Supplemental Table of Contents

(1)

Supplemental Table of Contents:

Supplemental Methods

Supplemental Table 1. Characteristics of the healthy controls and LN patients.

Supplemental Table 2. Characteristics of C57 and MRL/lpr mice.

Supplemental Table 3. Characteristics of saline- or pristane-induced WT and ADAMTS7^-/- mice.

Supplemental Table 4. Characteristics of pristane-induced WT and ADAMTS7^-/- mice transduced with AAV-shRNA-NC or AAV-shRNA-CFH.

Supplemental Table 5. Characteristics of WT and ADAMTS7^-/-Mice suffering sham or renal I/R injury.

Supplemental Table 6. Characteristics of renal I/R injury-treated WT and ADAMTS7^-/- mice transduced with AAV-shRNA-NC or AAV-shRNA-CFH.

Supplemental Table 7. Primers used for RT-qPCR analysis on mouse gene expression.

Supplemental Figure 1. The expression of ADAMTS7 is induced the most in lupus nephritis.

Supplemental Figure 2. ADAMTS7 directly interacts with CFH.

Supplemental Figure 3. The MS/MS spectrum of CFH peptides specifically generated in the presence of ADAMTS7 using samples without revolving on SDS-PAGE gels.

Supplemental Figure 4. The elevation of ADAMTS7 correlates with the decline in CFH in kidneys from mice with lupus.

Supplemental Figure 5. ADAMTS7 deficiency alleviates the development of renal injuries in SLE.

Supplemental Figure 6. Targeting ADAMTS7 does not influence on complement-mediated bacterial killing.

Supplemental Figure 7. CFH mediates the effect of ADAMTS7 on the development of renal injuries in SLE.

Supplemental Figure 8. The elevation of ADAMTS7 correlates to the decline in CFH in kidneys with ischemia-reperfusion injury.

Supplemental Figure 9. CFH mediates the effect of ADAMTS7 on the development of ischemia-reperfusion injury.

Supplemental References.

Supplemental Excel File I: The proteins immunoprecipitated by anti-CFH antibody

(2)

Supplemental Methods Western blotting

Western blot analysis was performed as previously described.¹ Total protein from murine tissues was extracted by RIPA lysis buffer (P0013B, Beyotime, Shanghai, China).). Equal amounts of total protein from murine tissues were resolved by 8% or 10% SDS-PAGE and subsequently transferred onto PVDF membranes (66543, PALL, Wilmington, DE, USA). The membranes were blocked with 5% BSA in TBST and then incubated with primary antibodies at 4 °C overnight. Following 1 hour of incubation with IRDye-conjugated secondary antibodies (Rockland,Gilbertsville, PA, USA),the immunofluorescent signal was detected and quantified using an Odyssey infrared imaging system (LI-COR Biosciences, Lincoln, NE, USA).

RNA isolation and real-time qPCR

Total RNA was isolated from renal tissues with TRIzol reagent (15596026, Thermo, Rochester, NY, USA), and 1 μg of total RNA was subjected to reverse transcription to generate complementary DNA (cDNA). Real-time PCR amplification involved the use of an ABI QuantStudio^TM 3 Real-Time PCR System (Thermo, Rochester, NY, USA) and SYBR Green 2×PCR mix (Novoprotein, Shanghai, China). The relative mRNA level was calculated using the 2^-Ct method. The Ct was computed with normalization to the internal control GAPDH.

Then, the mean Ct in the control samples was used as a calibrator. The primer sequences for real-time PCR are shown in Table S1.

Immunohistochemical staining

(3)

The kidneys were fixed in 4% paraformaldehyde for at least 24 hours, followed by paraffin sections (3-5 m). Paraffin sections were deparaffinized, rehydrated, and boiled in citrate buffer (pH 6.0) to retrieve antigens. Paraffin sections were permeabilized, blocked with 10% normal goat serum, and incubated with the indicated primary antibodies at 4 °C overnight. The primary antibodies used were as follows: rabbit anti-ADAMTS7 antibody (1:100, WG-04133, ABclonal, Wuhan, China) and rabbit anti-CFH antibody (1:100, DF6889, Affinity Biosciences, Jiangsu, China). Subsequently, the sections were incubated with the appropriate secondary antibodies for 1 hour at room temperature (RT),before further development with a DAB Kit (ZLI-9019, ZSGB-Bio, Beijing, China). The nuclei were counterstained with hematoxylin. Sections incubated with species-matched IgG alone were used as negative controls.

Cell culture

HEK293T cells were cultured in high-glucose DMEM (11995065, Gibco, Grand Island, NY, USA) with 10% FBS (900-108, GEMINI, Woodland, TX, USA) and penicillin- streptomycin (St488, Beyotime, Shanghai, China). These cells were maintained in a humidified 5% CO2 incubator at 37 °C.

Purification of recombinant proteins and peptides

(1) His-tagged Protein/Peptide Purification: The entire open reading frame of the CFH or CCP 1-4 domain with a His tag was inserted into the pcDNA3.1 vector. The purification of His-tagged CFH or CCP 1-4 was conducted as previously described.² The His-tagged CFH

(4)

transfected cells were washed twice with PBS and cultured in serum-free DMEM for another 24 hours. Cells were collected and lysed in 1 mL of His-tag purification buffer (50 mM NaH2PO4, 250 mM NaCl, 50 mM NaF, 1 mM PMSF, 1 μg/mL leupeptin, 0.5% NP-40 and 10 mM imidazole) with mild shaking at 4 °C for 1 hour. Following centrifugation at 10,000 g for 10 min, the supernatant was collected and mixed with 50 μL of a 50% slurry of Ni-NTA beads (78605, Invitrogen, Carlsbad, CA, USA). The mixture was rotated at 4 °C for 2 hours, followed by 4 washes with 0.25 mL of washing buffer (50 mM NaH2PO4, 300 mM NaCl and 20 mM imidazole) and centrifugation at 1000 g for 2 min. The His-tagged CFH or CCP 1-4 domain bound to Ni-NTA beads was eluted with a 0.05-0.3 M linear gradient of imidazole in washing buffer. The protein was dialyzed against eluate buffer and then concentrated by ultrafiltration.

(2) Flag-Tagged Protein/Peptide Purification: Full-length rat ADAMTS7 and spacer-2 plus 4 C-terminal TSP repeats (amino acids 999–1595, ADAMTS7-F4) were subcloned into the pcDNA3.1 vector with C-terminal Flag. HEK293T cells were transfected with the pcDNA3.1-ADAMTS7-Flag or pcDNA3.1-ADAMTS7-F4-Flag plasmid. Forty-eight hours later, the transfected cells were collected and lysed with BC500 buffer (25 mM Tris- HCl pH 7.3, 500 mM NaCl, 0.5% Triton X-100 and 20% glycerol) plus proteinase cocktail inhibitors (P8849, Sigma-Aldrich, Shanghai, China). Through centrifugation at 10,000 g for 10 min, the supernatant containing ADAMTS7 or F4 fragment was incubated overnight at 4 °C with an anti-FLAG M2 affinity gel. Then, the resin was collected by centrifugation at 1000 g for 2 min, followed by washing with BC500 buffer once and BC100 buffer (25 mM Tris-HCl pH 7.3, 100 mM NaCl, 0.5% Triton X-100 and 20% glycerol) twice. The

(5)

ADAMTS7 proteins were finally eluted with 3 × Flag peptides (dissolved in PBS).

C5a measurement by ELISA

The sera from C57BL/6 mice were incubated with zymosan (10 mg/mL) or LPS (2 mg/mL) in the presence of BSA or ADAMTS7 (20 g/mL) at 37 °C for 2 hours. Then, cold EDTA (10 mM) was added to stop all the complement activation pathways. The produced C5a in incubation solution was determined using a commercially available ELISA kit (CSB-E08514m, Cusabio Technology LLC, Wuhan, China.).

Fluorescence-activated cell sorting of renal cells

Kidneys were dissected following PBS perfusion in sacrificed mice. A single-cell suspension was prepared using as described previously.^{3, 4} Briefly, the renal tissues were minced into tiny particles by cutting with scissors and digested into single cells in 5 mL of collagenase II solution (1mg/ml) for 1 hour at 37°C. Then, the distinct renal cells were sorted using fluorochrome-conjugated antibodies by flow cytometric analysis (BD FACS Aria Sorp) from the single-cell suspension. Endothelial cells were sorted by using APC-anti-CD144 antibody (138006, BioLegend, Inc. San Diego, CA, USA). Epithelial cells were sorted by FITC-anti-CD326 antibody (118207, BioLegend, Inc. San Diego, CA, USA). Interstitial fibroblasts were sorted by PE-anti-PDGFRβ antibody (558426, BD Biosciences, New York, NJ, USA). Leukocytes were sorted by FITC-anti-CD45 antibody (103107, BioLegend, Inc.

San Diego, CA, USA). The sorted cells were harvested for measuring Adamts7 mRNA

(6)

Immunofluorescence staining

The kidneys were fixed in 4% paraformaldehyde for at least 24 hours, followed by frozen sections (10 m). Sections were permeabilized, blocked with 10% normal goat serum, and incubated with rabbit anti-C3 antibody (1:200, bs-2934R, Bioss., Beijing, China) at 4 °C overnight. Subsequently, the sections were incubated with secondary antibodies for 1 hour at RT. The secondary antibody was goat anti-rabbit IgG (H+L) cross-adsorbed secondary antibody with Alexa Fluor 633, prepared in 1% BSA dissolved in PBS buffer. Sections incubated with species-matched IgG alone were used as negative controls. In addition, the goat anti-Mouse IgG (H+L) antibody with Alexa Fluor 555 for detecting IgG deposition in Glomeruli. The nuclei were visualized by staining with DAPI (1:1000) for an additional 10 min. The fluorescent signals were demonstrated by confocal laser scanning microscopy using an Olympus FV3000 microscope. To quantify C3 and IgG deposits in the glomeruli, the fluorescence intensity within the peripheral glomerular capillary walls and mesangium were scored on a scale of 0-3 (0 = none; 1 = weak; 2 = moderate; 3 = strong) in at least 10 glomeruli per section.⁵ The relative fluorescence intensity of tubular-interstitial regions was quantified using ImageJ software (National Institutes of Health, Bethesda, MD, USA).

Serum bactericidal activity assay

The bactericidal activity of mouse sera was determined as described previously.⁶ T1 Escherichia coli (TransGen Biotech.)carrying the pcDNA3.1 vector were grown in lysogeny broth (LB) medium containing 50 g/mL ampicillin to mid-log, diluted to OD600 = 0.01in LB medium, and then incubated with 50% (vol/vol) sera from WT and ADAMTS7^-/- mice with or

(7)

without pristane induction, in a final volume of 100 μL, at 37°C for 1 hour while shaking. Equal volume of LB was applied as negative control. Undiluted up to 10³-fold diluted (in LB) culture (20 L) was plated on LB with 50 g/mL ampicillin agar and incubated at 37 °C overnight to count colony-forming units (CFUs). The bactericidal activity was present as the percentage survival calculated through the division of CFU in serum-containing culture by CFU in corresponding negative control culture.

Quantification of bacterial burdens

The age- and gender-matched WT and ADAMTS7^-/- mice were injected intraperitoneally with Salmonella typhimurium (5×10³ CFU per mouse). The infected mice were euthanized at 2 days after infection, and spleens and livers were harvested to determine the bacterial loads.

Livers and spleens were homogenized, serially diluted, plated onto LB agar plates, and incubated overnight at 37°C.^{7, 8}

TUNEL staining

Sections (3 m) of kidneys were TUNEL-stained using a one-step TUNEL apoptosis detection kit (bs-8004-10, Bioss., Beijing, China). The numbers of TUNEL-positive and total cells were counted in each section with 5 randomly chosen nonoverlapping fields. The data are presented as the percentage of TUNEL-positive cells among the total cells in each section.

(8)

Supplemental Tables

Table S1. Characteristics of the healthy controls and LN patients.

Group No.

Healthy controls N=29

Patients P N=29

Gender [n (%)]

Female Male Age (years)

23 (79.3) 6 (20.7) 30±11

23 (79.3) 1 6 (20.7) 1

28±8 0.432

Data were present as the mean ± SEM for age data and as frequency or percentage for gender data.

The unpaired Student's t-test was applied to evaluate statistical significance for age data. Meanwhile, the Chi-square test was used to evaluate the statistical significance between the proportions of genders in the two groups.

Table S2. Characteristics of C57 and MRL/lpr mice.

Group C57 MRL/lpr

No. n=4 n=4

Weight (g) 32.81±1.16 33.53±1.77

Data were presented as the mean ± SEM.

Table S3. Characteristics of saline- or pristane-induced WT and ADAMTS7^-/- mice.

Group Saline Pristane

WT ADAMTS7^-/- WT ADAMTS7^-/-

No. n=6 n=6 n=6 n=6

Weight before (g) Weight after (g)

23.38±0.97 22.01±0.84 36.16±0.83 36.96±0.79

23.08±0.71 23.61±1.14 34.98±1.45 35.32±1.53 Data were presented as the mean ± SEM.

(9)

Table S4. Characteristics of pristane-induced WT and ADAMTS7^-/- mice transduced with AAV-shRNA-NC orAAV-shRNA-CFH.

Group AAV-shRNA-NC AAV-shRNA-CFH

No. n=6 n=6 n=6 n=6

23.19±0.74 23.95±0.96 36.53±1.31 37.04±1.28

Table S5. Characteristics of WT and ADAMTS7^-/- Mice suffering sham or renal I/R injury.

Group Sham I/R injury

No. n=6 n=6 n=6 n=6

22.37±0.56 23.22±0.35 21.81±1.48 22.47±1.10

Table S6. Characteristics of renal I/R injury-treated WT and ADAMTS7^-/- mice transduced with AAV-shRNA-NC orAAV-shRNA-CFH.

Group AAV-shRNA-NC AAV-shRNA-CFH

No. n=6 n=6 n=6 n=6

22.37±0.99 22.54±0.81 20.59±1.95 20.76±1.48

22.63±0.17 23.22±0.52 20.79±1.53 20.41±0.93 Data were presented as the mean ± SEM

(10)

Table S7. Primers used for RT-qPCR analysis on mouse gene expression.

Gene Sequence

Gapdh sense TTGAGGTCAATGAAGGGGTC

antisense TCGTCCCGTAGACAAAATGG Adamts7 sense GCAGGCTTCGTCTGCTTTCTA

antisense GCCATCAGATAAGGGTTGGTGG Mep1a sense AATGCTTTGGATACAACCTGCG

antisense TCCATCTGCTTGAGGGATCTC

Anpep sense ATGGAAGGAGGCGTCAAGAAA

antisense CGGATAGGGCTTGGACTCTTT

Spli sense ATGGGTTTGCACTCAGAGTTG

antisense GCCAGCCGTGTAAGCAGAG Adamts13 sense GAGCCAGACGATCAACCCC

antisense TCCTCAGTGATAAGGCAACTCC

Il1b sense CTGGTACATCAGCACCTCAC

antisense AGAAACAGTCCAGCCCATAC

Il6 sense ACAACCACGGCCTTCCCTACTT

antisense GTGTAATTAAGCCTCCGACT

Tnf sense CCCTCACACTCAGATCATCTTCT

antisense GCTACGACGTGGGCTACAG Isg15 sense GGTGTCCGTGACTAACTCCAT

antisense CTGTACCACTAGCATCACTGTG

Mx1 sense GACCATAGGGGTCTTGACCAA

antisense AGACTTGCTCTTTCTGAAAAGCC

Irf7 sense GCGTACCCTGGAAGCATTTC

antisense GCACAGCGGAAGTTGGTCT

Cfh sense AGGCTCGTGGTCAGAACAAC

antisense GTTAGACGCCACCCATTTTCC

(11)

Supplemental Figures

(12)

Fig. S1. The expression of ADAMTS7 is induced the most in lupus nephritis. (A) Serum creatinine (Cre) and blood urea nitrogen (BUN) levels in 24-week-old female C57 and MRL/lpr mice. n=4, *P<0.05 by unpaired two-tailed Student’s t test. (B) Urinary albumin-creatinine ratios (UACR) in 24-week-old female C57 and MRL/lpr mice. n=4, *P<0.05 by unpaired two-tailed Student’s t test. (C) Representative images of renal sections from 24-week-old female C57BL/6 (C57) and MRL/lpr mice stained with Periodic acid Schiff (PAS). Scale bar=50 μm. (D) Quantification of glomerular and tubular-interstitial injuries. n=4, *P<0.05 by Mann-Whitney test.

(E) Representative western blot and quantitation of CFH protein in kidneys from 24-week-old female C57 and MRL/lpr mice. n=3, *P<0.05 by unpaired two-tailed Student’s t test. (F) Real-time PCR of Cfh gene expression in kidneys from 24-week-old female C57 and MRL/lpr mice. n=4, ns, no significance by unpaired two-tailed Student’s t test. (G) Real-time PCR of Adamts7, Mep1a, Anpep, Adamts13 and Spli gene expressions in kidneys from 24-week-old female C57 and MRL/lpr

mice. n=4, *P<0.05 by unpaired two-tailed Student’s t test. (H and I) ELISA measurements of serum ADAMTS7 and CFH from 24-week-old female C57 and MRL/lpr mice. n=4, *P<0.05 by unpaired two-tailed Student’s t test.

(13)

Fig. S2. ADAMTS7 directly interacts with CFH. (A and B) Co-IP assay of ADAMTS7 and CFH

in kidneys from 24-week-old female MRL/lpr mice. TS7, ADAMTS7. (C and D) Co-IP assay of

ADAMTS7 and CFH using HEK293T cells cotransfected with His-tagged CFH and Flag-tagged

ADAMTS7 plasmids for 48 hours. (E) HEK293T cells were cotransfected with the plasmids

encoding various Flag-tagged ADAMTS7 fragments and plasmids expressing His-tagged CFH CCP

1-4. Co-IP was performed to explore the interaction of the CCP 1-4 domain with ADAMTS7

fragments.

(14)

Fig. S3. The MS/MS spectrum of CFH peptides specifically generated in the presence of ADAMTS7 using samples without revolving on SDS-PAGE gels. n=3 independent experiments.

(15)

Fig. S4. The elevation of ADAMTS7 correlates with the decline in CFH in kidneys from mice

with lupus. (A) ELISA measurement of serum ADAMTS7 from mice with or without distinct

periods post pristane injection. n=6, *P<0.05 by two-way ANOVA followed by the Bonferroni test.

(B)Real-time PCR of Adamts7 expression in kidneys from mice with or without distinct periods

post pristane injection. n=6, *P<0.05 by two-way ANOVA followed by the Bonferroni test. (C)

(16)

mice with or without distinct periods post pristane injection. n=4, *P<0.05 by two-way ANOVA

followed by the Bonferroni test. (D) Real-time PCR of Adamts7 expression in different renal cells

isolated through fluorescence-activated cell sorting from mice with or without 6 months of pristane

induction. n=3, *P<0.05 by two-way ANOVA followed by the Bonferroni test.

(17)

Fig. S5. ADAMTS7 deficiency alleviates the development of renal injuries in SLE. (A and B)

ELISA measurements of serum CFH and C3 proteins from the WT and ADAMTS7^-/- mice with or

(18)

and ADAMTS7^-/- mice with or without 6 months of pristane induction. Scale bar=25 μm. (D) The

relative quantitation of IgG deposition on renal cross-sections. n=6, *P<0.05 by Mann-Whitney test.

(E)ELISA measurements of serum anti-dsDNA antibodies (Ab) from WT and ADAMTS7^-/- mice

with 6 months of pristane induction. n=6, *P<0.05 by unpaired two-tailed Student’s t test. (F and

G)Real-time PCR on the expression of inflammatory cytokines (F) and molecules involved in type

I IFN signaling pathways (G) in the WT and ADAMTS7^-/- mice with or without 6 months of pristane

induction. n=6, *P<0.05 by two-way ANOVA followed by the Bonferroni test.

(19)

Fig. S6. Targeting ADAMTS7 does not influence on complement-mediated bacterial killing.

(A) The percentage survival of E coli after incubation in 50% (vol/vol) sera from WT and

ADAMTS7^-/- mice. n=3, *P<0.05, ns, no significance by two-way ANOVA followed by the

Bonferroni test. (B) The percentage survival of E coli after incubation in 50% (vol/vol) sera from

WT and ADAMTS7^-/- mice with 6 months of pristane induction. n=3, *P<0.05, ns, no significance

by two-way ANOVA followed by the Bonferroni test. (C and D) Bacterial burdens of spleen and

liver from WT and ADAMTS7^-/- mice with Salmonella typhimurium (5×10³ CFU per mouse) infection for 48 hours. n=6, ns, no significance by unpaired two-tailed Student’s t test.

(20)

(21)

Fig. S7. CFH mediates the effect of ADAMTS7 on the development of renal injuries in SLE.

(A)Eight- to ten-week-old female WT and ADAMTS7^-/- mice were treated with AAV9-shRNA-NC

(negative control) or AAV9-shRNA-CFH. Following 6 months of pristane induction, western blot

analysis was performed to evaluate the efficiency of knockdown in livers and kidneys. n=4, *P<0.05

by two-way ANOVA followed by the Bonferroni test. (B and C) ELISA measurements of serum

CFH and C3 proteins from AAV-transduced WT and ADAMTS7^-/- mice after 6 months of pristane

induction. n=6, *P<0.05, ns, no significance by two-way ANOVA followed by the Bonferroni test.

(D)Immunofluorescence staining of IgG deposition in renal tissues from the AAV-transduced WT

and ADAMTS7^-/- mice after 6 months of pristane induction. Scale bar=25 μm. (E) The relative

quantification of IgG deposition on renal cross-sections. n=6, *P<0.05, ns, no significance by Mann-

Whitney test. (F and G) Real-time PCR of the expression of inflammatory cytokines (F) and

molecules involved in type I IFN signaling pathways (G) in the AAV-transduced WT and ADAMTS7^-

/- mice with 6 months of pristane induction. n=6, *P<0.05, ns, no significance by two-way ANOVA

followed by the Bonferroni test.

(22)

Fig. S8. The elevation of ADAMTS7 correlates to the decline in CFH in kidneys with ischemia-

reperfusion injury. (A) Real-time PCR of Adamts7 expression in mouse kidneys with or without

I/R injury. n=6, *P<0.05 by unpaired two-tailed Student’s t test. (B) Real-time PCR of Adamts7

expression in of different renal cells isolated by fluorescence-activated cell sorting from mice with

or without I/R injury. n=3, *P<0.05 by two-way ANOVA followed by the Bonferroni test. (C)

ELISA measurement of serum ADAMTS7 from mice with or without I/R injury. n=6, ns, no

significance by unpaired two-tailed Student’s t test. (D) Immunohistochemical staining of

ADAMTS7 and CFH in mouse kidneys with or without I/R injury. Nuclei were counterstained with

hematoxylin, and rabbit IgG was applied as a negative control. Scale bar=50 μm. (E) Representative

(23)

western blot and quantification of ADAMTS7 and CFH proteins in mouse kidneys with or without

I/R injury. n=4, *P<0.05 by unpaired two-tailed Student’s t test. IRI, I/R injury.

(24)

Fig. S9. CFH mediates the effect of ADAMTS7 on the development of ischemia-reperfusion injury. Eight- to ten-week-old WT and ADAMTS7^-/- mice were transduced with AAV9-shRNA-NC (negative control) or AAV9-shRNA-CFH. Two weeks later, the infected mice suffered from renal I/R injury. (A) Immunofluorescence staining of C3 deposition in renal tissues from the AAV- transduced WT and ADAMTS7^-/- mice with renal I/R injury. Scale bar=50 μm. (B) The relative

(25)

quantitation of C3 deposition on renal cross-sections. n=6, *P<0.05, ns, no significance by two-way ANOVA followed by the Bonferroni test. (C) Blood creatinine (Cre) and blood urea nitrogen (BUN) levels in the AAV-transduced WT and ADAMTS7^-/- mice with renal I/R injury. n=6, *P<0.05, ns, no significance by two-way ANOVA followed by the Bonferroni test. (D) Representative images of renal sections stained with Periodic acid–Schiff (PAS). Scale bar=50 μm. (E) Quantification of tubular injury score. n=6, *P<0.05, ns, no significance by Mann-Whitney test. (F) Representative images of renal sections with TUNEL staining. Scale bar=50 μm. (G) Quantification of TUNEL- positive cells. n=6, *P<0.05, ns, no significance by two-way ANOVA followed by the Bonferroni test. IRI, I/R injury.

(26)

Supplemental References

1. Mao C, Ma Z, Jia Y, Li W, Xie N, Zhao G, Ma B, Yu F, Sun J, Zhou Y, Cui Q, Fu Y and Kong W.

Nidogen-2 Maintains the Contractile Phenotype of Vascular Smooth Muscle Cells and Prevents Neointima Formation via Bridging Jagged1-Notch3 Signaling. Circulation. 2021;144:1244-1261.

2. Wang Y, Chen D, Zhang Y, Wang P, Zheng C, Zhang S, Yu B, Zhang L, Zhao G, Ma B, Cai Z, Xie N, Huang S, Liu Z, Mo X, Guan Y, Wang X, Fu Y, Ma D, Wang Y and Kong W. Novel Adipokine, FAM19A5, Inhibits Neointima Formation After Injury Through Sphingosine-1-Phosphate Receptor 2.

Circulation. 2018;138:48-63.

3. Wang H, Sheng J, He H, Chen X, Li J, Tan R, Wang L and Lan HY. A simple and highly purified method for isolation of glomeruli from the mouse kidney. American journal of physiology Renal physiology. 2019;317:F1217-F1223.

4. Nakai T, Iwamura Y and Suzuki N. Efficient isolation of interstitial fibroblasts directly from mouse kidneys or indirectly after ex vivo expansion. STAR Protoc. 2021;2:100826.

5. Kikawada E, Lenda DM and Kelley VR. IL-12 deficiency in MRL-Fas(lpr) mice delays nephritis and intrarenal IFN-gamma expression, and diminishes systemic pathology. Journal of immunology.

2003;170:3915-25.

6. Pouw RB, Brouwer MC, de Gast M, van Beek AE, van den Heuvel LP, Schmidt CQ, van der Ende A, Sanchez-Corral P, Kuijpers TW and Wouters D. Potentiation of complement regulator factor H protects human endothelial cells from complement attack in aHUS sera. Blood Adv. 2019;3:621-632.

7. Qi X, Man SM, Malireddi RK, Karki R, Lupfer C, Gurung P, Neale G, Guy CS, Lamkanfi M and Kanneganti TD. Cathepsin B modulates lysosomal biogenesis and host defense against Francisella novicida infection. The Journal of experimental medicine. 2016;213:2081-97.

8. Man SM, Karki R, Malireddi RK, Neale G, Vogel P, Yamamoto M, Lamkanfi M and Kanneganti TD. The transcription factor IRF1 and guanylate-binding proteins target activation of the AIM2 inflammasome by Francisella infection. Nat Immunol. 2015;16:467-75.