SUPPLEMENTAL MATERIAL
Supplemental Spreadsheet 1. Intrinsic variability RNA-Seq method (sham control vs. sham
control comparison) in the CCDs three hours after UUO
Supplemental Spreadsheet 2. Lists of gene sets for regulatory pathways three hours after UUO
Supplemental Spreadsheet 3. DAVID gene enrichment analysis with KEGG pathways and Gene
Ontology Biological Process terms in microdissected CCDs three hours after unilateral ureteral
obstruction (UUO)
Supplemental Table 1. mRNA abundance changes for aldosterone targets in microdissected
CCDs three hours after UUO
Supplemental Table 2. Secreted proteins increased in both CCDs and CTALs three hours after
UUO
Supplemental Table 3. Transcript abundance changes in microdissected CCDs of rats at 30 mins
after UUO.
Supplemental Figure 1. Primer sequences for RT-qPCR
Supplemental Figure 2. Female rats with unilateral ureteral obstruction (UUO) display
downregulation of AQP2 in ipsilateral kidney.
Supplemental Figure 3. Principal component analysis (PCA) of RNA seq data.
Supplemental Figure 4. Activation of aldosterone-regulated genes after UUO.
Supplemental Figure 5. Time course of the P-bodies after UUO.
Supplemental Figure 6. Decreased AQP2 abundance in culture collecting duct cells (mpkCCD)
after lipopolysaccharide (LPS).
Supplemental Table 1. mRNA abundance changes for aldosterone targets in microdissected cortical collecting ducts (CCDs) three hours after unilateral ureteral obstruction (UUO).
Gene
Symbol Annotation
Mean Sham TPM
Mean UUO TPM
Mean Log2
(UUO/
Sham)
SD Log2
(UUO/
Sham)
P
Tnfrsf12a tumor necrosis factor receptor superfamily member 12A 40.3 938.4 4.390 1.021 0.003 Atf3 cyclic AMP-dependent transcription factor ATF-3 8.9 38.0 2.816 1.053 0.013 Isg20 interferon-stimulated gene 20 kDa protein 3.6 10.3 2.103 1.255 0.044
Krt8 keratin, type II cytoskeletal 8 355.9 1318.0 1.850 0.485 0.005
Krt18 keratin, type I cytoskeletal 18 917.0 3362.7 1.819 0.811 0.020 Gadd45g growth arrest and DNA damage-inducible protein GADD45 gamma 392.7 1117.7 1.420 0.739 0.031 Fkbp5 peptidyl-prolyl cis-trans isomerase FKBP5 2.8 5.9 1.085 0.491 0.021 Marveld3 MARVEL domain-containing protein 3 9.8 19.0 0.980 0.201 0.002
Tsc22d3 TSC22 domain family protein 3 42.7 87.6 0.974 0.492 0.029
Usp2 ubiquitin carboxyl-terminal hydrolase 2 46.4 87.2 0.877 0.525 0.044
Kras GTPase KRas 4.4 7.4 0.704 0.764 0.163
Eif1 eukaryotic translation initiation factor 1 970.4 1507.5 0.633 0.084 0.001 Sgk1 serine/threonine-protein kinase Sgk1 566.9 768.0 0.618 0.670 0.162
B2m beta-2-microglobulin 54.6 83.0 0.598 0.549 0.117
Scnn1a amiloride-sensitive sodium channel subunit alpha 25.9 36.0 0.500 0.347 0.064 Ptpn1 tyrosine-protein phosphatase non-receptor type 1 10.6 15.1 0.451 0.413 0.117
Nme2 nucleoside diphosphate kinase B 531.4 729.4 0.449 0.354 0.085
Rpl12 60S ribosomal protein L12 47.3 62.3 0.379 0.417 0.167
Crem cAMP-responsive element modulator 51.5 63.3 0.330 0.536 0.305
Atp1b1 sodium/potassium-transporting ATPase subunit beta-1 645.7 760.0 0.220 0.408 0.360
Cstb cystatin-B 990.6 1028.4 0.046 0.231 0.717
Slc4a1ap kanadaptin 5.2 5.6 0.016 0.739 0.968
Rpl26 60S ribosomal protein L26 490.3 475.4 -0.046 0.072 0.292
Akt2 RAC-beta serine/threonine-protein kinase 22.7 21.9 -0.050 0.282 0.744
Serinc3 serine incorporator 3 147.2 132.1 -0.156 0.066 0.018
Dars aspartate--tRNA ligase, cytoplasmic 84.6 70.6 -0.268 0.354 0.227
Clta clathrin light chain A 119.4 100.3 -0.269 0.502 0.363
Mpg DNA-3-methyladenine glycosylase 17.0 14.2 -0.279 0.245 0.107
Rps29 40S ribosomal protein S29 135.7 108.5 -0.439 0.389 0.109
Mrpl1 39S ribosomal protein L1, mitochondrial 9.3 5.4 -0.728 0.544 0.075
Fbxl6 F-box/LRR-repeat protein 6 10.6 6.2 -0.768 1.080 0.250
Nedd9 enhancer of filamentation 1 30.9 17.1 -0.886 0.457 0.030
Grem2 gremlin-2 5.1 0.9 -2.429 1.057 0.019
A comprehensive list of aldosterone-responsive genes was extracted from references.
5, 30-33 Pvalues based on paired T-test.
Supplemental Table 2. Secreted proteins increased in both cortical collecting ducts (CCDs) and cortical thick ascending limbs of Henle’s loop (CTALs) three hours after unilateral ureteral obstruction (UUO).
Gene symbol Annotation
CCD Log
2(UUO/
Sham)
CTAL Log
2(UUO/
Sham)
Afm afamin 4.073 1.752
Angptl4 angiopoietin-related protein 4 7.400 8.014
Apoc2 apolipoprotein C-II 2.529 2.330
Apoe apolipoprotein E 1.663 1.046
Apom apolipoprotein M 2.902 3.823
Cela1 chymotrypsin-like elastase family member 1 1.521 1.235 Hbegf proheparin-binding EGF-like growth factor 2.998 3.706 Lcn2 neutrophil gelatinase-associated lipocalin 3.766 2.351
Napsa napsin-A 2.378 2.410
Pm20d1 N-fatty-acyl-amino acid synthase/hydrolase PM20D1 2.214 2.622 Serpinf1 pigment epithelium-derived factor 2.343 1.750
Serpinf2 alpha-2-antiplasmin 2.938 1.716
Tff3 trefoil factor 3 2.361 2.385
Timp1 metalloproteinase inhibitor 1 2.489 1.040
Supplemental Table 3. Transcript abundance changes in microdissected cortical collecting ducts (CCDs) of rats at 30 mins after unilateral ureteral obstruction (UUO). Values with
Pttest< 0.05 shown in bold based on paired T-test.
Gene Symbol
Gene Annotation Mean sham
control TPM
Log
2( UUO30m ins /Sham)
P
Aqp2 aquaporin 2 4887 -0.73 ± 0.35 0.025
Aqp3 aquaporin 3 2162 -0.35± 0.78 0.434
Aqp4 aquaporin 4 62 -0.29± 1.08 0.627
Atp1a1 ATPase Na
+/K
+transporting subunit alpha 1 359 -0.69± 0.08 <0.001 Atp1b1 ATPase Na
+/K
+transporting subunit beta 1 1018 -0.69± 0.33 0.026 Avpr2 arginine vasopressin receptor 2 492 -0.36± 0.70 0.377 Clcnkb chloride voltage-gated channel Kb 1459 -0.33± 0.40 0.195 Fxyd2 FXYD domain-containing ion transport regulator 5960 0.46± 0.50 0.160
Kcnj1 ROMK 995 -0.38± 0.51 0.234
Scnn1a ENaC alpha subunit 80 -0.97± 1.22 0.216
Scnn1b ENaC beta subunit 533 -0.44± 0.52 0.190
Scnn1g ENaC gamma subunit 578 -0.47± 0.88 0.364
ATPase, adenosine triphosphatase; ENaC, epithelial sodium channel; ROMK, potassium voltage-gated
channel subfamily J member 1; TPM, transcripts per million. Values are mean ± SD.
A
B
Target Gene Amplicon Size (bp) Forward Primer (5'-3') Reverse Primer (3’-5')
Aqp2 126 CTTCCTTCGAGCTGCCTTC CATTGTTGTGGAGAGCATTGAC
Atp1a1 215 GGCGCTCTTAAAGTGCATCG TGCCGTGGAGGAGGATAGAA
Aqp2 Atp1a1
100 200 500 1000 bp
Supplemental Figure 1. Primer sequences for RT-qPCR.Primer sequences for RT-qPCR Primer sequences and expected amplicon size for each transcript target are listed in (A). Primer specificity was tested by regular PCR using cDNA extracted from cortex samples in rats administrated with lipopolysaccharide (LPS) or 0.9% saline (vehicle) prior RT-qPCR. An agarose gel image (B) shows the amplicon size for each indicated primer-pair.
36
A
C
kDa
28
Sham 6 24
Gly-AQP2 Non-
Gly-AQP2 Coomassie Time (hr) after UUO
B
Female S-D Rats
Hours Sham 6 24
Start UUO
Sampling times
Immunoblotting
55
Supplemental Figure 2. Female rats with unilateral ureteral obstruction (UUO) display downregulation of AQP2 in ipsilateral kidney. (A)
Experimental Design. UUO or sham was followed by measurements at the
indicated time points. (B) Immunoblot for AQP2 in the whole kidney at 0, 6,
and 24-hours post-UUO (n=3 per time point). (C) Quantification of band
density of blot B (n=3 per time point, p values as indicated, one-way
ANOVA with post hoc Dunn’s Multiple comparison test).
A
B
CCDs
CTALs
UUO Sham
C
UUO3h UUO6h
UUO12h
Sham12h Sham6h
Sham3h
Sham0h-1
Sham0h-2
Principal component scatter plot of bulk kidney RNAseq
Principal component 1 (39.8%)
Pr in ci p al co m p on e n t 2 (20 .7% )
Principal component 1 (18.3%)
Pr in ci p al co m p on e n t 4 (8. 3% )
Principal component scatter plot of UUO3hrs RNAseq
Principal component scatter plot of UUO3hrs RNAseq
Principal component 1 (26.5%)
Pr in ci p al co m p on e n t 2 (17 .1% )
UUO 1
UUO 2
UUO 4 UUO 3 Sham 4
Sham 3
Sham 2 Sham 1
Sham 3-1
Sham 3-2 Sham 2-1 Sham 4-1
Sham 4-2 Sham 1-1
Sham 1-2 Sham 2-2
UUO 1-1 UUO 2-2 UUO 4-1 UUO 2-1
UUO 4-2 UUO 3-1
UUO 3-1 UUO 1-2
Supplemental Figure 3. Principal component analysis (PCA) of RNA seq data showed unilateral ureteral obstruction (UUO) (red) or sham surgery (green) samples from bulk kidney RNA-seq at 0, 3, 6, and 12-hour time points (A), microdissected cortical
collecting ducts (CCDs) (B) and cortical thick ascending limbs of
Henle’s loop (CTALs) (C) at 3 hours after UUO.
-2 -1 0 1 2 3 4 5 6
Aldosterone regulated genes
Sgk1
Scnn1a Tsc22d3 Tnfrsf12a Usp2
Sham 3 hrs 6 hrs 12 hrs Log 2 TPM (UUO/Sh am)
Time (hr) after UUO
Supplemental Figure 4. Activation of Aldosterone-regulated genes after unilateral ureteral obstruction (UUO). Bulk kidney RNA-seq values for log 2 TPM(UUO/Sham)
were plotted for select aldosterone-regulated genes at 3, 6, and 12 hours after UUO.
Sgk1 (blue), Scnn1a (red), Tsc22d3 (grey), Tnfrsf12a (yellow), Usp2 (green).
A
AQP2 DDX6
Sham
B
30mins
AQP2 4E-T
3 hrs 6 hrs 12 hrs
Sham 30mins 3 hrs 6 hrs 12 hrs
Supplemental Figure 5. Time course of dynamics of the P-bodies after UUO. (A) Representative
immunofluorescence for P-body scaffold proteins DDX6 and 4E-T (green) in cortical collecting ducts (CCDs) (AQP2 is
shown in red) at different time points (sham, 3, 6, and 12 hours) after unilateral ureteral obstruction (UUO). Scale
bar=5µm. (B) Quantification of positively stained area in A. (P values as indicated, ANOVA with post hoc Dunn’s
multiple comparison test. Error bars indicate SD).
0.0 0.5 1.0 1.5
0.9941 0.3887
0.0001
0.0056
Complete media
0 5 7 8
A
mpkCCDc11-38 cells Seeding 500,000 cells/well
Days
dDAVP 0.1nM and LPS
B
C
Immunoblotting of AQP2
Simple media
dDAVP LPS (ng/ml)
Gly-AQP2 Non-Gly- AQP2 37
29
Coomassie kDa
dDAVP - + + + + +
LPS (ng/ml) 0 0 1 10 100 1000 AQP2 abundance (arbitrary units)
0.0100
0 0 1 10 100 1000
- - - + + + + + + + + + + + + + + +
Supplemental Figure 6. Decreased AQP2 abundance in cultured collecting duct cells (mpkCCD) after lipopolysaccharide (LPS) treatment. (A) Experimental design. (B) Immunoblot for AQP2 in cultured mpkCCD preincubated 24 hours with dDAVP 0.1nM medium and LPS with different concentrations of 0, 1, 10, 100, 1000 ng/ml (n=3 per condition). (C) Quantification of immunoblotting shown in B. (p values as indicated, ANOVA with post hoc Dunn’s multiple comparison test). Error bars indicate SD.
