This thesis focuses on the construction of molecular nucleic acid tools that work with HCR. First, we demonstrate that in addition to being an isothermal, enzyme-free method for nucleic acid detection, HCR is also highly selective.
Introduction
For these reasons, the use of qRT-PCR as a clinical diagnostic has increased over the past decade. Finally, qRT-PCR relies on a thermocycler, which in turn limits both the speed of the method and the use of the method in point-of-care settings.
Detection of SNPs with Hybridization Chain Reaction
In the presence of an oligonucleotide (T) complementary to the base and half of the stem of hairpin 1 (h1), the metastable hairpins form polymers. In the presence of a target (T0) that has a single mismatch (illustrated in green) with respect to T, the hairpins maintain their closed structure.
Kinetic Control of HCR via ∆G Tuning
Thus, tuning the energetics of h1 addition to T leads to a similar tuning of h1 addition to h2-terminated polymers. Our ∆G tuning approach therefore focused on the free energy of addition from h1 to T, and from h2 to T·h1.
Experimental Verification of Kinetic Control of HCR
The red system is HCRslow; the grip and loop of its h1 component are shown in red, and its stem part is shown with a dashed red line. G values (in kcal/mol) of duplex formation between the 4-nt loop sequence and its reverse complement and between the 4-nt loop sequence and its reverse complement.
Effect of Mutation Location on SNP Discrimination
Seeking to determine the locus(s) that optimize discrimination, HCR systems were fixed (one system was incubated with the targets shown in panels A and B and another HCR system was incubated with the targets shown in panels C and D); the SNP type, eg, C→G in panel A, as well as the SNP's nearest neighbors, were also kept fixed in each of the four panels. SNPs located in the first half (relative to the foot brace) of the h1 stream provide discrimination ratios that are as good as, or better than, those obtained from SNPs located in either the the foot of h1 or in the second half of the flow of h1. For example, the data collected by T04 in panel A reveal that a C→G mutation with A/A nearest neighbors should not be placed too close to the h1 loop.
Detection of SNP Cancer Markers
Improving HCR Discrimination with Scavenger
The discrimination ratios obtained with HCR-mediated SNP detection depend on ∆∆G of the first step of HCR (the free energy difference between T·h1 and T0·h1). We therefore expect that HCR will yield poor discrimination ratios in the presence of SNPs that yield small ∆∆G values. Of such SNPs, G → A is the most difficult to detect in RNA-RNA hybridization because its detector-target (h1U·TA) energetics are nearly isoenergetic to the detector-off-target energies (h1U· TG) [41, 53]. leading to poor discrimination ratios in the absence of Scavenger (Figure 2.5, compare lanes 2 and 3).
Scavenger is a single-stranded oligonucleotide that hybridizes to T0 and has an SNP when hybridized to T (Figure 2.5, panels A and B, respectively).
SNP Profiling via HCR Multiplexing
In Section 2.6, we demonstrated that multiplexing with two HCR systems in one tube is feasible. Thus, arbitrary nucleotide identity was selectively determined using four HCR systems in one tube. Using the four HCR systems presented in Figure 2.7, we found it beneficial to increase the concentration of HC and HG 2× relative to HA and HU.
We increased the concentration of HG as it was relatively slow to polymerize compared to the other HCR systems.
Detection of SNPs in Long RNA
Each of four different targets triggers the polymerisation of its complementary HCR system, but not of other HCR systems. The sequence variation between the four targets used in this study is highlighted in orange. The sequence window with which each of the four HCR systems is designed to hybridize is marked by a solid line (toe of h1) and a dashed line (stem of h1).
An 872-nt transcript consisting mainly of the sequence of the d2EGFP gene, as well as a C→G SNP variant of it, were incubated with a Cy3-modified HCR system designed to detect the unmodified transcript, and a Cy5-modified HCR system. system designed to detect the SNP variant of the transcript.
Conclusion
Real-time PCR for single-nucleotide polymorphism detection in the 16S rRNA gene as an indicator for extensive drug resistance in Mycobacterium tuberculosis. Improving resolution and statistical power using mass spectrometry for detection of SNPs within the short tandem repeats. 22] Tiveljung-Lindell, A. et al. Development and implementation of a molecular diagnostic platform for daily rapid detection of 15 respiratory viruses. Journal of Medical Virology.
Identification of the JAK2 V617F mutation in chronic myeloproliferative disorders using FRET probes and melting curve analysis.
Introduction
At the same time, the sensitivity improvement seen with qRT-PCR requires the use of a thermocycler. Since NESA requires both a thermocycler and enzymes (DNA ligase and DNA polymerase), the limitations of NESA in a point-of-care setup are the same as those faced by qRT-PCR. In this chapter, we explore Quenched HCR as a new method for bulk nucleic acid detection.
Quenched HCR combines some of the positive features of molecular beacons with those of qRT-PCR.
Design of 2-Hairpin and 4-Hairpin Quenched HCR
However, with the internally labeled 2-hairpin Quenched HCR (Figure 3.1 panel C), the distance between the quencher and the fluorophore in the polymer is predicted to be large enough to facilitate the use of small DNA hairpins with toe/loop sizes of 6-nt, and stem sizes of 18-19-nt. Internally labeled 2-hairpin Quenched HCR was not studied here because internally labeled hairpins are difficult to synthesize. R6, where R is the distance between the fluorophore and the quencher [15], and for our choice of quenchers, the distance at which the quencher has ~50% efficiency is reported to be between 3–7 nm by the manufacturer (IDT) [ 16 .
Accordingly, Cy3 and Cy5 were chosen as the fluorophores with which to label the Quenched HCR systems.
Analysis of 2-Hairpin and 4-Hairpin Quenched HCR
To analyze quenched HCR, we designed 2-periodicity and 4-periodicity hairpin quenched HCR systems that detect the cancer markers BRAF T→A, JAK2 G→T, and PTEN C→G (Section 2.6). As shown in Figure 3.2, HCR systems with 4-hairpin periodicity were successfully designed for all three targets. Among the HCR systems with 2-quenched hair periodicity that were tested, P3 and P2 were successfully implemented, with the former performing better.
Finally, we note that an RNA-based 4-hairpin periodicity Quenched HCR has also been designed and successfully implemented (Appendix B.3).
Multiplexing Quenched HCR
We denote these targets as T1, T2, and T3, respectively, 2-hairpin periodicity Quenched HCR systems detecting them as P1, P2, and P3, respectively, and 4-hairpin periodicity Quenched HCR detecting the targets as Q1, Q2, and Q3, respectively. Two test tubes containing either the JAK2 cancer marker T2 or the PTEN cancer marker T3 were incubated in the presence of two 4-hairpin periodicity Quenched HCR systems (Q2 and Q3 designed to detect T2 and T3, respectively). Quenched HCR system 2 is labeled with Cy3 and monitored using a 515-530nm excitation filter and a 560-580nm emission filter.
Quenched HCR system 3 is labeled with Cy5 and monitored using 620-650nm excitation filter and 675-690nm emission filter.
Conclusion
Improved fluorescent in situ hybridization method for detection of bacteria from activated sludge and river water using DNA molecular beacons and flow cytometry. Real-time PCR using molecular beacons: a new tool to identify point mutations and to analyze gene expression in mycobacterium tuberculosis. Graphene surface-anchored fluorescence sensor for sensitive detection of microRNA coupled with enzyme-free signal amplification of hybridization chain reaction.
Introduction
Molecular beacons can thus be seen as conditional probes that undergo an activated reaction in which their stem-sequestered sequences change into single-stranded sequences only in the presence of target. Although molecular beacons are inherently conditional sequence transducers, they have found very limited use as such, and have instead been used primarily as fluorescent reporters1. However, unlike molecular beacons that transduce sequence A-to-light, we propose to engineer CPs to transduce sequence A-to-sequence B.
1Since molecular beacons are dually labeled with a fluorophore and a quencher at the 50-end and 30-end of their stems, respectively, the target-mediated perturbation of the stem that molecular beacons undergo results in a measurable increase in the fluorescent signal.
Design of Conditional Probes
Wilner's group used sequence transducers to form DNAzyme nanowires [5, 6], and Ellington's group used sequence transducers for DNA catalytic circuits2 [7]. Our molecular designs have focused on DNA-based conditional probes, due to their resistance to degradation and low cost, and RNA-based targets, due to their biological interest.
Experimental Verification of Conditional Probe Function
Cancer markers BRAF T → A, JAK2 G → T and PTEN C → G, denoted T1, T2 and T3 respectively, are orthogonal to each other. In Chapter 3 it was shown that these target sequences selectively activate Quenched HCR systems Q1, Q2 and Q3. Here, the quenched HCR systems Q2 and Q3 are triggered by target sequences orthogonal to their own sequences in the presence of relevant foot-holding conditional probes.
Conditional probes (CPs) are denoted by superscript indices indicating the target entity and the Quenched HCR system between which the CPs mediate.
Multiplexing via Conditional Probe and Quenched HCR
Detection of Long RNA
Conclusion
Therefore, any new target one wishes to discover requires the design, synthesis and characterization of a new Quenched HCR system. Furthermore, in vitro characterization of quenched HCR is time-consuming, and characterization of quenched HCR cells is time-consuming. We expect that the latter will often be a more convenient approach for users of Quenched HCR.
When the quenched HCR is hybridized directly to the target, i.e., without the use of conditional probes, the stem length of the quenched HCR strands depends on the G/C content of the target.
Methods
Appendix to Chapter 2 . experiment presented in Section 2.8 contained 2µM of each hairpin of HCR systems HC and HG; and 3) the experiment presented in Section 2.9 used 0.715 µM targets. HCR reactions were run for 1 hour at 37◦C, unlike the reaction involving the detection of long RNA (Section 2.9), which was run for 18 hours and 23 minutes. Imaging of all hairpins, except those conjugated to Alexa750, was performed on a FLA-5100 laser scanner (Fujifilm, Stamford, CT).
Imaging of Alexa750-modified hairpins was performed on Li-Cor's (Lincoln, NE) Odyssey machine, which uses a 785nm laser and collects emission above 810nm.
Strand Sequences
Giddugaleessa RNA h1 (HA) 36 UCCACACAGAAACAUACUCCUCUUGGAGUAUGUUUCUG 423 Giddugaleessa RNA h2 (HA) 36 /5Alex647N//iSp9/GGAGUUGUUUCUGUGGACAGAAACAUACUGAGUGUGUAUGUUCUG CCACAGACACAUACUCCA 447 Giddugaleessa RNA h2 (HC) 38 UCUCCACAGACAU CUGGAGUUGUGUGUGUGGA/iSp9//3AmMO/(Aleksaa532) 461*. Maqaa Meeshaa Paanaalii # (nt) Tartiiba (50 hanga 30) Istookii # RNA h1 1 36 RNA h1 1 36 RNA h2 1 36 RNA h1 2 36 RNA h1 502 h2 RNA 2 36 H1 RNA (HA) 35 /5GAACAUGGG7 UUCAUCCCUUUCCA 492 RNA h2 (HA) 36 AUGACCAGUUCAUCCCUUUGGAAAGGGAUGAACUGG 493 CAASAA RNA h1 (HC)/iSp9//3AmMO/(Cy5) 517*.
RNA h1 (HG) 36 RNA h1 (HG) 36 RNA h1 (HG) 36 RNA h1 (HG) 36 RNA h1 (HG) 38 RNA h1 (HU) 38 RNA h1 (HU) 38 RNA h1 (HU) 3AmMO/( Aleeksaa488) 516*.
Methods
Once in a homogeneous mixture, the test tubes were placed in Bio-Rad's CFX-96 Real-Time PCR machine and incubated at 25◦C. After the optical capture of Quenched HCR, test tubes were removed from the real-time PCR machine and analyzed on a gel. Background is defined as the average of three or four measurements that took place before the addition of test tubes to the real-time PCR machine.
2Multiplexing Figure 3.3 contains background-subtracted data normalized to the maximum recorded in each of the two channels.
Background-subtracted Data of Quenched HCR Multi- plexingplexing
Sensitivity of Quenched HCR
RNA-based Quenched HCR
Fast Target Detection with Quenched HCR
To design a fast polymerizing Quenched HCR system, we implemented ∆G tuning, which is described in Section 2.3. As shown in Figure B.4, we were able to generate a quenched HCR system (F3) that reaches a maximum fluorescence signal in ∼1 h. The slope of the curve around the first time point indicates that most of the polymerization occurs in the first few minutes of the reaction.
This fast-to-polymerize Quenched HCR system involved hairpins with long toe holds and was therefore realized in 2-hairpin periodicity (Figure 3.1).
Strand Sequences
Methods
Strand Sequences
