Variant identification of exon 11 of

(1)

AIP Conference Proceedings 2331, 050025 (2021); https://doi.org/10.1063/5.0042042 2331, 050025

Variant identification of exon 11 of

galactosamine (N-acetyl)-6-sulfatase

(GALNS) gene in mucopolysaccharidosis type IVA patients in Indonesia

Cite as: AIP Conference Proceedings 2331, 050025 (2021); https://doi.org/10.1063/5.0042042 Published Online: 02 April 2021

R. A. R. Sulaiman, R. P. Aji, N. M. Prakoso, et al.

ARTICLES YOU MAY BE INTERESTED IN

Identification of novel mutations in exon 1 of iduronate-2-sulfatase gene from mucopolysaccharidosis type II patient in Indonesia

AIP Conference Proceedings 2331, 050026 (2021); https://doi.org/10.1063/5.0042045

Novel base alterations at intron 3 of 6-pyruvoyl-tetrahydropterin synthase gene in Indonesian population

Variant analysis for exon 2 and 5 of iduronate 2-sulfatase gene on mucopolysaccharidosis type II patients in Indonesia

(2)

Variant Identification of Exon 11 of Galactosamine (N- Acetyl)-6-Sulfatase (GALNS) Gene in Mucopolysaccharidosis

Type IVA Patients in Indonesia

R. A. R. Sulaiman

¹

, R. P. Aji

¹

, N. M. Prakoso

²

, R. Priambodo

²

, Y. A. Aswin

^{2, 3, 4}

, C. N. Hafifah

^{2, 3}

, and D. R. Sjarif

^{2, 3, a)}

1Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Indonesia, Depok, Indonesia

2Human Genetics Research Center, Indonesian Medical Education and Research Institute (IMERI), Universitas Indonesia, Jakarta, 10430, Indonesia

3Department of Pediatric, Universitas Indonesia, RSUPN Dr. Cipto Mangunkusumo, Jakarta, 10430, Indonesia

4Department of Medical Biology, Faculty of Medicine, Universitas Indonesia, Depok, Indonesia

a)Corresponding author: [email protected]

Abstract. Mucopolysaccharidosis type IVA (MPS IVA) is an autosomal recessive disease, in which lysosomes are unable to catalyze glycosaminoglycans due to deficiency of the enzyme galactosamine (N-acetyl)-6-sulfatase (GALNS), encoded by GALNS gene. The exon 11 of GALNS gene is known as one of the mutation hotspot regions and encode the enzyme scaffolding structure along with exon 8-10 and 12-14. The GALNS enzyme deficiency leads to abnormal accumulation of glycosaminoglycans inside the lysosomes, rendering the cell unable to function properly. Symptoms of MPS IVA are commonly seen as skeletal dysplasia and multi-organ complications. Research on MPS IVA has been done in many countries, but not in Indonesia. This study aims to identify variants that may be present in exon 11 of GALNS gene in MPS IVA patients in Indonesia. The study was conducted using DNA from blood samples of 7 MPS IVA patients and 30 healthy individuals as controls, obtained from Cipto Mangunkusumo Hospital, Jakarta. A set of specific primers of exon 11 was designed and optimized before completing DNA extraction. Then, DNA extraction was performed, further amplified using the polymerase chain reaction technique. PCR products were visualized by electrophoresis and proceeded for Sanger sequencing. The sequencing results indicated that a variant c.1177G>T (p.Ala393Ser) was found in one patient and five healthy individuals. This variant has been reported in Japan before and identified as benign with more than 5% MAF globally. This research may provide additional information to existing databases for research in MPS IVA, especially in Indonesia.

INTRODUCTION

Mucopolysaccharidosis type IVA (MPS IVA; OMIM 253000) is a rare metabolic disorder, that is caused by deficiency of galactosamine (N-acetyl)-6-sulfatase (GALNS) enzyme and inherited as an autosomal recessive disorder [1, 2]. The GALNS enzyme is encoded by GALNS gene. The GALNS gene is located at chromosome 16, at subband 24.3, consisted of 14 exons, and has 43,237 bp. The total coding sequence of this gene is 1,569 bp which codes for 522 amino acids [3].

The GALNS enzyme is required for the hydrolysis of keratan sulfate (KS) and chondroitin-6-sulfate (C6S). The deficiency of the enzyme is caused by a mutation in the GALNS gene, including substitution and frameshift mutations. The GALNS enzyme becomes malfunctioned because of any structural or functional damage, making KS and C6S cannot be catalyzed [1]. When KS and C6S are not catalyzed, KS and C6S will be accumulated inside the lysosomes, hence increasing their sizes. This condition causes destabilization of lysosomes membranes thus releasing their contents, such as hydrolases and metabolites causing stress to other organelles, even inducing apoptosis or necrosis of the cells [2].

(3)

Signs and symptoms of MPSs that may appear are skeletal abnormalities, joint hypermobility, hepatosplenomegaly, valvulopathy, upper respiratory tract and hearing problem, and corneal clouding [4]. Despite the general MPS symptoms, the nervous system and intelligence-related problems have never been reported in MPS IVA. The symptoms and signs can be found in early and late childhood to adolescence, ranging from the rapid and severe form to the more slow and mild form. The global prevalence of MPS IVA is estimated to be about 1:201.000, but the occurrence of MPS IVA is varied in different countries [2].

The GALNS enzyme has consisted of two domains and the active site of the enzyme is liganded by Ca²⁺. Domain 1 consisted of the 28^th-379^th amino acid residue, while domain 2 consisted of the 380^th-481^st amino acid residue. Domain 2 is connected to domain 1, followed by a C-terminal meander, and consisting of part of the active site of the enzyme [5]. Exon 11 is composed of several parts of the domain 2, along with exon 10, 12, and 13.

According to the database from Morrone et al., there are 3 exons with the most variants reported, exon 5 with almost 50 variants, exon 10 with 32 variants, and exon 11 with 34 variants. At least 32 of 34 variants recorded in exon 11 are pathogenic, with 25 of them are reported as pathogenic variants, while the other 7 variants are reported as a variant of unknown significance (VUS) but predicted as pathogenic, and only 2 variants are reported as benign [6].

Therefore, exon 11 can be classified as one of the hotspot regions in GALNS gene. The objective of this research is to identify the variations that occur in exon 11 of the MPS IVA patients in Indonesia and to search for a possibility of any novel variants in exon 11 of GALNS gene.

METHOD

Patients and Blood Samples

A total of seven MPS IVA patients were studied and compared to thirty healthy individuals as the control group in this research. The MPS IVA patients came from various regions in Indonesia and were referred to Cipto Mangunkusumo Hospital, Jakarta. The control group were healthy adult individuals with no physical symptoms of MPS IVA observed. All of the subjects had their blood taken with a sterile syringe and then stored in a 4 ^oC refrigerator. The blood collecting process was performed by healthcare professionals that followed the procedure based on the ethical approval of the Ethical Clearance Committee. Informed consent was signed and approved beforehand by the patients.

DNA Extraction and Quantification

The blood samples of 7 MPS IV patients and 30 normal individuals were obtained from Cipto Mangunkusumo Hospital, Jakarta and were extracted in room temperature using GB100 Genomic DNA Mini Kit [Geneaid], according to the manufacturer’s protocol. The extracted DNA was stored in a -20 ၨC freezer. The extracted DNA was quantified using ThermoFisher Varioskan Microplate Reader [Thermo Scientific] to determine its concentration and purity.

Primer Design and Optimization

A set of specific primers was designed in silico using Primer3 and verified by PrimerBlast. The primers were optimized using gradient PCR [Applied Biosystems] to determine the optimum annealing temperature with the temperature range tested were 52-62 ၨC. The PCR mixture for optimization was consisted by 3.6 μL of nuclease-free water, 5 μL of MyTaq™ HS Red Mix [Bioline], 0.2 of μL forward primer, 0.2 μL of reverse primer, and 1 μL of DNA template.

DNA Amplification and Sequencing

DNA of patients and controls were amplified with specific primers by polymerase chain reaction at optimized temperature. The PCR mixture was consisted by 19 μL of nuclease-free water, 25 μL of MyTaq™ HS Red Mix, 1 μL of forwarding primer, 1 μL of reverse primer, and 4 μL of DNA template. The PCR undergone following stages:

1 min of initial denaturation at 95 ၨC, 40 cycles of amplification (15 sec of denaturation at 95 ၨC, 15 sec of annealing

(4)

at 64 ၨC, and 30 sec of extension at 72 ၨC), and 10 min of final extension at 72 ၨC. About 10 μL of PCR products were taken from each sample to be visualized by agarose gel electrophoresis and the rest were sent to the 1st Base Sequencing Services.

Bioinformatics Analysis

Sequencing analysis was performed using the chromatogram and sequence data of 7 MPS IVA patients and 30 normal individuals that were produced from the sequencing process. The quality of all chromatograms was evaluated using FinchTV software. All sequencing data were aligned with GALNS Consensus Coding Sequence (CCDS 10970.1) to detect any variation in the coding sequence or amino acid alterations in exon 11. The pathogenicity level of detected variants will be verified using MutPred2 [14], Provean [15], PMUT (16), and MutationT@ster [17].

RESULT AND DISCUSSION DNA Extraction and Quantification

The concentration of the extracted DNA is ranging from 43.02—977.90 μg/μL. Purity measurement was performed using 260 nm and 280 nm wavelength because nucleic acids have a maximum absorbance value at 260 nm wavelength and protein has a maximum absorbance value at 280 nm. The purity of the extracted DNA is ranging from 1.76—1.94, or generally about 1.8. Based on this value, we can conclude that the extracted DNA samples are pure [11].

Primer Optimization and DNA Amplification

The profile of the primers is shown in Table 1. The PCR product of the constructed primers is 331 bp, with each primers’ melting temperatures were 58.44 ၨC and 59.88 ၨC. The gradient PCR results in Fig. 1(a) showed that a single PCR product with a size of 331 bp was amplified at 54—62 ၨC. However, we determined that the optimum annealing temperature is 64 ၨC to prevent the amplification of primer dimers. Hence, the samples are prepared for sequencing at 64 ၨC and a single amplicon with a size of about 331 bp has been observed in all samples as shown in Fig. 1(b).

TABLE 1. Profile of The Specific Primers for Exon 11 of GALNS Gene.

Primer

Name Nucleotide Sequence Length (bp)

GC Content

(%)

Tm (ၨC)

Secondary Structure (kcal/mol)

PCR Product

(bp) GALNS-ID

Ex11 F TAAAGTATCAACCAAGACCTCACG 24 41.67 58.44

- 331 GALNS-ID

Ex11 R TGCCTGTCTCACCCTCCTGT 19 60 59.88

(5)

(a) (b) FIGURE 1. Visualization of PCR products of exon 11 (a) Gradient PCR at 52—62 ၨC, (b) Amplification of exon 11 at 64 ၨC

where 331 bands were observed in every sample (M: 100 bp DNA ladder, 1: P5, 2: P6, 3: P7, 4: N22, 5: N23, 6: N24).

Bioinformatics Analysis

The chromatogram of all samples was evaluated using FinchTV, showing clean results without noise as can be seen in Fig. 2(a). The sequence files were produced by editing the chromatogram sequences with a Phred quality value of more than 20 and then aligned with GALNS Consensus Coding Sequence (CCDS 10970.1). The alignment result showed that variant c.1177G>T was the only variant that has been detected in P4, which is predicted to alters the 393^rd amino acid from Alanine to Serine (p.Ala393Ser) as shown in Figure 2(b) and (c).

(6)

(a)

(b)

(c)

FIGURE 2. (a) An example of sequencing result showing clear and high quality peaks without noises (b) Alignment result of exon 11 from subjects with reference CCDS. A single nucleotide substitution c.1177G>T has been detected in P4 (c) The alignment of protein sequence of all subjects predicts the alteration of 393^rd amino acid from Alanine to Serine (p.Ala393Ser) in

P4.

A missense variant c.1177G>T (p.Ala393Ser) was found in P4 and N13, N17, N18, N22, and N29. This finding has been reported before and listed in a number of databases. Tomatsu et al. reported this particular variant in 1998 [12] and 2005 [13] as a polymorphism since it was also found in the control group. According to ClinVar, the pathogenicity of this variant is benign [19]. Supporting details are also provided by many genome mapping projects that have been carried out across the globe. Based on the UCSC Genome Browser database, the average minor allele frequency (MAF) of c.1177G>T is more than 5% globally [20]. Another substitution was reported at position c.1177 by Terzioglu et al. in 2002. They found that the mutation was a frameshift mutation (c.1177_1178insT), and it was reported as pathogenic [18]. We analyzed the pathogenicity level of c.1177G>T (p.Ala393Ser) using MutPred2 [14],

(7)

Provean [15], PMUT [16], and MutationT@ster [17] and the result is shown in Table 2. According to Provean and PMUT, this mutation is categorized as a neutral variant [15, 17], while according to MutationT@ster, this mutation is categorized as a polymorphic variant [16], both means that the mutation is not affecting the patient 4. Based on the bioinformatics predictions and the presence of this variant in control samples, we also assumed that this variant is benign.

TABLE 2. Mutation Prediction of c.1177G>T (p.Ala393Ser)

MutPred2 Provean PMUT MutationT@ster

Prediction Benign Neutral Neutral Polymorphism

Probability 0.444 -1.577 0.44 0.9999589807

Scale 1 Threshold: -2.5 1 1.0

CONCLUSION

This study provides additional data in exon 11 of GALNS gene in MPS IVA patients in Indonesia. We have detected one variant in this research c.1177G>T (p.Ala393Ser) that has been classified as benign. Further research is needed to identify the details of other variants in other exons of GALNS gene in MPS IVA patients in Indonesia.

ACKNOWLEDGMENT

The authors thanked The Human Genetic Research Center IMERI FK UI, The Department of Pediatric, and The Department of Medical Biology for providing support and their cooperation during the research. The authors also thanked Dr. Retno Lestari as the academic counselor from The Department of Biology, Faculty of Mathematics and Natural Science to be involved in this research. This work is funded by Hibah Klaster IMERI 2018 Fakultas Kedokteran Universitas Indonesia.

REFERENCES

1. Online Mendelian Inheritance in Man, Mucopolysaccharidosis, type IVA; MPS4A. [Online]. Available from:

https://www.omim.org/entry/253000. [Accessed, May 20^th, 2020].

2. B. Donida, D. P. Marchetti, G. B Biancini, M. Deon, P. R. Manini, H. T. da Rosa, et al., Biochimica et Biophysica Acta 1852, pp. 1012-1019 (2015).

3. NCBI CCDS Database, Report for CCDS10970.1 (current version). [Online]; Available from : https://www.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi?REQUEST=CCDS&GO=MainBrowse&DATA=CCDS 10970.1. [Accessed, May 20^th, 2020].

4. National Organization for Rare Disorders, ‘Mucopolysaccharidoses’. [Online]. Available from : https://rarediseases.org/rare-diseases/mucopolysaccharidoses/. [Accessed, May 20^th, 2020].

5. Y. Rivera-Colon, E. K. Schutsky, A. Z. Kita, and S. C. Garman, Journal of Molecular Biology 423, pp. 736- 751 (2012).

6. A. Morrone, et al., Human Mutation 35(11), pp. 1271-1279 (2014).

7. N. Yamada, et al., Human Mutation 11, pp. 202--208 (1998).

8. Z. Kato, et al., Human Genetics 101, pp. 97-101 (1997).

9. S. Tomatsu, et al., Journal of Medical Genetics 41, pp. 1-6 (2004).

10. A. Morrone, et al., Molecular Genetics and Metabolism 112, pp. 160-170 (2014).

11. Thermo Scientific, T123 Technical Bulletin: Interpretation of Nucleic Acid 26 (ThermoScientific, Wilmington, 2012).

12. S. Tomatsu, et al., Human Mutation 1, pp. S42-6 (1998).

13. S. Tomatsu, et al., Human Mutation 26, pp. 500-512 (2005).

14. V. Pejaver, et al., BioRxiv 134981, pp. 1-28 (2017).

15. Y. Choi, G. E. Sims, S. Murphy, J. R. Miller, and A. P. Chan. PLoS ONE 7, pp. 1-13 (2012).

16. E. Lubeck, A. F. Coskun, T. Zhiyentayev, M. Ahmad, and L. Cai, Nature Methods 10, pp. 865-867 (2013).

(8)

17. V. Lopez-Ferrando, A. Gazzo, X. de la Cruz, M. Orozco, and J. L. Gelpi. Nucleic Acids Research 45, pp.

W222-228 (2017).

18. M. Terzioglu, A. Tokatli, T. Coskun, and S. Emre, Human Mutation 20, pp. 1-7 (2002).

19. M. J. Landrum, J. M. Lee, G. R. Riley, W. Jang, W. S. Rubinstein, D. M. Church, and D. R. Maglott, Nucleic Acids Research 42, pp. D980-985 (2014).

20. M. E. Mangan, J. M. Williams, R. M. Kuhn, and W. C. Lathe III. Current Protocols in Molecular Biolgy 19, pp. 1-44 (2009).