• Tidak ada hasil yang ditemukan

Evaluation of SYBR green I based visual loop-mediated isothermal amplification (LAMP) assay for genus and species-specific diagnosis of malaria in P. vivax and P. falciparum endemic regions

N/A
N/A
Protected

Academic year: 2023

Membagikan "Evaluation of SYBR green I based visual loop-mediated isothermal amplification (LAMP) assay for genus and species-specific diagnosis of malaria in P. vivax and P. falciparum endemic regions"

Copied!
7
0
0

Teks penuh

(1)

INTRODUCTION

Malaria is one of the major public health problems of the developing countries resulting in considerable morbidity, mortality and economic loss. World Malaria Report, 2013 illustrated that 97 out of 104 malaria-endem- ic countries had ongoing transmission of the malaria para- site in 2013 with an estimated 3.4 billion people at risk, of which 1.2 billion are at high risk1. India’s National Vector Borne Disease Control Programme (NVBDCP) has re- ported about 1.0 million cases each year from 2011–152. In India, the incidence of malaria has declined over the years but it still bears the highest malaria burden in South- east Asia, the second most affected region in the world after Africa1.

Early and accurate malaria diagnosis is essential for

appropriate treatment of patients. Microscopy is the most suitable and cost-effective technique for the diagnosis of malaria in field settings. In ideal conditions, 4–20 para- sites/µl can be detected in the Giemsa-stained thick blood film by a well-trained staff but in the field condition this threshold decreases to 50–100 parasites/µl. Antigen-cap- ture immunochromatographic technology based malaria rapid diagnostic tests (RDTs) for detection of the P. falci- parum–specific antigen histidine-rich protein 2 (PfHRP2) or parasite-specific lactate dehydrogenase (pLDH) are also widely used. RDTs provide the improved speed and precision for malaria diagnosis in areas where standard laboratory diagnosis is not available. Low detection limit of >200 parasites/µl and false positive results due to the persistence of antigen after parasite clearance are ma- jor concerns with RDTs3. Further, recent reports of false

Evaluation of SYBR green I based visual loop-mediated isothermal amplification (LAMP) assay for genus and species-specific diagnosis of malaria in P. vivax and P. falciparum endemic regions

Ruchi Singh

1-2

, Dhirendra Pratap Singh

1

, Deepali Savargaonkar

1

, Om P. Singh

1

, Rajendra M.

Bhatt

3

& Neena Valecha

1

1National Institute of Malaria Research (ICMR), Dwarka; 2National Institute of Pathology (ICMR), Safdarjung Hospital Campus, New Delhi; 3National Institute of Malaria Research, Field Unit, Raipur, Chhattisgarh, India

ABSTRACT

Background & objectives: Loop-mediated isothermal amplification (LAMP) is an emerging nucleic acid based diag- nostic approach that is easily adaptable to the field settings with limited technical resources. This study was aimed to evaluate the LAMP assay for the detection and identification of Plasmodium falciparum and P. vivax infection in malaria suspected cases using genus and species-specific assay.

Methods: The 18S rRNA-based LAMP assay was evaluated for diagnosis of genus Plasmodium, and species- specific diagnosis of P. falciparum and P. vivax, infection employing 317 malaria suspected cases, and the results were compared with those obtained by 18S nested PCR (n-PCR). All the samples were confirmed by microscopy for the presence of Plasmodium parasite.

Results: The n-PCR was positive in all Plasmodium-infected cases (n=257; P. falciparum=133; P. vivax=124) and negative in microscopy negative cases (n=58) except for two cases which were positive for P. vivax, giving a sen- sitivity of 100% (95% CI: 97.04–100%) and a specificity of 100% (95% CI: 88.45–99.5%). Genus-specific LAMP assay missed 11 (3.2%) microscopy and n-PCR confirmed vivax malaria cases. Considering PCR results as a refer- ence, LAMP was 100% sensitive and specific for P. falciparum, whereas it exhibited 95.16% sensitivity and 96.7%

specificity for P. vivax. The n-PCR assay detected 10 mixed infection cases while species-specific LAMP detected five mixed infection cases of P. vivax and P. falciparum, which were not detected by microscopy.

Interpretation & conclusion: Genus-specific LAMP assay displayed low sensitivity. Falciparum specific LAMP assay displayed high sensitivity whereas vivax specific LAMP assay displayed low sensitivity. Failed detection of vivax cases otherwise confirmed by the n-PCR assay indicates exploitation of new targets and improved detection methods to attain 100% results for P. vivax detection.

Key words LAMP; malaria; molecular diagnosis; PCR; Plasmodium falciparum; P. vivax

(2)

negative results by RDTs due to deletion of PfHRP2 and PfHRP3 genes poses problem in the detection of P. falci- parum4-5. The low parasitaemia in vivax patients and in- stability of lactate dehydrogenase at higher temperatures pose difficulty in RDT based detection of P. vivax.

Several nucleic acid amplification methods like nest- ed PCR (n-PCR) and real-time quantitative PCR have been developed for the diagnosis of malaria. Compared to microscopy, these methods have higher sensitivity, with detection limit of 1–5 parasites/µl of peripheral blood, and greater specificity for mixed infection6-10. However, the long turn around time, high cost, and availability only in well-equipped laboratories render these methods inad- equate for routine diagnosis in hospital laboratories and field clinics in the areas endemic for malaria.

Loop-mediated isothermal amplification (LAMP) is a nucleic acid amplification method that relies on auto- cycling strand-displacement DNA synthesis performed with Bst DNA polymerase. The amplification products are stem-loop DNA structures with several inverted repeats of the target and structures with multiple loops11. The principal merit of this method is that it does not require denaturation of the DNA template, and all the reactions can be conducted under isothermal conditions (ranging from 60 to 65°C). The method produces a large amount of amplified product, resulting in easier detection simply by the visual judgment of the turbidity or fluorescence of the reaction mixture12. Several investigators have reported and commended the usefulness of LAMP methods for the rapid identification of Plasmodium, Trypanosoma, Babe- sia and Leishmania, etc13-16. LAMP has relevant charac- teristics of a potential point of care test for diagnosis of malaria as it exhibits high sensitivity with detection limit of 0.2–5 parasite/µl and the cost of reagent is equivalent to market cost of RDTs17.

First report on the use of LAMP assay for diagnosis of malaria in the clinically proven cases dates back in 2006, wherein Poon et al14 reported the detection of highly con- served 18S ribosomal RNA gene of P. falciparum. The malaria diagnosis by LAMP does not require expensive reagents (for DNA extraction), turbidimeter, thermal cycler, or skilled technicians and can easily be adapted to the field settings with limited technical resources/sup- port14,18. There are many reports where the LAMP assay has been used for Plasmodium spp. detection in blood with high sensitivity and specificity14,19-23. Recently, the assay has been found to be applicable for noninvasive de- tection of P. vivax and P. falciparum using saliva and urine samples24-25. The Pan/Pf LAMP kit has shown promising results in field-based diagnosis and was found reliable for the detection of low parasitaemia from filter paper derived

samples26-27. LAMP assays based on real-time measure- ment of DNA amplification have been applied with high sensitivity and specificity for Plasmodium detection28-29.

Although, P. falciparum causes the most severe form of the disease, its geographic distribution overlaps with P.

vivax in India and therefore, it requires the LAMP assay capable for identification of both species, as the mixed in- fection often remains unrecognized. In the present study, the applicability of the LAMP assay was evaluated for de- tection and identification of P. falciparum and P. vivax in malaria suspected cases and further the results of LAMP assay were compared with those of conventional micros- copy and nested PCR.

MATERIAL & METHODS Study subjects and sample collection

A total of 317 febrile individuals suspected of having malaria, attending/referred to the clinic at the National Institute of Malaria Research (NIMR), New Delhi from July 2011 to August 2013, and at NIMR Field Unit, Rai- pur between the months of December 2011 and 2012 were included in the study. The sample collection and labora- tory investigations were performed as outlined in Fig. 1.

Finger-prick blood samples were collected in heparinized vials or on filter paper as dried blood spot and stored at 4°C until further use.

Ethics statement

The study was approved by the Institutional Ethics Committee of NIMR, New Delhi (Approval No.ECR/

NIMR/EC/2011/40). Written informed consent was ob- tained from each individual or parent/guardian (in cases of minors) before enrolment in the study.

Fig. 1: Schematic representation of sample collection from sus- pected malaria patients and various laboratory investigations performed on samples.

(3)

Microscopy

Thick blood smears were examined under 1000X magnification by microscopists with extensive experi- ence in the identification of malaria parasites. The num- ber of parasites per 200 white blood cells (WBCs) were counted and the parasite density was calculated assuming a leukocyte count of 8000/ml.

DNA extraction

The DNA was extracted using Qiagen DNA isolation kit according to manufacturer’s instructions from dried filter paper spot or 0.1 ml blood .

18 S rRNA n-PCR assay

For n-PCR, the species-specific nucleotide sequenc- es of the 18S rRNA genes of P. falciparum and P. vivax were amplified as described previously8-9, 30 with slight modifications. Nest 1 PCR amplification was performed in a 20 μl reaction mixture containing 10 pmoles of each primer (rPLU 1 TCAAAGAATAAGCCATGCAAGTGA and rPLU 2 TAACCCTGTTGTTGCCTTAAACTCC), 4 mM MgCl2, PCR buffer (50 mM, KCl, 10 mMTris-HCl), 200 mM of each deoxynucleoside triphosphate, and 1.25 units of TaqDNA polymerase and 5 μl of sample DNA.

For Nest 2 assay 1 µl of Nest 1 PCR product was used with 10 pmoles of respective species-specific primers: P. vivax VIV F 5′-CGCTTCTAGCTTAAT CCACATAACT- GATAC-3′; VIV R 5′-ACTTCCAAGCCGAAGCAAAG AAAGTCCTTA-3′ and P. falciparum FAL F 5′-TTA-

AACTGGTTTGGGAAAACCAAATATATT-3′; FALR ACACAATGAACTCAATCATGACTACCCG TC. The amplified products were visualized in 2% agarose gels stained with ethidium bromide.

LAMP assay and analysis of LAMP products

The genus and species-specific LAMP primer sets designed on the basis of the genus and the nucleotide sequences of the 18S rRNA genes of P. falciparum and P. vivax as described previously were used in the study21 (Table 1). The reaction mixture (25 µl), containing 1.6 to 2.4 mM of each primers FIP and BIP, 0.2 mM of each primers F3 and B3c, 0.8 mM of each primers LPF and LPB, 2 X reaction buffer (12.5 µl), Bst DNA polymerase (1 µl), and 5 µl of DNA sample, was incubated at 60°C for 100 min and then the enzyme was inactivated at 80°C for 2 min.

To visualize and confirm the results fluorescent dye SYBR Green I was added to the completed reaction that gives fluorescent green colour in the positive reaction as it gets intercalated in the nucleic acid while the negative reaction remained orange indicating no amplification.

The two individuals scored the LAMP results and the con- sensus of the results was considered for further analysis.

Diagnostic accuracy analysis

Specificity, sensitivity, positive and negative predic- tive values and diagnostic accuracy of various tests were calculated using free online diagnostic accuracy calcu-

Table 1. Primer sequences used for genus and species-specific amplification of Plasmodium parasite

Genus/species Primer Sequences (5′-3′)

Plasmodium genus PLU F3 GTATCAATCGAGTTTCTGACC

PLU B3 CTTGTCACTACCTCTCTTCT

PLU FIP TCGAACTCTAATTCCCCGTTACCTATCAGCTTTTGATGTTAGGGT

PLU BIP CGGAGAGGGAGCCTGAGAAATAGAATTGGGTAATTTACGCG

PLU LPF CGTCATAGCCATGTTAGGCC

PLU LPB AGCTACCACATCTAAGGAAGGCAG

P. falciparum PfF3 TGTAATTGGAATGATAGGAATTTA

PfB3c GAAAACCTTATTTTGAACAAAGC

PfFIP AGCTGGAATTACCGCGGCTGGGTTCCTAGAGAAACAATTGG

PfBIP TGTTGCAGTTAAAACGTTCGTAGCCCAAACCAGTTTAAATGAAAC

PfLPF GCACCAGACTTGCCCT

PfLPB TTGAATATTAAAGAA

P. vivax PvF3 GGAATGATGGGAATTTAAAACCT

PvB3c ACGAAGTATCAGTTATGTGGAT

PvFIP CTATTGGAGCTGGAATTACCGCTCCCAAAACTCAATTGGAGG

PvBIP AATTGTTGCAGTTAAAACGCTCGTAAGCTAGAAGCGTTGCT

PvLPF GCTGCTGGCACCAGACTT

PvLPB AGTTGAATTTCAAAGAATCG

(4)

lator (http://www.hutchon.net/Diagnostic-test.htm). The kappa (k) statistics was applied to calculate the agreement between the results observed by LAMP and microscopy vs n-PCR assay.

RESULTS Patient profile and microscopy results

In total, 317 blood samples from febrile individuals;

220 (69.5%) males and 97 (29.5%) females were screened for Plasmodium infection by microscopy, 18S-PCR and LAMP (genus and species-specific) assays. The age range was 1 to 80 yr. The microscopic examination revealed malaria parasites in the blood smears of 257 (81%) pa- tients. Of these, 124 (39.1%) were found positive for P.

vivax (320–61,600 parasites/µl) and 133 (41.9%) were positive for P. falciparum (200–4,96,000 parasites/µl) in- fection, while 60 patients were microscopically negative for the parasite.

Diagnostic performance of molecular assays (18S n- PCR and LAMP assay for species-specific diagnosis) vs microscopy

The results of microscopy, n-PCR and genus and spe- cies-specific LAMP assay for 317 investigated patients are detailed in Tables 2 and 3. The microscopic examina- tion detected 257 patients with Plasmodium infection; of these 124 were diagnosed with P. vivax and 133 were P.

falciparum cases. In aggregate, 113 samples were posi- tive for P. vivax and 127 for P. falciparum and 58 cases were negative for Plasmodium infection by all the three molecular assays (Table 2); rest of the samples exhibited discordant results. The discordant results (5.6%) were mainly P. vivax cases and mixed infections. The micro- scopic slides of samples exhibiting discordant results and an equal number of randomly selected slides from sam- ples with concordant results were re-examined blindly by two independent microscopists.

The 18S n-PCR assay detected Plasmodium in all 257 (100%) microscopically positive samples. Of these, 120 were P. vivax infection and 127 were P. falciparum in- fection, while 10 patients were found positive for both P.

vivax and P. falciparum indicating mixed infection. Ge- nus-specific LAMP assay detected 246/257 microscopi- cally positive samples. The test was found 96.8% sensitive and 96.67% specific for detection of Plasmodium spp. in blood samples. It failed to detect the 11/124 microscopi- cally confirmed P. vivax infections including two cases of mixed infection detected by n-PCR. PvLAMP detected 118 samples to be infected with P. vivax while 133 sam- ples were found positive for P. falciparum by PfLAMP as- say and five samples were mixed infections. All the three molecular assays detected two cases of P. vivax from 60 microscopically negative patient samples.

Sensitivity and specificity of molecular assays (LAMP and n-PCR) for identifying mixed infection of Plasmo- dium spp.

Microscopic examination of slides did not identify any mixed infections. The n-PCR assay identified 10 cas- es of mixed infection of P. falciparum and P. vivax among 317 blood samples tested. Out of these 10, six cases were microscopically diagnosed as P. falciparum and remain- ing four as P. vivax. On the other hand, LAMP assay iden- tified five cases of mixed infection.

Considering n-PCR as reference, the sensitivity and specificity of microscopy in identifying P. falciparum in- fections were 100% (k=0.974); for P. vivax infections it was 98.4 and 100%, respectively (k=0.948) and nil for mixed infection (k=0) (Table 3). The sensitivity and specificity of LAMP assay for P. falciparum identification were 100% (k=0.961), whereas for P. vivax identification it was 95.25 and 100%, respectively (k=1). The n-PCR assay based parasite detection revealed higher number of mixed infections identification compared to LAMP assay (3 vs 1.5%; k=0.658) (Table 3). The data indicates

Table 2. Detailed comparison of microscopy, n-PCR, species-specific and genus specific LAMP for malaria parasite detection methods

Microscopy Nested PCR Species-specific LAMP

(Pf/PvLAMP) Genus-specific LAMP (Pan LAMP)

P. falciparum (133) P. falciparum (133)

P. vivax (6) P. falciparum (133)

P. vivax (4) Plasmodium spp. (133)

Negative (0) P. vivax (124) P. vivax (124)

P. falciparum (4) P. vivax (118)

P. falciparum (1) Plasmodium spp. (113) Negative (11)

Negative (60) Negative (58)

P. vivax (2) Negative (58)

P. vivax (2) Negative (58)

Plasmodium spp. (2) Figures in parentheses indicate number of samples.

(5)

that molecular tests have better sensitivity to detect low- density parasitaemia of the Plasmodium species that often remains masked by the high density parasitaemia of an- other Plasmodium species in mixed infection.

DISCUSSION

Rapid, reliable and species-specific diagnostic tools are indispensable for effective control of malaria. Light microscopy-based diagnosis to date is the most effective method; however, it demands technical expertise and suf- fers low detection limits in field conditions. This study was performed to compare the diagnostic performance of Plasmodium genus-specific, P. falciparum and P. vivax specific LAMP assays in a visual format and standard species-specific n-PCR assay with the microscopic ex- amination for P. falciparum and P. vivax specific diagnosis of malaria infection.

Genus-specific LAMP assay accurately identified P.

falciparum cases, however, it failed to diagnose 11 con- firmed cases of P. vivax (<5000 parasites/µl) infection.

The species-specific PfLAMP assay evaluated in this study displayed high sensitivity and specificity of 100%

same as in n-PCR assay using blood samples, however, low detection rate was observed for P. vivax infection by PvLAMP assay compared to that with n-PCR. The n- PCR assay is a two-step assay and displays detection limit of 1 parasite/µl compared to LAMP assay with a detec- tion limit of 40 parasite/µl for P. vivax. High sensitivity (100%) of LAMP for P. falciparum was observed in this study as well as in others14, 21, whereas for P. vivax detec- tion variable sensitivity of LAMP assay ranging from 36 to 100% have been reported by researchers21, 29. Researchers have suggested the use of other targets like mitochondrial genes and consensus sequence repeats to achieve high sensitivity and specificity for Plasmodium detection. This

study adopted the visual detection method that does not have a defined cut-off limit and therefore, it is likely that six P. vivax cases with low parasitaemia though positive (< 1000 parasites/µl, n=3; <3000 parasites/µl, n=3) have been read as false negative compared to n-PCR assay.

Using microscopy as the reference assay, standard 18S n-PCR assay detected Plasmodium in all 257 (100%) microscopically positive samples. Of these 120 were P.

vivax infection and 127 were P. falciparum infection, while 10 patients were found positive for both P. vivax and P. falciparum (mixed infection). Similarly, PvLAMP detected 117 samples to be infected with P. vivax while PfLAMP detected 129 samples as P. falciparum and re- maining five samples were mixed infections. Giemsa mi- croscopy remains the gold standard for malaria diagnosis in resource-limited environments; however, its sensitivity and specificity compared to molecular assays is limited in identifying mixed infection. Hence, novel, rapid and simplified molecular techniques like LAMP assay should be widely used for species-specific diagnosis of malaria in endemic areas.

CONCLUSION

The LAMP assay could be made applicable to a re- source-limited setting as a point of care diagnostic test.

However, to develop it as a point of care test it needs to be simplified further by eliminating the DNA isolation step.

In this study, it was observed that Plasmodium genus- specific LAMP assay failed to diagnose 11(3.2%) cases of vivax malaria confirmed by n-PCR. Screening of clini- cal samples first by Plasmodium genus-specific LAMP assay and further confirmation by a species-specific assay based on endemicity of species in the area is proposed for epidemiological surveillance. However, in areas where two or more species are co-existing, screening for clini-

Table 3. Sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV) and agreement (Kappa statistics) of microscopy and LAMP assay vs nested PCR assay (18S n-PCR)

as the reference standard for diagnosis of malaria in blood samples (n=317) Species Sensitivity

(95% CI) Specificity

(95% CI) PPV

(95% CI) NPV

(95% CI) Agreement with n–PCR

Cohen’s Kappa coefficient (k) Microscopy

P. vivax 98.41 (94.37– 99.76) 100 (93.78– 100) 100 (97.04–100) 96.67 (88.45– 99.50) 0.948 P. falciparum 100 (97.24– 100) 100 (93.78– 100) 100 (97.24– 100) 100 (93.98 –100) 0.974

Pv+Pf 0 0 0 0 0

LAMP assay

P. vivax 95.24 (89.92– 98.22) 100 (93.78–100) 100 (96.94– 100) 90.62 (80.69– 96.46) 0.961 P. falciparum 100 ( 97.24– 100) 100 (93.98– 100) 100 (97.24– 100) 100 (93.98 –100) 1

Pv+Pf 50 98.4 0.658

Pv+Pf—Mixed infection.

(6)

cal diagnosis is debatable and such situations demand a simplified assay capable of simultaneously detecting two or more Plasmodium spp.

Conflict of interest: None to declare.

ACKNOWLEDGEMENTS

The study was supported by a grant under Vector Borne Diseases Science Forum (5/8-7(231)2011-ECD- II) from the Indian Council of Medical Research, New Delhi, India. The technical support of Mrs. Alka Kapoor is gratefully acknowledged. The authors are grateful to Prof. A.P. Dash and Dr S.K. Subbarao for con- stant encouragement and critical suggestions during the study.

REFERENCES

1. Malaria. World Malaria Report 2013. Geneva: World Health Organization 2013; p. 1–286.

2. Malaria. National Vector Borne Disease Control Programme 2016. Available from: www.nvbdcpgov.in (Accessed on May 3, 2016).

3. McMorrow ML, Aidoo M, Kachur SP. Malaria rapid diagnostic tests in elimination settings—Can they find the last parasite?

Clin Microbiol Infect 2011; 17(11): 1624–31.

4. Kumar N, Pande V, Bhatt RM, Shah NK, Mishra N, Srivastava B, et al. Genetic deletion of HRP2 and HRP3 in Indian Plas- modium falciparum population and false negative malaria rapid diagnostic test. Acta Trop 2013; 125(1): 119–21.

5. Koita OA, Doumbo OK, Ouattara A, Tall LK, Konaré A, Diaki- té M, et al. False-negative rapid diagnostic tests for malaria and deletion of the histidine-rich repeat region of the HRP2 gene.

Am J Trop Med Hyg 2012; 86(2): 194–8.

6. Perandin F, Manca N, Calderaro A, Piccolo G, Galati L, Ricci L, et al. Development of a real-time PCR assay for detection of Plasmodium falciparum, Plasmodium vivax and Plasmodi- um ovale for routine clinical diagnosis. J Clin Microbiol 2004;

42(3): 1214–9.

7. Hanscheid T, Grobusch MP. How useful is PCR in the diagnosis of malaria? Trends Parasitol 2002; 18(9): 395–8.

8. Snounou G, Viriyakosol S, Jarra W, Thaithong S, Brown KN.

Identification of the four human malaria parasite species in field samples by the polymerase chain reaction and detection of a high prevalence of mixed infections. Mol Biochem Parasitol 1993; 58(2): 283–92.

9. Singh B, Bobogare A, Cox-Singh J, Snounou G, Abdullah MS, Rahman HA. A genus- and species-specific nested polymerase chain reaction malaria detection assay for epidemiologic stud- ies. Am J Trop Med Hyg 1999; 60(4): 687–92.

10. Singh B, Kim Sung L, Matusop A, Radhakrishnan A, Sham- sul SS, Cox-Singh J, et al. A large focus of naturally acquired Plasmodium knowlesi infections in human beings. Lancet 2004;

363(9414): 1017–24.

11. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res 2000; 28(12): E63.

12. Mori Y, Nagamine K, Tomita N, Notomi T. Detection of loop- mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem Biophys Res Commun 2001; 289(1): 150–4.

13. Ikadai H, Tanaka H, Shibahara N, Matsuu A, Uechi M, Itoh N, et al. Molecular evidence of infections with Babesia gibsoni parasites in Japan and evaluation of the diagnostic potential of a loop-mediated isothermal amplification method. J Clin Micro- biol 2004; 42(6): 2465–9.

14. Poon LL, Wong BW, Ma EH, Chan KH, Chow LM, Abeye- wickreme W, et al. Sensitive and inexpensive molecular test for falciparum malaria: Detecting Plasmodium falciparum DNA directly from heat-treated blood by loop-mediated isothermal amplification. Clin Chem 2006; 52(2): 303–6.

15. Takagi H, Itoh M, Islam MZ, Razzaque A, Ekram AR, Hashi- ghuchi Y, et al. Sensitive, specific, and rapid detection of Leish- mania donovani DNA by loop-mediated isothermal amplifica- tion. Am J Trop Med Hyg 2009; 81(4): 578–82.

16. Thekisoe OM, Inoue N, Kuboki N, Tuntasuvan D, Bunnoy W, Borisutsuwan S, et al. Evaluation of loop-mediated isothermal amplification (LAMP), PCR and parasitological tests for detec- tion of Trypanosoma evansi in experimentally infected pigs. Vet Parasitol 2005; 130 (3–4): 327–30.

17. Cordray MS, Richards-Kortum RR. Emerging nucleic acid- based tests for point-of-care detection of malaria. Am J Trop Med Hyg 2012; 87(2): 223–30.

18. Abdul-Ghani R, Al-Mekhlafi AM, Karanis P. Loop-mediated isothermal amplification (LAMP) for malarial parasites of hu- mans: Would it come to clinical reality as a point-of-care test?

Acta Trop 2012; 122(3): 233–40.

19. Chen JH, Lu F, Lim CS, Kim JY, Ahn HJ, Suh IB, et al. Detec- tion of Plasmodium vivax infection in the Republic of Korea by loop-mediated isothermal amplification (LAMP). Acta Trop 2009; 113 (1): 61–5.

20. Polley SD, Mori Y, Watson J, Perkins MD, González IJ, Notomi T, et al. Mitochondrial DNA targets increase sensitivity of ma- laria detection using loop-mediated isothermal amplification. J Clin Microbiol 2010; 48(8): 2866–71.

21. Han ET, Watanabe R, Sattabongkot J, Khuntirat B, Sirichaisin- thop J, Iriko H, et al. Detection of four Plasmodium species by genus- and species-specific loop-mediated isothermal ampli- fication for clinical diagnosis. J Clin Microbiol 2007; 45(8):

2521–8.

22. Paris DH, Imwong M, Faiz AM, Hasan M, Yunus EB, Silamut K, et al. Loop-mediated isothermal PCR (LAMP) for the diag- nosis of falciparum malaria. Am J Trop Med Hyg 2007; 77(5):

972–6.

23. Poschl B, Waneesorn J, Thekisoe O, Chutipongvivate S, Kara- nis P. Comparative diagnosis of malaria infections by micros- copy, nested PCR, and LAMP in northern Thailand. Am J Trop Med Hyg 2010; 83(1): 56–60.

24. Singh R, Savargaonkar D, Bhatt R, Valecha N. Rapid detection of Plasmodium vivax in saliva and blood using loop mediated isothermal amplification (LAMP) assay. J Infect 2013; 67(3):

245–7.

25. Ghayour Najafabadi Z, Oormazdi H, Akhlaghi L, Meamar AR, Nateghpour M, Farivar L, et al. Detection of Plasmodium vivax and Plasmodium falciparum DNA in human saliva and urine:

Loop-mediated isothermal amplification for malaria diagnosis.

Acta Trop 2014; 136: 44–9.

26. Hopkins H, Gonzalez IJ, Polley SD, Angutoko P, Ategeka J, Asiimwe C, et al. Highly sensitive detection of malaria para-

(7)

sitemia in a malaria-endemic setting: Performance of a new loop-mediated isothermal amplification kit in a remote clinic in Uganda. J Infect Dis 2013; 208(4): 645–52.

27. Aydin-Schmidt B, Xu W, Gonzalez IJ, Polley SD, Bell D, Shake- ly D, et al. Loop mediated isothermal amplification (LAMP) ac- curately detects malaria DNA from filter paper blood samples of low density parasitaemias. PLoS One 2014; 9(8): e103905.

28. Surabattula R, Vejandla MP, Mallepaddi PC, Faulstich K, Pola- varapu R. Simple, rapid, inexpensive platform for the diagnosis of malaria by loop mediated isothermal amplification (LAMP).

Exp Parasitol 2013; 134(3): 333–40.

29. Patel JC, Oberstaller J, Xayavong M, Narayanan J, DeBarry JD, Srinivasamoorthy G, et al. Real-time loop-mediated isothermal amplification (Real Amp) for the species-specific identification of Plasmodium vivax. PLoS One 2013; 8(1): e54986.

30. Valecha N, Pinto RG, Turner GD, Kumar A, Rodrigues S, Dub- hashi NG, et al. Histopathology of fatal respiratory distress caused by Plasmodium vivax malaria. Am J Trop Med Hyg 2009; 81(5): 758–62.

31. Drain PK, Hyle EP, Noubary F, Freedberg KA, Wilson D, Bishai WR, et al. Diagnostic point-of-care tests in resource-limited set- tings. Lancet Infect Dis 2014; 14(3): 239–49.

Correspondence to: Dr Ruchi Singh, Scientist 'E', National Institute of Pathology (ICMR), Safdarjung Hospital Campus, New Delhi–110 029, India.

E-mail: [email protected]; [email protected]

Received: 19 May 2016 Accepted in revised form: 19 December 2016

Referensi

Dokumen terkait