24/4/2018 Editorial Board | International Journal of Entomology Research
http://www.entomologyjournals.com/board 1/9
Search SEARCH
ISSN: 2455-4758 International Journal of Entomology
Research
HOME EDITORIAL BOARD ARCHIVES INSTRUCTIONS MEMBERSHIP INDEXING CONTACT US
SIDEBAR
Home Editorial Board Archives Instructions Indexing and Abstracting Contact Us Publication Ethics
CERTIFICATE
UGC Approved Journal Editorial Board
EDITOR-IN-CHIEF
Dr. B. S. Chandel (M.Sc., Ph.D., D.Sc. (Zoology-Entomology) FESI, FSLSc., FSESc., IAES, FANSF, SPPS. FAEB)
Associate Professor & Head
Biopesticides and Toxicological Laboratory, Department of Zoology, D.B.S. College, A liated to CSJM University, Kanpur, India
ASSOCIATE EDITORS
Dr. Surya Prakash Mishra (Ph.D., .Z.S.I., F.A.I.R., F.I.A.E.S., F.S.L.Sc.) Associate Professor and Head,
P.G. Department of Zoology, Ganpat Sahai P.G. College, Sultanpur, Uttar Pradesh, India
Rouhollah Radjabi (Ph.D.) Researcher
Plant Protection Department, Agricultural Faculty, Islamic Azad University, Dezful Branch, Dezful, Iran
Dr. Saroj Kumar Ghosh (M.Sc., M.Phil., Ph.D.) Assistant Professor,
Department of Zoology, Bejoy Narayan Mahavidyalaya, Itachuna, Hooghly, West Bengal, India
Dr. Abhishek Shukla (Ph.D.)
Senior Acarologist and Associate Professor
Department of Entomology Navsari Agricultural University, Navsari, Gujarat, India
Neeraj Kumar Sharma (Ph. D.)
Department of Zoology, H.N.B Garhwal University, Tehri Garhwal Uttarakhand, India
Dr. (Mrs.) Ranjana Saxena (M. Sc., Ph.D.) Associate Professor
Dyal Singh College, University of Delhi, Delhi, India Dr. Hany M. R. Abdel-Latif ((DVM, MVSc, PhD) Lecturer of Fish diseases
Department of Poultry and Fish diseases, Faculty of Veterinary medicine, Alexandria University Ed na, Behera province, Egypt Syed Ishtiaq Anjum (Ph.D.)
Lecturer
Department of Zoology, Kohat University of Science and Technology, Kohat-26000, Khyber Pakhtunkhwa, Pakistan
Dr. Nayan Roy (M. Sc., Ph.D.) Assistant Professor
MUC Women’s College, Department of Zoology, West Bengal, India Instructions to Reviewer Click Here
Online and Print Journal Indexed Journal Refereed Journal Peer Reviewed Journal
SUBMIT YOUR ARTICLE AT
INDEXED IN
JOIN EDITORIAL BOARD
Journals List
Research Journals
24/4/2018 Editorial Board | International Journal of Entomology Research
http://www.entomologyjournals.com/board 2/9
Dr. Semra BENZER Assistant Professor
Education Faculty, Gazi University, Ankara, Turkey Dr. Deepak Sumbria (Ph.D.)
Teaching Associate
Department of Veterinary Parasitology Post-Graduate Institute of Veterinary Education and Research jaipur, Rajasthan, India Prof. Dr. Muhammad Faheem Malik (M. Sc., Ph.D.) Dean (Director) of Faculty of Sciences
University of Gujrat, Ha z Hayat Campus, Gujrat, Pakistan Dr. R. Raveen (M.Sc., M.Phil., Ph.D.)
Assistant Professor,
Department of Zoology, Madras Christian College, Chennai, Tamil Nadu, India
Hameed Ur Rehman Researcher
Department of Chemistry, Kohat University of Science and Technology, Khyber Pakhtunkhwa, Pakistan
Dr. Selçuk Altınsaçlı (M. Sc., Ph.D.) Faculty of Fisheries,
İstanbul University, Istanbul, Turkey
Dr. Amit Tomar (M.Sc. Botany, Ph.D., F.L.S. London, D.Sc.) Assistant Professor
Department of Botany Meerut College, Meerut, Uttar Pradesh, India Dr. Buddhadeb Manna (M. Sc., Ph.D.)
Professor,
Department of Zoology, University of Calcutta, India Mandakini Singla (Ph.D.)
Lecturer
Govt Science College, Jagraon, Punjab, India Dr. Meera Srivastava (M. Sc., Ph.D.) Head,
PG Department of Zoology Govt. Dungar College, Bikaner, Rajasthan, India
Dr.abid Farid (M. Sc., Ph.D.) Associate Professor/Head,
Department of Agriculture, University of Haripur, Haripur, Pakistan Dr. Alexander V. Ilyinykh (Ph.D., D.Sc.,)
Institute of Systematics and Ecology of Animals SB PAS, Novosibirsk, Russia
Prof. Dr. Naim Saglam (M. Sc., M.A., Ph.D.)
Department of Aquaculture and Fish Diseases, Faculty of Fisheries, Firat University, Turkey
Prof. Dr. Ahmad-Ur-Rahman Saljoqi (M. Sc., Ph.D.) Professor,
Department of Plant Protection, The University of Agriculture, Peshawar, Pakistan
Prof. Dr. Emel Ergun (Ph.D.)
Department of Histology and Embryology, Faculty of Veterinary Medicine, Ankara University, Turkey
Journals List
Research Journals
24/4/2018 Editorial Board | International Journal of Entomology Research
http://www.entomologyjournals.com/board 3/9
Dr. R.a. Tripathi Professor (Retd.),
Division of Entomology, C.S. Azad University of Agriculture and Techenology, Kanpur, Uttar Pradesh, India
Prof. Dr. Bilal Dik (D.M.V., Ph.D.)
Department of Parasitology, Selcuk University, Turkey
Prof. Bhaweshwar Singh (M. Sc., Ph.D.) Prof-in-Charge,
Gerontology, University Department of Zoology, L.N. Mithila University, Darbhanga, India
Prof. C.p.m Tripathi Head,
Department of Zoology, D.D.U. University of Gorakhpur, Gorakhpur, India
Prof. Abdurasulov Yrysbek (Ph.D.) Consultant,
FAO National Farm Animal Genetic Resources of Kyrgyzstan, Kyrgyzstan
Assoc. Prof. Dr. Mustafa Garip (D.V.M., Ph.D.)
Division of Animal Nutrition and Zootechnics, Faculty of Veterinary Medicine, Selcuk University, Turkey
Prof. Dr. Svetlana G. Nesterova (Ph.D.)
Department of Biodiversity and Bioresources, Faculty of Biology and Biotechnology, Al-Farabi Kazakh National University, Kazakhstan Dr. J.p. Shukla
Head,
Department of Zoology, Shiv Harsh Kisan P.G. College, Basti, India Dr. Ravneet Kaur
Division of Entomology, Punjabi University, Patiala, Punjab, India
Prof. S.c. Joshi
Department of Zoology, Rajasthan University Jaipur, Jaipur, Rajasthan, India
Prof. Nogoybayev Mukambetov Daiyrovich Head,
Head of the Department of Internal Medicine Animals, Kyrgyz National Agrarian University, Kyrgyzstan
Dr. Oguzhan Avci
Department of Virology, Faculty of Veterinary, Medicine, University of Selcuk, Turkey
Dr. Ashish Tripathi (M.Sc., Ph.D., F.I.S.C.A.)
P.G. Department of Zoology and Entomology, Janta College Bakewar, Etawah, Uttar Pradesh, India
Dr. Varuna Verma (M.Sc., Ph.D.)
Environmental Engineering, Geetanjali Institute of Technical Studies, Dabok, Udaipur, India
Dr. Matiyar Rahaman Khan (M.Sc., Ph.D.) Associate Professor
AICRP (Nematode), Directorate of Research/Department of Agril Entomology, Bidhan Chandra Krishi Viswavidyalaya, Kalyani, Nadia,
Journals List
Research Journals
24/4/2018 Editorial Board | International Journal of Entomology Research
http://www.entomologyjournals.com/board 4/9
West Bengal, India
Dr. Samuel Tennyson (M.Sc., Ph.D.) Assistant Professor,
Department of Zoology, Madras Christian College, Chennai, Tamil Nadu, India
Dr. S. Arivoli (M.Sc., M.Phil, Ph.D.) Assistant Professor,
Department of Zoology, Thiruvalluvar University, Vellore, Tamil Nadu, India
Assoc. Prof. Dr. Ali Satar (M.Sc., Ph.D.)
Dicle University Department of Biology, Diyarbakır, Turkey
Dr. Md. Abdur Rashid (M.Sc., Ph.D.)
Genetics and Molecular Biology Lab. Department of Zoology, University of Dhaka, Bangladesh
Dr. Jainder Singh Chhilar (M.Sc., Ph.D., P.G.D.B.I.) Assistant Professor,
Department of Zoology, Pt CLS Government PG College, Karnal, Haryana, India
Asist. Prof. Dr. M. Yeşim çelik (M.Sc., Ph.D.) Department of Aquaculture, Sinop University, Turkey
Dr. Melek Zeybek (Ph.D.)
Department of Biology. Süleyman Demirel University, Turkey
Dr. Shivaji Bhagwan Ubarhande (M.Sc., Ph.D.) Head,
Department of Zoology, Rajarshi Shahu Arts, Commerce and Science College, Pathri Phulambri, Aurangabad, India
Dr. Meral Apaydın Yağcı (Ph.D.) Fisheries Engineer
Fisheries Research Station, Eğirdir-Isparta, Turkey Dr. B. N. Pandey (M.Sc., Ph.D.)
P.G.Department of Zoology. Purnea College, Purnia, Bihar, India
Dr. Sanjay Shamrao Nanware (M.Sc., Ph.D., F.H.S.I., F.S.L.Sc.,F.Z.S.I.,F.I.A.S.N.)
Assistant Professor,
Post Graduate Department of Zoology, Yeshwant Mahavidyalaya, Nanded, Maharashtra, India
Dr. Dhanraj Balbhim Bhure (M.Sc., Ph.D.) Assistant Professor,
Post Graduate Department of Zoology, Yeshwant Mahavidyalaya, Nanded, Maharashtra, India
Dr. Sebastian C. D. (M.Sc., Ph.D.) Associate Professor,
Department of Zoology Director, School of Health Sciences University of Calicut, Kerala, India
Dr. Omer Kucuk (M.Sc., Ph.D.)
Chamber of forest Engineer, Society of Kastamonu University, Turkey
Journals List
Research Journals
24/4/2018 Editorial Board | International Journal of Entomology Research
http://www.entomologyjournals.com/board 5/9
Dr. P.k. Mittal (M. Sc., Ph.D.) Scientist
National Institute of Malaria Research, New Delhi, India Prof. Tinatin Doolotkeldieva (M. Sc., Ph.D.)
Head and Prof. of Plant Protection
Department, Agriculture Faculty, Kyrgyz-Turkish Manas University, Kyrgyzstan
Dr. Sarwan Kumar (M.Sc., Ph.D.) Assistant Entomologist (Oilseeds),
Department of Plant Breeding and Genetics, Punjab Agricultural University, Ludhiana, Punjab, India
Dr. Mamata Kumari (M.Sc., Ph.D.)
Ramdayalusingh College, B.R.A. Bihar University, Muzaffarpur, Bihar, Indian
Dr. M. Serajuddin (M.Sc., Ph.D.) Associate Professor,
Department of Zoology, University of Lucknow, Lucknow, India Associate. Prof. Dr. Hasan Kalyoncu (M.Sc., Ph.D.)
Faculty of Art and Science,
Departmant of Biology, University of Süleyman Demirel, Isparta, Turkey
Dr. S. Rajashekara (M.Sc., Ph.D.)
Centre for Applied Genetics, Department of Zoology, Jnana Bharathi Campus, Bangalore University, Bengaluru, Karnataka, India Dr. Muhammad Zubair (M.Sc., Ph.D.)
Lecturer
(currently on study leave), Faculty of Veterinary and Animal Science, The Univeristy of Poonch, Rawalakot, Azad Jammu & Kashmir, Pakistan
Dr. Hassan Nasirian (M.Sc., Ph.D.)
Department of Medical Entomology and Vector Control, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran Prof. Poduri Nagaraja Rao (M.Sc., Ph.D., FPPAI., FSPPS.,FAEB., FAZRA,)
Professor of Zoology,
Department of Zoology, Osmania University, India Dr. Youssef Dewer (M.Sc., Ph.D.)
Department of Biological Chemistry and Crop Protection, Rothamsted Research, Harpenden, United Kingdom
Dr.El-Sayed Abdel-Malek El-Sheikh (M.Sc., Ph.D.) Associate Prof.
Associate Prof. of Pesticides Biotechnology and Toxicology, Faculty of Agriculture, Zagazig University, Egypt
Dr. Soad I. Abd El-Razak Ramadan (M.Sc., Ph.D.)
Plant Protection Research Institute, Agricultural Research Center, Sabahia, Baccous, Alexandria, Egypt
Dr. Pratibha Menon (M.Sc., Ph.D.)
Division of Entomology, Indian Agricultural Research Institute, Delhi, India
Prof. Dr Mou d Yassine (Ph.D.) Tishreen university, Latakia, Syria
Journals List
Research Journals
24/4/2018 Editorial Board | International Journal of Entomology Research
http://www.entomologyjournals.com/board 6/9
Dr. Muhammad Saeed Assistant Professor
Department of Agriculture, University of Haripur, Khyber Pakhtunkhwa, Pakistan
Dr. Ali Darvishzadeh (M. Sc., Ph.D.)
Department of Plant Protection, College of Agriculture and Natural Resources, University of Tehran, Karaj, Alborz, Iran
Prof. Dr. Uğur Uslu (M. Sc., Ph.D.) Vice Dean
Selcuk Universite, Veterinary Medicine Parasitology Department, Kampus-Konya, Turkey
Dr. Y. Norma-Rashid (Ph.D.) Professor,
Ecology & Biodiversity Programme, Institute of Biological Sciences, Faculty of Science, University of Malaya, Kuala Lumpur, Malaysia Dr. Dushyant Mishra (Ph.D.)
Research Associate,
Department of Molecular and Cellular Medicine, Reynolds Medical Bldg. Texas A&M Health Science Center, College Station, Texas, USA Dr. Jayaprada Rao Chunduri (M.Sc., M.Phil., Ph.D., PGDB)
Assistant Professor,
Biotechnology Department, Mithibai College of Arts, Chauhan Institute of Science and AJ college of commerce and economics (A td. to MUMBAI university), Vile Parle(W), Mumbai, India
Dr. Showket Ahmad Dar (Ph.D.)
Sher e Kashmir University of Agricultural Sciences and Technology Kashmir, Shalimar, Srinager, India
Mukesh Kumar Chaubey (Ph.D) Assistant Professor
Department of Zoology, Mahatma Gandhi Post Graduate College, Gorakhpur, Uttar Pradesh, India
Luis Carlos Martínez (Ph.D) Researcher
Department of Entomology, Universidade Federal De Viçosa, Minas Gerais, Brazil
Bolormaa Ganbaatar (Master) P.o.b 53/15.
Institute of Plant Protection, Ub. Khan-uul, Zaisan, Ulaanbaatar, Mongolia
Dr. Kalim Shaikh (M.Sc, B.Ed, Ph.D(Zoology)) Assistant Professor
Poona College of Arts, Science & Commerce New, Modikhana Camp, Pune, Maharashtra, India
Grace Beena Paul (M.sc, B.Ed, Ph.D) Editorial Board Member
Department of Zoology, St.pious X Degree & Pg College Fr Women, Hyderabad, Telangana, India
Dr. Nitin Kulkarni (Ph.D) Scientist G
Journals List
Research Journals
24/4/2018 Editorial Board | International Journal of Entomology Research
http://www.entomologyjournals.com/board 7/9
Forest Entomology Division, Tropical Forest Research Institute, Jabalpur, Madhya Pradesh, India
Dr. Rajendra Kumar Kalyan (M.Sc.(Ag. Ento.), Ph.D.(Ento)) Assistant Professor(entomology)
Agricultural Research Station-borwat Farm, Maharan Pratap University of Agriculture & Technology-udaipur, Banswara, Rajasthan, India Dr. G. Ramkumar (M.Sc., Ph.D)
Research Scientist
Department of Biotechnology, Periyar University, Salem, Tamil Nadu, India
Dr. Lingathurai (M.Sc., M.Phil., Ph.D) Assistant Professor
Department of Biotechnology, Madura College, Madurai, Tamil Nadu, India
Dr. A. Prakasam (M.Sc., M.Phil., M.B.A., Ph.D) Assistant Professor
Department of Physics, Thiruvalluvar Government Arts College, Namakkal, Tamil Nadu, India
Dr. Fazil Hasan (Ph.D., Post Doc.) Post Doctoral
Division of Entomology, icar-indian Agricultural Research Institute, New Delhi, Delhi, India
Dr. Prabhakar ramchandra pawar (M.Sc. Ph.D) Vice-principal & Head
Department of Zoology, Veer Wajekar Arts Science and Commerce College, Navi Mumbai, Maharashtra, India
Dr. A. Najitha Banu (Ph.D) Assistant Professor
Department of Zoology, School of Bioengineering and Biosciences, Lovely Professional University, Punjab, India
Dr. Snehangsu Sinha (BVSc, MVSc, NET, D.Tech, PD.Tech) Teaching Associate
Department of Anatomy, College of Veterinary Science, Guwahati, Assam, India
Dr. C. V. Sreeranjitkumar (MSc., MPhil, PhD, PDF) Associate Professor
Head of Department, P. G and Research Department of Zoology, Govt.
Victoria College, Palakkad, Kerala, India Dr. Partha Pratim Chakravorty (M.Sc., PhD, FZS) Associate Professor & Head
Post Graduate Department of Zoology, Raja N. L. Khan Women &
College, Gope Palace, Vidyasagar University, Midnapore, West Bengal, India
Dr. Manish Sharma (MSc, MPhil, PhD) Assistant Professor in Zoology
PG Department of Agriculture, General Shivdev Singh Diwan Gurbachan Singh Khalsa College, Patiala, Punjab, Patiala, Punjab, India
Dr. Angsuman Chanda (M. Sc., Ph. D.) Associate Professor
Journals List
Research Journals
24/4/2018 Editorial Board | International Journal of Entomology Research
http://www.entomologyjournals.com/board 8/9
PG Department of Zoology, Raja N. L. Khan Women & College, Medinipur, Paschim Medinipur, West Bengal, India
Dr. Kathirvelu Baskar (Ph.D Entomology) Senior Scientist
Optimurz Biotechnology Internships Training Chennai, Shenoy Nagar West, Chennai, Tamil Nadu, India
Dr. Ankush M. Raut (Ph.D) Assistant Professor
Department of Plant Protection, School of Agriculture, Lovely Professional University, Jalandhar, Punjab, India
ASSISTANT EDITORS
Tamizhazhagan (M.Sc., B.Ed., M.Phil., Ph.D.,) Researcher
Department of Zoology, Annamalai University, Chidambaram, Tamil Nadu, India
ASSISTANT EDITOR
Haseeb Jan (M.Sc(Hons) Entomology) Researcher in Acarology Laboratory
Department of Entomology University of Agriculture, Faisalabad, Pakistan
Dr. Sameera Siraj (Ph.D) Assistant Professor
Department of zoology, S. P. college Srinagar, Cluster university srinagar, Srinagar, Jammu and Kashmir, India
Dr Priyankar Sanphui (M.Sc, Ph.D) Assistant Professor
Department of Zoology, Sree Chaitanya College, West Bengal, India
Shivashankara (M.Sc., Ph.D)
Department of Entomology, Colleage of Agriculture, G. B. Pant University of Agriculture and Technology, Pantnagar, Uttarakhand, India
Ramesh Singh Yadav (M.Sc. NET) Assistant Teacher
Govt School Dehariya, Zamaniya, Ghazipur, Uttar, Pradesh, India
Mainak Bhattacharyya (M.Sc., B.Ed, Ph.D)
Department of Agricultural Entomology, Bidhan Chandra Krishi Viswavidyalaya, Mohanpur, Nadia, West Bengal, India
Dr. Jitendar Kumar Sharma (Ph.D) Assistant Professor
Department of Plant Pathology, School of Agriculture, Rai University, Ahmedabad, Gujarat, India
G. Dineshkumar (M.Sc.,M.Phil.,(Ph.D))
Department of Zoology, Biotechnologya V. Vm Sri Pushpam College (Autonomous) Poondi, Thanjavur, Tamilnadu, India
Dr. Shabir Ahmad Bhat (Ph.d) Assistant Professor
Journals List
Research Journals
24/4/2018 Editorial Board | International Journal of Entomology Research
http://www.entomologyjournals.com/board 9/9
Junior Scientist (SS), Temperate Sericulture Reserach Institute, Mirgund SKUAST, Jammu and Kashmir, India
Email: [email protected] Phone: 08803343509 ASSOCIATE EDITOR
Dr. Sudhakar Gupta (M.Sc. Ph.D.) Associate Professor
Department of Zoology, Suraj Degree (PG) College, Mahendergarh, Haryana, India
Dr. Abdul Rasheed War (Ph.D) Scientist
World Vegetable Centre-South Asia, ICRISAT Campus, Hyderabad, Telangana, India
Dr. Bhanvi Wadhawan (M.Sc, Ph.D) Assistant Professor
Department of Zoology, M. M. Modi College, Patiala, Punjab, India Dr. Aditya Prasad Acharya (PhD)
Assistant Professor
Department of Veterinary Pathology, College of Veterinary Science &
Animal Husbandry, OUAT, Bhubaneswar, Odisha, India
Dr. Mrs. Rajendramani Gnaneswaran (Ph.D)
Department of Zoology University of Jaffna, Jaffna, Sri Lanka
Dr. Palem Harinath (Ph.D)
Department of Zoology, Yogi Vemana University, Vemana Puram, Yogi Vemana University Road, Ganganapalle, Andhra Pradesh, India Dr. Rajendramani Gnaneswaran (Ph.D)
Department of Zoology, University of Jaffna, Jaffna, Sri Lanka
Chinnaperumal Kamaraj (M.Sc.,M.Phil.,Ph.D.,)
Department of Biotechnology, School of Biosciences, Periyar University, Salem, Tamil Nadu, India
Dr. Deepak Rawal (M. Sc., SET, CSIR-NET, Ph. D.) Assistant Professor
Department of Zoology, UCOS, Mohanlal Sukhadia University, Udaipur, Ganesh Nagar, Udaipur, Rajasthan, India
Dr. Sushil Kumar Saxena (M.Sc.(Agril), Ph.D. (Forest Ento.), Ph.D.
(Agril. Ento.)) Professor and Head
Department of Entomology, ASPEE College of Horticulture and Forestry, Navsari Agricultural University, Navsari, Gujarat, India
Apply for Editorial Board Member Click Here
HOME EDITORIAL BOARD ARCHIVES INSTRUCTIONS MEMBERSHIP INDEXING CONTACT US COPYRIGHT © 2016 - 2018. ALL RIGHTS RESERVED.
Journals List
Research Journals
Vol. 3, Issue 2 (2018)
S. No. Title and Authors Name Country
21 Incidence and diversity of lepidopterous insect pests and their parasitoids (natural enemies) on cole crops at danderkhah location in Srinagar District (J&K, India)
Deen Mohd Bhat
[ABSTRACT][DOWNLOAD]
PAGES: 107-113 | 69 VIEWS 29 DOWNLOADS
India
22 The moths (Lepidoptera: Heterocera) of vagamon hills (Western Ghats), Idukki district, Kerala, India
Pratheesh Mathew, Sekar Anand, Kuppusamy Sivasankaran, Savarimuthu Ignacimuthu
[ABSTRACT][DOWNLOAD]
PAGES: 114-120 | 65 VIEWS 27 DOWNLOADS
India
23 Histopathological effects of chlorpyrifos on the midgut of 3rd larval instar of oriental latrine fly, Chrysomya megacephala(Fabricius) (Diptera:
Calliphoridae)
Shagufta Yasmeen, Mohammad Amir [ABSTRACT][DOWNLOAD]
PAGES: 121-126 | 66 VIEWS 35 DOWNLOADS
India
24 Location specific morphological peculiarity of honey bee Apis indica in Amethi, region Uttar Pradesh, India: Revealization from an identification and characterization studied
Saleem Ahamad, Rajneesh Tripathi [ABSTRACT][DOWNLOAD]
PAGES: 127-129 | 57 VIEWS 24 DOWNLOADS
India
25 Oviposition deterrent, repellent and ovicidal activity of Pterolobium hexapetalum (Fab.) against the stored grain pest, Callosobruchus maculatus (Coleoptera: Chrysomelidae)
Saranya J, Elumalai Kuppusamy [ABSTRACT][DOWNLOAD]
PAGES: 130-138 | 31 VIEWS 17 DOWNLOADS
India
26 Larvicidal activity of selected essential oils against Aedes aegypti (Insecta:
Diptera: Culicidae)
Christina Pauline M, Mary Fabiola, Johnson Amala Justin, JMV Kalaiarasi [ABSTRACT][DOWNLOAD]
PAGES: 139-142 | 34 VIEWS 20 DOWNLOADS
India
27 Expression patterns of epsilon glutathione S – transferases genes in developmental stages of susceptible and DDT resistant lines of Anopheles arabiensis strains
Yayo AM, Ado A, Habibu UA, Mohammed BR, Ebere N, Hemingway J [ABSTRACT][DOWNLOAD]
PAGES: 143-151 | 36 VIEWS 23 DOWNLOADS
Nigeria
28 Population dynamics study for triple-e sustainable management of a major pest, Leptocorisa oratorius fabricius (Hemiptera: Alydidae)
Nayan Roy
[ABSTRACT][DOWNLOAD]
PAGES: 152-158 | 20 VIEWS 11 DOWNLOADS
India
29 Evaluation of toxicity of biopesticides against okra moth, Earias
vittella (Fabricius) (Noctuidae: Lepidoptera) India
Pratibha, Rajendra Singh [ABSTRACT][DOWNLOAD]
PAGES: 159-163 | 22 VIEWS 13 DOWNLOADS
30 Field efficacy of emamectin benzoate 1.9 EC against shoot and fruit borer of okra
Karthikeyan Rajuponnu, Ayysamy Regupathy [ABSTRACT][DOWNLOAD]
PAGES: 164-167 | 20 VIEWS 11 DOWNLOADS
India
31 Molecular identification of house fly, Musca domestica L. (Diptera :
Muscudae), using mitochondrial DNA partial genes cytochrome oxidase sub unit 1 (CO1) in Manado city
Ivonne E Rotty, Odi Pinontoan, Max Tulung, Inneke Rumengan, Mokosuli Yermia Semuel
[ABSTRACT][DOWNLOAD]
PAGES: 168-176 | 34 VIEWS 27 DOWNLOADS
Indonesia
32 Physico-chemical characteristics of larval hatritat waters of mosquitoes in and around Bangalore, Karnataka, India
BM Sreedhara Nayaka [ABSTRACT][DOWNLOAD]
PAGES: 177-179 | 15 VIEWS 8 DOWNLOADS
India
33 Insect faunal diversity of chintamani kar bird sanctuary and other protected areas of West Bengal
Bulganin Mitra, Arjan Basu Roy, Apurva Das, Suresh Kumar Shah, Sarika Baidya, Devsena Roy Chaudhury, Debapriya Mukherjee, Balaram Panja [ABSTRACT][DOWNLOAD]
PAGES: 180-189 | 14 VIEWS 7 DOWNLOADS
India
34 Taxonomic studies on subfamily Phaneropterinae (Orthoptera: Tettigoniidae) from Uttar Pradesh, India
Mohd. Kaleemullah Farooqi, Mohd. Kamil Usmani [ABSTRACT][DOWNLOAD]
PAGES: 190-195 | 2 VIEWS 2 DOWNLOADS
India
35 Diversity and abundance of the myrmicofauna in Chalisgaon, North Maharashtra region, India
Arun Sawarkar
[ABSTRACT][DOWNLOAD]
PAGES: 196-199 | 6 VIEWS 4 DOWNLOADS
India
36 Leafhoppers and their morphology, biology, ecology and contribution in ecosystem: A review paper
Bismillah Shah, Yating Zhang [ABSTRACT][DOWNLOAD]
PAGES: 200-203 | 8 VIEWS 7 DOWNLOADS
China
Editorial Board
EDITOR-IN-CHIEF
Dr. B. S. Chandel (M.Sc., Ph.D., D.Sc. (Zoology-Entomology) FESI, FSLSc., FSESc., IAES, FANSF, SPPS. FAEB)
Associate Professor & Head
Biopesticides and Toxicological Laboratory, Department of Zoology, D.B.S. College, Affiliated to CSJM University, Kanpur, India
ASSOCIATE EDITORS
Dr. Surya Prakash Mishra (Ph.D., .Z.S.I., F.A.I.R., F.I.A.E.S., F.S.L.Sc.) Associate Professor and Head,
P.G. Department of Zoology, Ganpat Sahai P.G. College, Sultanpur, Uttar Pradesh, India
Rouhollah Radjabi (Ph.D.) Researcher
Plant Protection Department, Agricultural Faculty, Islamic Azad University, Dezful Branch, Dezful, Iran
Dr. Saroj Kumar Ghosh (M.Sc., M.Phil., Ph.D.) Assistant Professor,
Department of Zoology, Bejoy Narayan Mahavidyalaya, Itachuna, Hooghly, West Bengal, India
Dr. Abhishek Shukla (Ph.D.)
Senior Acarologist and Associate Professor
Department of Entomology Navsari Agricultural University, Navsari, Gujarat, India
Neeraj Kumar Sharma (Ph. D.)
Department of Zoology, H.N.B Garhwal University, Tehri Garhwal Uttarakhand, India
Dr. (Mrs.) Ranjana Saxena (M. Sc., Ph.D.) Associate Professor
Dyal Singh College, University of Delhi, Delhi, India
Dr. Hany M. R. Abdel-Latif ((DVM, MVSc, PhD) Lecturer of Fish diseases
Department of Poultry and Fish diseases, Faculty of Veterinary medicine, Alexandria University Edfina, Behera province, Egypt
Syed Ishtiaq Anjum (Ph.D.) Lecturer
Department of Zoology, Kohat University of Science and Technology, Kohat-26000, Khyber Pakhtunkhwa, Pakistan
Dr. Nayan Roy (M. Sc., Ph.D.) Assistant Professor
MUC Women’s College, Department of Zoology, West Bengal, India
Dr. Semra BENZER Assistant Professor
Education Faculty, Gazi University, Ankara, Turkey
Dr. Deepak Sumbria (Ph.D.)
Teaching Associate
Department of Veterinary Parasitology Post-Graduate Institute of Veterinary Education and Research jaipur, Rajasthan, India
Prof. Dr. Muhammad Faheem Malik (M. Sc., Ph.D.) Dean (Director) of Faculty of Sciences
University of Gujrat, Hafiz Hayat Campus, Gujrat, Pakistan
Dr. R. Raveen (M.Sc., M.Phil., Ph.D.) Assistant Professor,
Department of Zoology, Madras Christian College, Chennai, Tamil Nadu, India
Hameed Ur Rehman Researcher
Department of Chemistry, Kohat University of Science and Technology, Khyber Pakhtunkhwa, Pakistan
Dr. Selçuk Altınsaçlı (M. Sc., Ph.D.) Faculty of Fisheries,
İstanbul University, Istanbul, Turkey
Dr. Amit Tomar (M.Sc. Botany, Ph.D., F.L.S. London, D.Sc.) Assistant Professor
Department of Botany Meerut College, Meerut, Uttar Pradesh, India
Dr. Buddhadeb Manna (M. Sc., Ph.D.) Professor,
Department of Zoology, University of Calcutta, India
Mandakini Singla (Ph.D.) Lecturer
Govt Science College, Jagraon, Punjab, India
Dr. Meera Srivastava (M. Sc., Ph.D.) Head,
PG Department of Zoology Govt. Dungar College, Bikaner, Rajasthan, India
Dr.abid Farid (M. Sc., Ph.D.) Associate Professor/Head,
Department of Agriculture, University of Haripur, Haripur, Pakistan
Dr. Alexander V. Ilyinykh (Ph.D., D.Sc.,)
Institute of Systematics and Ecology of Animals SB PAS, Novosibirsk, Russia
Prof. Dr. Naim Saglam (M. Sc., M.A., Ph.D.)
Department of Aquaculture and Fish Diseases, Faculty of Fisheries, Firat University, Turkey
Prof. Dr. Ahmad-Ur-Rahman Saljoqi (M. Sc., Ph.D.) Professor,
Department of Plant Protection, The University of Agriculture, Peshawar, Pakistan
Prof. Dr. Emel Ergun (Ph.D.)
Department of Histology and Embryology, Faculty of Veterinary Medicine, Ankara University, Turkey
Dr. R.a. Tripathi Professor (Retd.),
Division of Entomology, C.S. Azad University of Agriculture and Techenology, Kanpur, Uttar Pradesh, India
Prof. Dr. Bilal Dik (D.M.V., Ph.D.)
Department of Parasitology, Selcuk University, Turkey
Prof. Abdurasulov Yrysbek (Ph.D.) Consultant,
FAO National Farm Animal Genetic Resources of Kyrgyzstan, Kyrgyzstan
Assoc. Prof. Dr. Mustafa Garip (D.V.M., Ph.D.)
Division of Animal Nutrition and Zootechnics, Faculty of Veterinary Medicine, Selcuk University, Turkey
Prof. Dr. Svetlana G. Nesterova (Ph.D.)
Department of Biodiversity and Bioresources, Faculty of Biology and Biotechnology, Al-Farabi Kazakh National University, Kazakhstan
Prof. Nogoybayev Mukambetov Daiyrovich Head,
Head of the Department of Internal Medicine Animals, Kyrgyz National Agrarian University, Kyrgyzstan
Dr. Oguzhan Avci
Department of Virology, Faculty of Veterinary, Medicine, University of Selcuk, Turkey
Dr. Varuna Verma (M.Sc., Ph.D.)
Environmental Engineering, Geetanjali Institute of Technical Studies, Dabok, Udaipur, India
Dr. Omer Kucuk (M.Sc., Ph.D.)
Chamber of forest Engineer, Society of Kastamonu University, Turkey
Associate. Prof. Dr. Hasan Kalyoncu (M.Sc., Ph.D.) Faculty of Art and Science,
Departmant of Biology, University of Süleyman Demirel, Isparta, Turkey
Dr. Hassan Nasirian (M.Sc., Ph.D.)
Department of Medical Entomology and Vector Control, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran
Dr. Youssef Dewer (M.Sc., Ph.D.)
Department of Biological Chemistry and Crop Protection, Rothamsted Research, Harpenden, United Kingdom
Dr.El-Sayed Abdel-Malek El-Sheikh (M.Sc., Ph.D.) Associate Prof.
Associate Prof. of Pesticides Biotechnology and Toxicology, Faculty of Agriculture, Zagazig University, Egypt
Dr. Soad I. Abd El-Razak Ramadan (M.Sc., Ph.D.)
Plant Protection Research Institute, Agricultural Research Center, Sabahia, Baccous, Alexandria, Egypt
Prof. Dr Moufid Yassine (Ph.D.) Tishreen university, Latakia, Syria
Dr. Muhammad Saeed Assistant Professor
Department of Agriculture, University of Haripur, Khyber Pakhtunkhwa, Pakistan
Dr. Ali Darvishzadeh (M. Sc., Ph.D.)
Department of Plant Protection, College of Agriculture and Natural Resources, University of Tehran, Karaj, Alborz, Iran
Prof. Dr. Uğur Uslu (M. Sc., Ph.D.) Vice Dean
Selcuk Universite, Veterinary Medicine Parasitology Department, Kampus-Konya, Turkey
Dr. Y. Norma-Rashid (Ph.D.) Professor,
Ecology & Biodiversity Programme, Institute of Biological Sciences, Faculty of Science, University of Malaya, Kuala Lumpur, Malaysia
Dr. Dushyant Mishra (Ph.D.) Research Associate,
Department of Molecular and Cellular Medicine, Reynolds Medical Bldg. Texas A&M Health Science Center, College Station, Texas, USA
Luis Carlos Martínez (Ph.D) Researcher
Department of Entomology, Universidade Federal De Viçosa, Minas Gerais, Brazil
Bolormaa Ganbaatar (Master) P.o.b 53/15.
Institute of Plant Protection, Ub. Khan-uul, Zaisan, Ulaanbaatar, Mongolia
Instructions to Author
Submit Manuscript: Manuscript can be submitted through email attachment at [email protected]
Download Copyright form. Click Here Download Sample Paper. Click Here
These articles should clearly describe new and carefully confirmed results and experimental procedure which should be given in required details for others to verify the work.
The manuscript should be prepared in English using "MS Word". "Times New Roman" font should be used. The font size should be of 12pt but main subheadings may be of 14pt. All research articles should have the following sections: Title page, Abstract, Key words, Introduction, Materials and methods, Results, Discussion, Conclusion, Acknowledgement (if any) and References.
Title: The title should then followed by the author name and the institution name and address by indicating suitable superscripts. Title page should contain title of the paper in bold face, title case, names of the authors in normal face, upper case (font size 12) followed by the address(es) in normal face lower case. An asterisk (*) must be placed after the corresponding authors name as superscript whose email id, fax, telephone number can be given. Corresponding author has the responsibility to ensure that all co-authors are aware and approve the contents of the submitted manuscript.
Abstract: This section should detail the problems, experimental approach, major findings and conclusion in one paragraph and should appear on the second page. Avoid abbreviation, diagram and references in the abstract.
Keywords: Author(s) must give key words which can identify the most important subjects covered by the paper.
They must be placed at the end of the abstract.
Introduction: The manuscript should include the purpose of the investigation and relating the manuscript to similar previous research. Only information essential to the arguments should be presented.
Materials and Methods: This section must contain specific details about the materials studied, instruments used, specialized chemicals source and related experimental details which allows other research worker to reproduce the results. Obtain permission for all fully borrowed, adapted, and modified tables and provide a credit line in the footnote. Results and Discussions The results should be concisely presented. Results and discussion may be separate or combined based on the author’s requirement. Tables and figures should be designed to maximize the comprehension of the experimental data. The interpreted results should be explained clearly in discussions and should relate them to the existing knowledge in the field as clearly as possible. Tables, Graphs and figures (Illustrations) should be inserted in to the main text at respective place they should appear when published and should have appropriate numbers and titles with an explanatory heading. Labels of the table, graph and figures MUST be in the text form and should not form part of the image. Colour photographs and illustrations (line drawings, halftones, photos, photomicrographs etc) must be clean originals or digital files would be charged that may be intimated along with the acceptance letter. Those photographs must be clear and sharp. Digital files are recommended for highest quality reproduction.
Acknowledgement (if any): This section can be kept at the end of the manuscript before reference section. This section can be used to acknowledge the help of those who do not qualify for authorship or to acknowledge funding, donated resources or significant contribution to the research.
References: References to the literature cited for the manuscript should be numbered in order of appearance in the manuscript and cited in the text with superscript numbers. The reference number should follow the following format.
For Journals Format: Author(s) of article (surname initials). Title of the manuscript. Journal title abbreviated Year of publication; volume number (issue number): page numbers.
Standard journal article (If more than six authors, the first six shall be listed followed by et al. )
Hornung H, Woolley K, Kori M L, Bennani L K, Bundgaard R K, Charles C S
et al. Anti-Inflammatory and analgesic activity of Jatropha gossypifolia in experimental animal models. Global Journal of Pharmacology 2009; 3(1):1-5.
For Books and other monograph Format: Author AB, Author BB, Author CC. Title of Book. Ed, Vol, Publisher, City, year, page numbers.
Faycal K M, Indian Materia Medica. Edn 3, Vol. I, London, 2000, 242-246.
For Patent Reference: H. Aviv, D. Friedman, A. Bar-Ilan and M. Vered. Submicron emulsions as ocular drug delivery vehicles, U.S. Patent US 5496811; 1996.
For Website Reference: Quick dissolving tablets. http://www.biospace.com. 27 may, 2001.
Ethical Matters: Authors involving in the usage of experimental animals and human subjects in their research article should seek approval from the appropriate Ethical committee in accordance with "Principles of Laboratory Animal Care". The Method section of the manuscript should include a statement to prove that the investigation was approved and that informed consent was obtained.
Indexing and Abstracting
International Journal of Entomology Research is indexed in following database.
Index Copernicus
Google Scholar
International Journal of Entomology Research
168 International Journal of Entomology Research
ISSN: 2455-4758
Impact Factor: RJIF 5.24 www.entomologyjournals.com
Volume 3; Issue 2; March 2018; Page No. 168-176
Molecular identification of house fly, Musca domestica L. (Diptera : Muscudae), using mitochondrial DNA partial genes cytochrome oxidase sub unit 1 (CO1) in Manado city
Ivonne E Rotty1, Odi Pinontoan2, Max Tulung3, Inneke Rumengan4*, Mokosuli Yermia Semuel5
1 Ph.D Student, Department of Entomology, Graduate Program, Sam Ratulangi University, Manado, Indonesia
2, 3 Professor in Entomology, Department of Entomology, Graduate Program, Sam Ratulangi University, Manado, Indonesia
4 Department of Entomology, Graduate Program, Sam Ratulangi University, Manado, Indonesia.
5 Laboratory of Bioactivity and Molecular Biology, Department of Biology, State University of Manado, Indonesia
Abstract
Musca domestica L. becomes a serious problem in tropical country. Its role as a vector of many pathogenic microbes has caused many health problems for humans. A study was conducted to identify house fly in Manado City, using partial gene cytochrome oxidase sub unit 1 (CO1). House fly is obtained from nine different habitats in Manado City. Isolation of DNA were used DNA extraction and purification Kit. Amplification of CO1 gene by PCR method. Sequence analysis using Geneous and MEGA 6.0.
The result of this research showed, the sequence of house fly CO1 gene : IBP, IBS, IBT, IKT, IMT and IPB have the highest similarity level with Musca domestica cytochrome oxidase subunit I (COI) gene [MG557665.1], while the CO1 gene of IKP and IKT has the highest similarity level with Musca domestica ISOLATE CSU 140601CBJI A $ cytochrome oxidase subunit I (COI) gene [KY001857.1]. CO1 gene of IKS showed similarity with Musca domestica ISOLATE CSU 140601CBJI A$ cytochrome oxidase subunit I (COI) gene. Intraspecies genetic variation of house flies in Manado city based on partial CO1 gene, are high.
Keywords: Musca domestica L., cytochrome oxidase sub unit 1 gene, Manado, Indonesia
Introduction
The house fly (Musca domestica L.) is the most frequent house fly species transmitting pathogenic bacteria in humans (Sembel, 2008; Kassiri et al. 2012) [8]. House flies can act as vectors of transmission of gastrointestinal diseases, such as cholera, dysentery, typhoid and also carry protozoa, eggs and worm larvae (Santi, 2001; Chandra, 2005). Furthermore, house flies are considered as annoying insects because it is a mechanical vector of several diseases including gastrointestinal infections (Hastutiek, 2007). Transmission of the disease mechanically, i.e. through all parts of the body flies. Disease germs from animal feces, humans and trash can stick to body hair, hairs on legs and probosis. House fly, can spread Helicobacter pylori, Escherichia coli, Cryptosporidium parvum, even H5N1 virus (Hastutiek, 2007.
Manado city has 16 working areas of Community Health Center (Loacal Name : Puskesmas). In 2015, the total population of Manado City amounted to 425,633 inhabitants.
Diarrhea disease in Manado City 2014 reportedly amounted to 3174 patients; in 2015 increased to 4967 sufferers. For the work area of Puskesmas Minanga, 2015 was 180 patients, Puskesmas Bahu was 260 patients, Puskesmas Ranotana was 284 patients and Puskesmas Wenang was 182 patients.
Government General Hospital, Prof. Dr. R.D. Kandou, in 2015 reportedly handles 480 diarrhea sufferers. Diarrhea is one of the 10 largest infectious diseases in North Sulawesi. In many reports, the highest cases of diarrhea in areas with poor sanitation in Manado City (BPS Sulawesi Utara, 2015) [2]. Based on previous research, population of house fly, at
various location in Manado city, founded mixed population of flies with other flies species. Morphological studies have found variations in morphological characteristics such as wing length, body length, head structure, compound eye color, limb structure and abdominal structure of houseflies originating from various locations in Manado City (Rotty, 2017).
However, morphological characteristics have not been sufficient to distinguish the species of house fly, which exist in Manado city. Answering the problem was a genotypic analysis using mitochondrial DNA of CO1 gene as a molecular barcode used universally for animal identification.
The structure and composition of the genetic information contained in mitochondrial DNA has been extensively researched, can characterize a population, phylogenetic and make it possible to reconstruct evolutionary history (Hebert et al. 2003; Lessinger et al., 2000; Mokosuli, 2013) [6, 10]. Mitochondrial DNA is maternalistic, so there is no recombination with parental male mitochondrial DNA (Nelson and Cox, 2005; Alberts et al. 2005) [15, 1]. In mitochondrial DNA, there is a conservative region that can be used to construct an animal evolutionist relationship (Bruce et al. 2006; Hebert et al. 2003) [6]. Since, Cytochrome c oxidase subunit 1 (CO1) gene is considered as one of the widely used markers in the studies of population genetics and evolution (Hebert et al. 2003; Shao et al., 2007) [6] because it is among the most conservative protein-coding genes found in the mitochondrial genomes of animals (Bruce et al. 2006). The cytochrome oxidase sub unit 1 (CO1) is one of the genes present in the mitochondrial genome and is widely used for
International Journal of Entomology Research
169 animal molecular identification. The application of a universal
CO1 gene for molecular identification of insects in North Sulawesi has been done on Apis dorsata Binghami (Mokosuli, 2013) [14], Aedes sp. (Kaunang et al. 2015), Anopheles sp.
(Manuahe et al. 2016) [12]; (Timah and Mokosuli, 2017) [20], and bed bugs (Kalangi et al. 2016) [9], marine gerridae (Warouw et al. 2015) [23], frehwater gerridae (Waha et al.
2016) [22] and demselfly (Rantung et al. 2015).
Materials and Methods Samples
Adult home fly is obtained by direct capture technique. The location of catching house flies, done in some places in Manado, among others, traditional markets, residential areas and bus terminals. Flies captured, preserved in 70% ethanol.
Subsequently used as a sample for DNA analysis. Body parts of flies used as tissue sources for DNA extraction are thorax and legs. This research was conducted in Laboratory Bioactivity and Biology Molecular, Department of Biology, Manado State University. DNA sequencing using ABI PRISM 3730xl sequence Genetic Analyzer engine developed by Applied Biosystems, USA, at First BASE Laboratories Sdn Bhd, Singapore.
Tools and Materials
The tools used in this research were : tissue ruptor (Qiagen), vortex V-1 plus (Biosain), orbitals shaker OS-20 (Biosain), micropipette (eppendorf), mini personal centrifuge Tommy Digital Biology, P-class Nanofotometer, centrifuse 5430R (eppendorf), master cycles pro s (eppendorf), gel documentation system fire reader UVitec, Qiaxel automatic electrophoresis (Qiagen), sequence ABI PRISM 3730xl Genetic Analyzer develop by Applied Biosystems, USA. The materials used are: ethanol p.a. (merck), chloroform p.a.
(merck), Genomic DNA Mini KIT (Tissue) Geneaid, 2x MyTaq HS Red Bioline Mix (USA), Qiaxel DNA Screening gel kit and 2 μl tips - 100 μl Qiagen, CO1 Universal primer:
LCO1490: GGTCAACAAATCATAAAGATATTGG HCO2198: AACTTCAGGGTGACCAAAAAATCA (Folmer et al. 1994),
DNA extraction and purification a. Extraction of house fly DNA
DNA extraction and purification using the Geneaid Mini KIT (Tissue) Genomic DNA procedure. Initial stage before entering on extraction is tissue dissociation consisting of taking 30 mg tissue legs and thorax of house fly, then inserted in vial eppendof 1,5 ml. In the vial, 200 μl of GT Buffer is added. Furthermore, 20 μl Proteinase K was added. The incubation was modified from 30 minutes to 24 hours. The next step follows the Kit protocol. The result of DNA extraction of house fly, then analyzed the concentration and purity by using Implant nanophotometer. DNA purity can be seen with an A260 / A280 ratio of between 1.8 - 2.0 nm. If
<1.8 is contaminated with protein and or protein derivate contaminant components that affect DNA molecules, and if>
2.0 means contaminated with RNA (Protocol Kit).
b. Amplification of house fly CO1 gene, by PCR method The PCR process used 2x MyTaq HS Red Mix Bioline (USA) and CO1 primer is Forward LCO 1490:
5'GGTCAACAAATCATAAAGATATTGG3' and Reverse HCO 2198: 5'TAAACTTCAGGGTGACCAAAAAATCA3'.
The PCR component and PCR conditions applied are shown in Table 1 and Table 2.
Table 1: PCR Component
PCR Component Volume (µL) 2x MyTaq HS Red Mix Bioline 25
Primer Forward 1
Primer Reverse 1
DNA of house fly* 2
ddH2O 21
Total 50
Table 2: PCR Condition
Cycle Time (Seconds) Temperatur (°C) Phase 35 x
60 94 Denaturasi
30 50 Annealing
30 72 Ekstension
60 72 Final Ekstension
Visualization of PCR products
Amplicons of CO1 gene of house flies, produced at the PCR stage, were visualized using automatic electrophoresis (Qiaxel), by applying a Qiaxel DNA Screning gel (Qiagen) kit. Visualization of PCR results was also performed using conventional electrophoresis.
Sequences analyses and phylogeny trees reconstruction Obtained sequences were aligned using MEGA 6.0 and Geneous 6.0 software. Sequences were subjected to Basic Local Alignment Search Tool (BLAST) in order to perform sequence similarity searches (www.ncbi.nih.gov.com).
Nucleotide frequencies were calculated using MEGA 6.0 software (Tamura et. al. 2013) [19]. The genetic distances (number of nucleotide substitutions per site) among sequences were calculated using the Maximum Composite Likelihood model in Geneous 6.0 software. Phylogenetic trees were reconstructed using two different reconstruction methods: (1) neighbor joining (NJ) and (2) Minimum Evolution (ME). The NJ tree was reconstructed using the Maximum Composite Likelihood method. Phylogenetic analyses were conducted in MEGA 6.0 software. Bootstrap support values were obtained by 1,000 replications using both methods (Tamura et. al.
2013) [19].
Results and Discussion
DNA extraction of house flies (Musca sp.) from Manado city
The highest DNA purity of nine house flies samples was 1,75 (sample IKP). While the lowest DNA purity was 1,55 (IKT Samples). In the other hand, the highest DNA concentration was 53.2 µg/ml (IMT sample) while the lowest total DNA concentration was 40.25 µg/ml (IBP sample). DNA purity is not linear, with the DNA concentration of house flies obtained
(Figure 1).
International Journal of Entomology Research
170 Fig 1: Concentration and Purity dsDNA of house fly from Manado City
Based on the concentration and purity of the extracted DNA, it showed that the Genomic DNA Mini KIT (Tissue) Geneaid, which is used to extract house fly DNA, has effective in extracting total DNA from legs and thorax flies. The difficulty in extracting insect DNA, compared with other animal samples is the number of complex biomolecule contaminants from the exoskeleton. Common contaminants found in insect DNA extraction are chitin, complex proteins and peptides from exoskeleton. This contaminant may decrease the effectiveness of buffers and proteinase enzymes in the kit (Timah and Mokosuli, 2017; Manuahe et al. 2015; Mokosuli, 2013) [20, 14]. In this research, modification of protocol kit is done by the destruction of thorax and legs, using tissue ruptor and tissue immersion time with protenase K according to protocol kit, 30 minute has modified to 24 hours. This modification proved to increase the concentration and purity of the house fly DNA extraction results. The total DNA concentration distribution based on the Kit protocol used was 30 μg / ml up to 70 μg / ml. Thus the total DNA concentration obtained in this study is quite good. While total DNA purity is at the distribution of 1,7 - 2,0 (A260 / A280). Total DNA purity of the results of this study is still quite good. However, the mitochondrial DNA content present in extracted DNA is known after amplification of the target gene, using a universal CO 1 primer.
PCR and Visualization of Amplikon Gen CO1 Home Flies (Musca sp.) From Manado
Extracted DNA, amplified by PCR method. Of the 4 stages of PCR, the annealing is the most important stage, so temperature and time modification greatly affect the optimization of CO1 gene amplification. In this study, modified annealing temperatures are proven to produce amplicons as targeted. Visualization of amplicons content of CO1 gene is done by electrophoresis technique.
Electrophoresis condition was 0.8% agarose gel, the number of ladder DNA that is applied to each well 0.2 μg with the
volume of samples per well 1 μl. The band on the electrogram shows the amplicon content of the flies CO1 gene successfully amplified by the PCR method. The PCR results show that sample amplicons are 6. (IKP), 7. (IKT), 8. (IKS), 9. (IMT), 10. (IPB). was formed optimally while sample 3. (IBS), 4.
(IBP), the band is very thin (Figure 2).
Fig 2: Visualization of CO1 gene amplicons, house flies from Manado City. Description :1. (control) 2. (IBT), 3. (IBS), 4. (IBP), 5.
(IMS), 6. (IKP), 7.(IKT), 8. (IKS), 9. (IMT), 10. (IPB).
Sequensing
Output sequencing from First BASE Singapore, read with Geneous 10.1. and MEGA 6.0. Based on the chromatogram of sequenced results, the sequencing showed well. This is evidenced by chromatogram bands representing different types of nucleotides perfectly or not coincident (Appendix 1.).
After the contig analysis, the length of the CO1 gene sequence of flies from Manado was between 558bp - 691 bp and HQ (68.5% - 92.8%). Characteristics of the CO1 fly gene sequence from Manado were then shown in Table 2. The sequence of CO1 gene lies at length 600 - 700 bp (Herbert, 2003). Thus, the nine sequences of the fly fly CO1 gene from Manado were on the long-range CO1 gene, according to the characteristics of the CO1 gene as molecular barcodes for animal identification.
