Im et al., 2021). Here, the effects of XP on iNOS and substance P expression in the esophageal epithelium were evaluated by immunohistochemical staining. Our results confirmed a significantly increased positive staining of iNOS and substance P in the esophageal tissues following GERD establishment (*** p< 0.001) (Figure5e, score 5 J and Figure6e, score 6 J)

compared with Sham groups (Figure5a–d, score 5 J and Figure6a–d, score 6 J). Immunoreactivity to iNOS and substance P was favorably decreased after 7 days of treatments with sodium alginate (##

p< 0.01) (Figure5g, score 5 J and Figure6g, score 6 J) and XP (##

p< 0.01) (Figure5f, score 5 J and Figure 6f, score 6 J). However, a most valuable decrease in both iNOS and substance P expressions was obtained following omeprazole 20 mg/kg (### p< 0.001) (Figure5h, score 5 J and Figure6h, score 6 J) and XP+omeprazole (###p< 0.001) (Figure5i, score 5 J and Figure6i, score 6 J).

4 | D I S C U S S I O N

Currently, PPIs are the mainstay treatment in the therapeutic regimen of GERD patients (Jaynes & Kumar,2019). Although effective in con- trolling gastric acidity, the long-term use of PPIs may cause several side effects leading to vitamin B12, magnesium and calcium deficien- cies, increasing the risk of osteoporosis and bone fractures (Jaynes &

Kumar,2019). Similarly, alginate salts appear to be a safe option to mitigate GERD symptomatology. These compounds have the ability to interact with the stomach acids, forming a protective raft over the gastric content that impede the refluxate to reach the esophagus (Leiman et al.,2017). However, there is currently a lack of robust data demonstrating how these substances can exert a direct protective action towards the esophageal mucosa (Smart & Atkinson, 1990).

Thereby, in recent years, new interest has been given to natural mucoprotectors as therapeutic agents able to restore the esophageal mucosal integrity in order to prolong remission periods and delay relapses often experienced by GERD patients, also after PPI withdrawal (Helgadottir & Bjornsson,2019).

Particularly, in this study, our attention focused on the advanta- geous features of two natural compounds, XG and PP, which are well- known to be food-grade components with a good safety profile (Garcia Arteaga et al.,2021; Pique et al.,2018). In this regard, XG and PP, due to their mucoprotective qualities, might represent promising therapeutic agents able to create a protective layer on mucosae and promote the restoration of compromised gastroesophageal tissues (Garcia Arteaga et al.,2021; Pique et al.,2018).

Here we investigated the beneficial effect of XP, in comparison with PPI and alginates, in a non-surgical animal model of GERD.

Epigastric pain is a common symptom experienced by GERD patients, representing one of the major challenges in today's gastroenterology practice (Lukic et al.,2022). Gastric discomfort occurs mostly after a meal and lasts for hours, often with a negative impact on the quality of sleep and consequently affecting the daily activities of patients (Lukic et al.,2022).

In this in vivo model of GERD, induction of the disease led to a substantial epigastric hypersensitivity, resulting in excessive abdominal pain and responsiveness. Nevertheless, XP oral administration significantly counteracted the increase of gastric sensitivity caused by GERD establishment, highlighting the rapid symptom relief capacity of

(9)

this compound already after 3 days of treatment, and more consis- tently after 7 days, demonstrating a comparable efficacy to omeprazole.

From this result, we could hypothesize that XP reduces epigastric pain thanks to its barrier mechanism, which prevents prolonged con- tact between acid reflux and esophageal mucosa, avoiding the hyper- activation of gastroesophageal nociceptors.

A sensation of bloating, fullness, or a distended stomach can occur due to the frequent reflux of gastric contents (Im et al.,2021), accordingly, macroscopical evaluations resulted in considerable gastric enlargement elicited by overeating. XP administration exten- sively restored gastric homeostasis as demonstrated by the significant decrease in distended gross appearance of the stomach.

Similarly, macroscopic evaluations of esophagi showed positive outcomes following XP administration, which was able to promote a good recovery from esophageal damage caused by the corrosive effects of the acid refluxate in an equivalent way to a standard of care like omeprazole.

Due to a constant exposure to the aggressive acidic refluxate, lower esophageal injury is considered one of the main features of GERD; this pathological process promotes the development of erosive esophagitis with associated symptoms, as well as several

complications involving the impairment of esophageal mucosal barrier (Oshima & Miwa,2016). In fact, scientific research addressed the restoration of the esophageal epithelial barrier as a promising strategy for GERD patients, opening a new scenario, worthy of further investigations, in the treatment of this pathology. Our results clearly revealed esophageal damage caused by acid exposure in GERD mice, conversely, XP administration, thanks to its mechanical protective action and mucoadhesive properties efficiently reduced histological damage of the lower esophagus, with a comparable efficacy to omeprazole and even more interestingly, with a superior efficacy compared to sodium alginate, supporting the importance of the use of mucosal protective agents for the reestablishment of epithelial barrier function.

The degree of esophageal mucosal injury in GERD subjects largely depends on the duration of exposure and the pH of the refluxate (Hunt,1999). In this context, Jimenez et al. demonstrated that esophageal cell proliferation, in vitro, was inhibited in a gradual manner with increasing time of acid exposure and gastric acidity, indicating that mucosal repairing ability was suppressed upon exposure to pH lower than 3.0 (Jimenez et al., 1997). Thus, the control of gastric pH is essential to manage GERD symptoms. In this regard, a substantial decrease in pH values in gastric secretions was observed in GERD F I G U R E 5 Evaluation of iNOS expression by immunohistochemistry. GERD+vehicle mice exhibited an extensive increase in iNOS expression (e, j) compared with the Sham groups (a–d, j). XP and sodium alginate treatments decreased iNOS immunopositivity (f, g, j). A stronger decrease in iNOS expression was observed following omeprazole alone or in combination with XP (h, i, j). One-way ANOVA test. ***p< 0.001 versus Sham +vehicle; #p< 0.05 versus GERD+vehicle; ##p< 0.01 versus GERD+vehicle; ###p< 0.001 versus GERD+vehicle;+++p< 0.001 versus GERD+XP;p< 0.001 versus GERD+Sodium Alginate 250 mg/kg.

(10)

+vehicle mice. However, 1 week of XP administration led to a notable increase in intragastric pH contents, resulting highly effective in coun- teracting gastric hyperacidity.

The decrease In gastric pH typical of GERD stimulates mucins secretion from submucosal glands, in order to reinforce the mucus layer in the esophageal lumen (Niv & Fass, 2011). If primarily this mechanism has a defensive function, over time it can trigger an injury- repair process which, if not compensated by adequate endogenous defenses, can lead to disease exacerbation and development of severe esophageal pathologies (Niv & Fass, 2011). Indeed, a significant increase of MUC5AC expression in esophageal mucosa tissues of GERD mice was observed but was significantly decreased following XP oral administration for 7 days.

Laryngopharyngeal reflux (LPR), defined as the reflux of gastric content reaching above the upper esophageal sphincter, occurs in up to 60% of GERD individuals (Wong et al.,2019). In particular, LPR is considered the main contributor to extraesophageal symptoms of GERD including asthma, chronic cough, hoarseness, globus sensation, and laryngitis (Poelmans & Tack,2005). These clinical consequences are the aftermaths of an intense inflammatory response in the upper respiratory tracts prompted by the refluxate, which instigates an influx of several immune species such as neutrophils, macrophages, and

lymphocytes along laryngeal mucosa (Liu et al., 2020). Here, the obtained data confirmed the correlation between GERD and LPR, demonstrating an important presence of immune cells in laryngopharyngeal lavage following overeating-induced GERD. However, XP treatment was significantly able to reduce LPR induced by GERD, as demonstrated by the considerable decrease of neutrophils and macrophages infiltration in laryngopharyngeal lavage. These findings are of particular importance considering the inconsistency of current treatments in managing extraesophageal symptoms such as laryngopharyngeal inflammation, which still represents an unmet need of GERD patients.

It is well-known that inflammatory cytokines play a pivotal role in triggering early inflammatory changes in GERD patients, further pro- posing a close correlation between ILs levels and endoscopic index of esophageal severity (Yoshida, 2007). Moreover, it seems likely that cytokines, cooperating with PAF and ROS, establish a self-sustained inflammatory cycle which in addition to worsening esophageal epithelial damage favors GERD comorbidities (Rieder et al.,2010). In particular, PAF has been demonstrated to be a significant contributor to acute epithelial damage, operating as a powerful proinflammatory phospholipid and immune cell chemoattractant while upregulating other inflammatory mediators, including ROS (Paterson et al.,2007;

F I G U R E 6 Evaluation of Substance P expression by immunohistochemistry. GERD+vehicle mice showed an increase in substance P expression (e, j) compared with the Sham groups (a–d, j). Such expression was considerably reduced after XP and sodium alginate administrations (f, g, j). The administration of omeprazole alone or combined with XP displayed a superior efficacy in reducing the expression of substance P in the esophageal tissue compared with other treatments. One-way ANOVA test. ***p< 0.001 versus Sham+vehicle; ##p< 0.01 versus GERD +vehicle; ###p< 0.001 versus GERD+vehicle.++p< 0.001 versus GERD+XP;p< 0.001 versus GERD+Sodium Alginate 250 mg/kg.

(11)

Rieder et al.,2010). Indeed, the protective barrier granted by XP significantly decreased the expression of the aforementioned proinflammatory cytokines in the systemic flow compared with GERD mice.

Notably, XP 7-day treatment showed a significant superiority in reducing inflammatory biomarkers compared with sodium alginate.

Moreover, GERD induction in mice led to a marked overexpression of iNOS and substance P in esophageal specimens. This is in line with observations from previous studies, suggesting nitrosative stress, with the induction of iNOS, is induced by reflux components like stomach acid or bile acids in esophageal cells (Jiang et al., 2016), advancing the hypothesis that this could play a key role in the GERD- related inflammatory process. In particular, iNOS induction lead to the increase of NO levels (Beiranvand & Bahramikia,2020). As a gaseous free radical, NO is involved in many physiological processes, some of which are harmful in pathophysiological situations such as GERD because it readily reacts with O^•-2to produce proxy nitrite (ONOO) (Beiranvand & Bahramikia,2020).

Furthermore, a positive correlation has been demonstrated between acid reflux score and substance P expression, which appears to interact with several reflux-related receptors increasing the manifestation of GERD clinical signs such as heartburn or esophageal edema (Yoshida et al.,2013). Here, XP treatment exerted beneficial effects significantly decreasing the expression of both GERD markers, confirming that the mechanical action of XP was able to moderate local inflammation induced by refluxate in a manner comparable with alginates.

Our results are consistent with the recent findings highlighting the ability of Magnolia sieboldiibuds extract to significantly protect esophageal tissue damage and downregulate inflammatory mediators.

(Nan et al.,2020).

Magnolia sieboldiiextract used by Nan and colleagues was able to decrease iNOS expression and reduced histological damage caused by gastric acid reflux, exerting a protective effect comparable to that of XP used in this study. Also Curcumin, a well-known natural compound with noteworthy biological abilities, was studied to mitigate GERD consequences (Mahattanadul et al., 2006). Curcumin, extracted from Curcuma Longa's rhizome, inhibited the development of GERD in a 6-h model (Mahattanadul et al., 2006). In particular, from that study, Curcumin significantly reduced inflammation and oxidative stress during acute GERD, confirming the ability of natural compounds to manage refluxate disorders (Mahattanadul et al.,2006).

Despite the promising results obtained in this study, some limita- tions need to be addressed. Further research is needed to confirm the macroscopic and microscopic alterations of the lower esophageal mucosa following overeating, as the lack of endoscopic methods pre- vented us to establish direct evidence on the hypotensive lower esophageal sphincter, a standard procedure used to diagnose esophageal motility disorders.

Moreover, in order to better understand the mechanism by which XP reduces gastric damage, it would be of interest to explore the impact of XP on the volume of gastric content and gastric transit.

As well, considering that GERD is a chronic disease, studies employing long-term administration or preventive treatments with XP will be able to better validate these preliminary findings, thus providing more robust characterization regarding the action of XP in the context of GERD. In addition, the physiological differences in the GI tract between mice and humans must be considered; thus, future well-designed clinical trials are needed to confirm our findings and the use of XP oral solution as effective GERD patients care.

5 | C O N C L U S I O N

Taken as a whole, the obtained data in this study highlighted the positive outcomes deriving from XP treatment in ameliorating signs and symptoms of GERD observed in this murine model. In particular, XP administration resulted in a significative reduction of gastric and esophageal damage induced by acid reflux, restoring gastric homeostasis, reducing proinflammatory cytokines levels as well as nitrosative and oxidative stress. In detail, the beneficial effects exerted by XP were more consistent at 7 days rather than after 3 days of treatment, when compared to the standard treatments such as omeprazole. If compared with sodium alginate, XP showed a similar efficacy to alginates in moderating serum cytokines after 3 days of treatment, while it exerted a superior efficacy after 7 days of treatment. Interestingly, XP displayed a comparable efficacy to omeprazole in reducing esophageal macroscopic and histological damage, as well as epigastric pain.

Therefore, given these preliminary findings, XP could represent an efficacious therapeutic alternative to respond to an unmet need and ameliorate outcomes in GERD patients, with a particular focus on subjects suffering from esophageal hypersensitivity and LPR's, non-responders to PPI, alginates, or H2 antagonists as well as those suffering from refractory episodes upon drug withdrawal. Certainly, considering the lack of preclinical studies adequate to mimic the previously mentioned case studies, clinical investigations will be able to shed a light on the protective action of XP in different pathological contexts related to gastric reflux and gastric transit.

A U T H O R C O N T R I B U T I O N S

Alessio Ardizzone:Writing–original draft.Deborah Mannino:Meth- odology. Giovanna Casili:Methodology.Michela Campolo:Supervi- sion. Irene Paterniti: Supervision. Marika Lanza: Methodology.

Alessia Filippone:Methodology.Alberto Repici:Methodology.Valen- tina Bova:Methodology.Anna Paola Capra:Formal analysis.Salva- tore Cuzzocrea: Conceptualization. Emanuela Esposito:

Conceptualization.

F U N D I N G I N F O R M A T I O N

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

C O N F L I C T O F I N T E R E S T S T A T E M E N T The authors declare no conflict of interest.

(12)

D A T A A V A I L A B I L I T Y S T A T E M E N T

Data of this study are available to the corresponding author's address.

O R C I D

Alessio Ardizzone https://orcid.org/0000-0002-2293-0634 Emanuela Esposito https://orcid.org/0000-0002-2663-6387

R E F E R E N C E S

Alecci, U., Bonina, F., Bonina, A., Rizza, L., Inferrera, S., Mannucci, C., &

Calapai, G. (2016). Efficacy and safety of a natural remedy for the treatment of gastroesophageal reflux: A double-blinded randomized- controlled study.Evidence-based Complementary and Alternative Medi- cine,2016, 2581461.https://doi.org/10.1155/2016/25814618.

Ardizzone, A., Mannino, D., Capra, A. P., Repici, A., Filippone, A., Esposito, E., & Campolo, M. (2023). New insights into the mechanism of Ulva pertusa on colitis in mice: Modulation of the pain and immune system.Marine Drugs,21(5), 298.https://doi.org/10.3390/md21050298 Beiranvand, M., & Bahramikia, S. (2020). Ameliorating and protective

effects mesalazine on ethanol-induced gastric ulcers in experimental rats.European Journal of Pharmacology,888, 173573.https://doi.org/

10.1016/j.ejphar.2020.173573

Campolo, M., Casili, G., Lanza, M., Filippone, A., Cordaro, M., Ardizzone, A., Scuderi, S. A., Cuzzocrea, S., Esposito, E., & Paterniti, I. (2021). The inhibition of mammalian target of rapamycin (mTOR) in improving inflammatory response after traumatic brain injury.Journal of Cellular and Molecular Medicine,25(16), 7855–7866.https://doi.org/10.1111/

jcmm.16702

Campolo, M., Casili, G., Paterniti, I., Filippone, A., Lanza, M., Ardizzone, A., Scuderi, S. A., Cuzzocrea, S., & Esposito, E. (2020). Effect of a product containing xyloglucan and pea protein on a murine model of atopic dermatitis.International Journal of Molecular Sciences, 21(10), 3956.

https://doi.org/10.3390/ijms21103596

Campolo, M., Lanza, M., Paterniti, I., Filippone, A., Ardizzone, A., Casili, G., Scuderi, S. A., Puglisi, C., Mare, M., Memeo, L., Cuzzocrea, S., & Esposito, E. (2021). PEA-OXA mitigates Oxaliplatin-induced painful neuropathy through NF-kappaB/Nrf-2 Axis. International Journal of Molecular Sciences,22(8), 3927.https://doi.org/10.3390/

ijms22083927

Cicala, M., Emerenziani, S., Guarino, M. P., & Ribolsi, M. (2013). Proton pump inhibitor resistance, the real challenge in gastro-esophageal reflux disease.World Journal of Gastroenterology,19(39), 6529–6535.

https://doi.org/10.3748/wjg.v19.i39.6529

Costa, P., Somensi, L. B., da Silva, R. C. M. V. A. F., Mariano, L. N. B., Boeing, T., Longo, B., Perfoll, E., de Souza, P., Gushiken, L. F. S., Pelliz- zon, C. H., Rodrigues, D. M., Bastos, J. K., de Andrade, S. F., & da Silva, L. M. (2020). Role of the antioxidant properties in the gastroprotective and gastric healing activity promoted by Brazilian green propolis and the healing efficacy of Artepillin C. Inflammopharmacology, 28(4), 1009–1025.https://doi.org/10.1007/s10787-019-00649-7 Crowe, M. S., & Kinsey, S. G. (2017). MAGL inhibition modulates gastric

secretion and motility following NSAID exposure in mice. European Journal of Pharmacology, 807, 198–204. https://doi.org/10.1016/j.

ejphar.2017.05.006

Dutta, P., Giri, S., & Giri, T. K. (2020). Xyloglucan as green renewable bio- polymer used in drug delivery and tissue engineering. International Journal of Biological Macromolecules, 160, 55–68. https://doi.org/10.

1016/j.ijbiomac.2020.05.148

Filippone, A., Ardizzone, A., Bova, V., Lanza, M., Casili, G., Cuzzocrea, S., Esposito, E., Campolo, M., & Paterniti, I. (2022). A combination of xyloglucan, pea protein and chia seed ameliorates intestinal barrier integrity and mucosa functionality in a rat model of constipation- predominant irritable bowel syndrome. Journal of Clinical Medicine, 11(23), 7073.https://doi.org/10.3390/jcm11237073

Filippone, A., Casili, G., Lanza, M., Scuderi, S. A., Ardizzone, A., Capra, A. P., Paterniti, I., Campolo, M., Cuzzocrea, S., & Esposito, E.

(2023). Evaluation of the efficacy of xyloglucan, pea protein and Opuntia ficus-indica extract in a preclinical model of psoriasis.Inter- national Journal of Molecular Sciences, 24(4), 3122. https://doi.org/

10.3390/ijms24043122

Fuchs, K. H., Babic, B., Breithaupt, W., Dallemagne, B., Fingerhut, A., Furnee, E., Granderath, F., Horvath, P., Kardos, P., Pointner, R., Savarino, E., Van Herwaarden-Lindeboom M., & Zaninotto, G. (2014).

EAES recommendations for the management of gastroesophageal reflux disease.Surgical Endoscopy,28, 1753–1773.

Garcia Arteaga, V., Leffler, S., Muranyi, I., Eisner, P., & Schweiggert- Weisz, U. (2021). Sensory profile, functional properties and molecular weight distribution of fermented pea protein isolate.Current Research in Food Science,4, 1–10.https://doi.org/10.1016/j.crfs.2020.12.001 Ge, J., Sun, C. X., Corke, H., Gul, K., Gan, R. Y., & Fang, Y. (2020). The

health benefits, functional properties, modifications, and applications of pea (Pisum sativum L.) protein: Current status, challenges, and per- spectives. Comprehensive Reviews in Food Science and Food Safety, 19(4), 1835–1876.https://doi.org/10.1111/1541-4337.12573 Giampieri, F., Cianciosi, D., & Forbes-Hernández, T. Y. (2020). Myrtle

(Myrtus communis L.) berries, seeds, leaves, and essential oils: New undiscovered sources of natural compounds with promising health benefits.Food Frontiers,1(3), 276–295.

Gyawali, C. P., Yadlapati, R., Fass, R., Katzka, D., Pandolfino, J., Savarino, E., Sifrim, D., Spechler, S., Zerbib, F., Fox, M. R., Bhatia, S., de Bortoli, N., Cho, Y. K., Cisternas, D., Chen, C. L., Cock, C., Hani, A., Remes Troche, J. M., Xiao, Y.,…Roman, S. (2023). Updates to the modern diagnosis of GERD: Lyon consensus 2.0. Gut, 73(2), 361–371.

Helgadottir, H., & Bjornsson, E. S. (2019). Problems associated with depre- scribing of proton pump inhibitors.International Journal of Molecular Sciences,20(21), 5469.https://doi.org/10.3390/ijms20215469 Herregods, T., Bredenoord, A., & Smout, A. (2015). Pathophysiology of

gastroesophageal reflux disease: New understanding in a new era.

Neurogastroenterology and Motility,27(9), 1202–1213.

Hsu, C.-S., Liu, T.-T., Wen, S.-H., Wang, C.-C., Yi, C.-H., Chen, J.-H., Lei, W. Y., Orr, W. C., Fabio, P., & Chen, C.-L. (2015). Clinical, metabolic, and psychological characteristics in patients with gastroesophageal reflux disease overlap with irritable bowel syndrome.European Journal of Gastroenterology & Hepatology,27(5), 516–522.

Hunt, R. H. (1999). Importance of pH control in the management of GERD.

Archives of Internal Medicine, 159(7), 649–657. https://doi.org/10.

1001/archinte.159.7.649

Im, N. R., Kim, B., Jung, K. Y., Kim, T. H., & Baek, S. K. (2021). Non-surgical animal model of gastroesophageal reflux disease by overeating induced in mice.Journal of Investigative Medicine,69(6), 1208–1214.

https://doi.org/10.1136/jim-2020-001691

Jaynes, M., & Kumar, A. B. (2019). The risks of long-term use of proton pump inhibitors: A critical review.Therapeutic Advances in Drug Safety, 10, 2042098618809927.

Jiang, B., Zhao, S., Tao, Z., Wen, J., Yang, Y., Zheng, Y., Yan, H., Sheng, Y., & Gao, A. (2016). Controlled bile acid exposure to oesophageal mucosa causes up-regulation of nuclear gamma-H2AX possibly via iNOS induction.Bioscience Reports,36(4), e00357.https://doi.org/10.

1042/BSR20160124

Jimenez, P., Lanas, A., Piazuelo, E., Esteva, F., & Sainz, R. (1997). Small decreases in pH inhibit both proliferation and restitution of esophageal epithelial cells. Paper Presented at the Gastroenterology.

Lai, Y. C., Wang, P. C., & Lin, J. C. (2008). Laryngopharyngeal reflux in patients with reflux esophagitis. World Journal of Gastroenterology, 14(28), 4523–4528.https://doi.org/10.3748/wjg.14.4523

Lanza, M., Casili, G., Filippone, A., Campolo, M., Paterniti, I., Cuzzocrea, S., & Esposito, E. (2021). Evaluating the protective properties of a xyloglucan-based nasal spray in a mouse model of allergic

(13)

rhinitis. International Journal of Molecular Sciences, 22(19), 10472.

https://doi.org/10.3390/ijms221910472

Leiman, D. A., Riff, B. P., Morgan, S., Metz, D. C., Falk, G. W., French, B., Umscheid, C. A., & Lewis, J. D. (2017). Alginate therapy is effective treatment for GERD symptoms: A systematic review and meta-analysis.

Diseases of the Esophagus, 30(5), 1–9.https://doi.org/10.1093/dote/

dow020

Liu, D., Qian, T., Sun, S., & Jiang, J. J. (2020). Laryngopharyngeal reflux and inflammatory responses in mucosal barrier dysfunction of the upper Aerodigestive tract.Journal of Inflammation Research,13, 1291–1304.

https://doi.org/10.2147/JIR.S282809

Lukic, S., Mijac, D., Filipovic, B., Sokic-Milutinovic, A., Tomasevic, R., Krstic, M., & Milosavljevic, T. (2022). Chronic abdominal pain: Gastro- enterologist approach.Digestive Diseases,40(2), 181–186.https://doi.

org/10.1159/000516977

Mahattanadul, S., Radenahmad, N., Phadoongsombut, N., Chuchom, T., Panichayupakaranant, P., Yano, S., & Reanmongkol, W. (2006).

Effects of curcumin on reflux esophagitis in rats.Journal of Natural Medicines, 60(3), 198–205. https://doi.org/10.1007/s11418-006- 0036-4

Nair, A. B., & Jacob, S. (2016). A simple practice guide for dose conversion between animals and human.Journal of Basic and Clinical Pharmacy, 7(2), 27–31.https://doi.org/10.4103/0976-0105.177703

Nan, L., Nam, H. H., Park, B. Y., Kim, B. T., & Choo, B. K. (2020). Ameliora- tive effects ofMagnolia sieboldiibuds hexane extract on experimental reflux esophagitis.Phytotherapy Research,34(9), 2385–2396.https://

doi.org/10.1002/ptr.6689

Nirwan, J. S., Hasan, S. S., Babar, Z. U., Conway, B. R., & Ghori, M. U.

(2020). Global prevalence and risk factors of gastro-oesophageal reflux disease (GORD): Systematic review with meta-analysis. Scientific Reports,10(1), 5814.https://doi.org/10.1038/s41598-020-62795-1 Niv, Y., & Fass, R. (2011). The role of mucin in GERD and its complications.

Nature Reviews. Gastroenterology & Hepatology, 9(1), 55–59.https://

doi.org/10.1038/nrgastro.2011.211

Oh, D. S., Hagen, J. A., Fein, M., Bremner, C. G., Dunst, C. M., Demeester, S. R., Lipham, J., & Demeester, T. R. (2006). The impact of reflux composition on mucosal injury and esophageal function.Journal of Gastrointestinal Surgery, 10(6), 787–796; discussion 796-787.

https://doi.org/10.1016/j.gassur.2006.02.005

Oshima, T., & Miwa, H. (2016). Gastrointestinal mucosal barrier function and diseases.Journal of Gastroenterology,51(8), 768–778.https://doi.

org/10.1007/s00535-016-1207-z

Panahi, Y., Khedmat, H., Valizadegan, G., Mohtashami, R., & Sahebkar, A.

(2015). Efficacy and safety of Aloe vera syrup for the treatment of gastroesophageal reflux disease: A pilot randomized positive-controlled trial.Journal of Traditional Chinese Medicine,35(6), 632–636.https://

doi.org/10.1016/s0254-6272(15)30151-5

Paterson, W. G., Kieffer, C. A., Feldman, M. J., Miller, D. V., & Morris, G. P.

(2007). Role of platelet-activating factor in acid-induced esophageal mucosal injury. Digestive Diseases and Sciences, 52(8), 1861–1866.

https://doi.org/10.1007/s10620-006-9385-9

Peritore, A. F., D'Amico, R., Siracusa, R., Cordaro, M., Fusco, R., Gugliandolo, E., Genovese, T., Crupi, R., Di Paola, R., Cuzzocrea, S., &

Impellizzeri, D. (2021). Management of acute lung injury: Palmitoy- lethanolamide as a new approach. International Journal of Molecular Sciences,22(11), 5533.https://doi.org/10.3390/ijms22115533 Pique, N., Gomez-Guillen, M. D. C., & Montero, M. P. (2018). Xyloglucan, a

plant polymer with barrier protective properties over the mucous membranes: An overview.International Journal of Molecular Sciences, 19(3), 673.https://doi.org/10.3390/ijms19030673

Poelmans, J., & Tack, J. (2005). Extraoesophageal manifestations of gastro- oesophageal reflux.Gut,54(10), 1492–1499.https://doi.org/10.1136/

gut.2004.053025

Rieder, F., Biancani, P., Harnett, K., Yerian, L., & Falk, G. W. (2010). Inflam- matory mediators in gastroesophageal reflux disease: Impact on esophageal motility, fibrosis, and carcinogenesis.American Journal of Physiology. Gastrointestinal and Liver Physiology,298(5), G571–G581.

https://doi.org/10.1152/ajpgi.00454.2009

Scuderi, S. A., Casili, G., Lanza, M., Ardizzone, A., Pantaleo, L., Campolo, M., Paterniti, I., Cucinotta, L., Cuzzocrea, S., & Esposito, E. (2022). Efficacy of a product containing xyloglucan and pea protein on intestinal barrier function in a partial restraint stress animal model.International Journal of Molecular Sciences,23(4), 2269.https://doi.org/10.3390/ijms23042269 Sharma, P., & Yadlapati, R. (2021). Pathophysiology and treatment options for gastroesophageal reflux disease: Looking beyond acid.Annals of the New York Academy of Sciences,1486(1), 3–14.https://doi.org/10.

1111/nyas.14501

Smart, H. L., & Atkinson, M. (1990). Comparison of a dimethicone/antacid (Asilone gel) with an alginate/antacid (Gaviscon liquid) in the management of reflux oesophagitis.Journal of the Royal Society of Medicine, 83(9), 554–556.https://doi.org/10.1177/014107689008300907 Tack, J., & Pandolfino, J. E. (2018). Pathophysiology of gastroesophageal

reflux disease.Gastroenterology,154(2), 277–288.

van Rhijn, B. D., Weijenborg, P. W., Verheij, J., van den Bergh Weerman, M. A., Verseijden, C., van den Wijngaard, R. M., de Jonge, W. J., Smout, A. J., & Bredenoord, A. J. (2014). Proton pump inhibitors partially restore mucosal integrity in patients with proton pump inhibitor-responsive esophageal eosinophilia but not eosinophilic esophagitis. Clinical Gastroenterology and Hepatology, 12(11), 1815– 1823.https://doi.org/10.1016/j.cgh.2014.02.037

Wong, M. W., Bair, M. J., Chang, W. C., Hsu, C. S., Hung, J. S., Liu, T. T., Yi, C. H., Lei, W. Y., Vaezi, M. F., Gyawali, C. P., & Chen, C. L. (2019). Clini- cal and psychological characteristics in gastroesophageal reflux disease patients overlapping with laryngopharyngeal reflux symptoms.Journal of Gastroenterology and Hepatology,34(10), 1720–1726. https://doi.

org/10.1111/jgh.14651

Yamamoto, A., Itoh, T., Nasu, R., & Nishida, R. (2014). Sodium alginate ameliorates indomethacin-induced gastrointestinal mucosal injury via inhibiting translocation in rats. World Journal of Gastroenterology, 20(10), 2641–2652.https://doi.org/10.3748/wjg.v20.i10.2641 Yoshida, N. (2007). Inflammation and oxidative stress in gastroesophageal

reflux disease.Journal of Clinical Biochemistry and Nutrition,40(1), 13– 23.https://doi.org/10.3164/jcbn.40.13

Yoshida, N., Kuroda, M., Suzuki, T., Kamada, K., Uchiyama, K., Handa, O., Takagi, T., Yoshikawa, T., & Kuramoto, H. (2013). Role of nociceptors/neuropeptides in the pathogenesis of visceral hypersensitivity of nonerosive reflux disease. Digestive Diseases and Sciences, 58(8), 2237–2243.https://doi.org/10.1007/s10620-012-2337-7

S U P P O R T I N G I N F O R M A T I O N

Additional supporting information can be found online in the Support- ing Information section at the end of this article.

How to cite this article:Ardizzone, A., Mannino, D., Casili, G., Campolo, M., Paterniti, I., Lanza, M., Filippone, A., Repici, A., Bova, V., Capra, A. P., Cuzzocrea, S., & Esposito, E. (2024).

Efficacy of an oral suspension containing xyloglucan and pea proteins on a murine model of gastroesophageal reflux disease.Phytotherapy Research,38(3), 1610–1622.https://doi.

org/10.1002/ptr.8133