Genetic characterization and molecular phylogeny of Aedes albopictus (Skuse) species from Sonitpur district of Assam, India based on

(1)

INTRODUCTION

Mosquitoes are highly efficient vectors of diseases like dengue, malaria, yellow fever, chikungunya, etc. Pres- ently, dengue is a serious arboviral disease in Asia, South and Central America, and Africa; transmitted mainly by Aedes aegypti and Ae. albopictus vectors. Several recent studies have detected the dengue virus in Ae. albopictus in rural and urban settings of India and identified this species as a potential dengue vector^1–2. The first major wide -spread epidemic of dengue occurred in India during 1996 involving areas in Delhi³ and Lucknow⁴ which subse- quently spread to all over the country^5–6. Recently, dengue is becoming one of the fastest emerging vector-borne diseases in Assam. Very few cases were reported from this region in the last decade, but in 2012 and 2013, mani-

fold increase in the number of dengue cases was recorded respectively⁷. In Sonitpur district of Assam, 13 cases were reported in the year 2012⁷.

Correct identification of the Aedes species involved in arbovirus transmission is very important to design strat- egies for vector surveillance and control programme.

Larval surveillance was conducted in dengue outbreak areas in Malaysia from 2008 until 2009⁸. Moreover, many closely related species of mosquitoes with varying ecology and host preferences are nearly inseparable morphologically⁹. This poses difficulty in identification of mosquitoes to a species or even genus level^10–12.

As a result, molecular methods of mosquito identification^13–15, genetic characterization^16–17, and molecular phylogeny^18–19 have gained increasing importance. Beebe et al²⁰ developed a molecular identification technique for

Genetic characterization and molecular phylogeny of Aedes albopictus (Skuse) species from Sonitpur district of Assam, India based on

COI and ITS1 genes

Momi Das

¹

, Manuj K. Das

²

& Prafulla Dutta

³

1Department of Life Sciences, Dibrugarh University, Dibrugarh; ²Department of Bioengineering and Technology, Institute of Science and Technology, Gauhati University, Guwahati; ³Regional Medical Research Centre (Indian Council of Medical Research), Northeast Region, Dibrugarh, Assam

ABSTRACT

Background & objectives: Aedes albopictus (Skuse) is one of the major vectors of dengue which is an emerging threat in Northeast part of India. The morphological characterisation of mosquitoes is time consuming and lacks accuracy for distinguishing closely related species. Hence, molecular methods of mosquito identification, genetic diversity and molecular phylogeny have gained increased importance. This study was aimed to identify and characterize the most abundant species of Aedes vectors collected from different breeding spots in Assam, Northeast India employing molecular as well as bioinformatics tools.

Methods: Ae. albopictus species was genetically characterized with internal transcribed spacer1 (ITS1) and cytochrome c oxidase subunit I (COI) genes and sequence analysis was carried out following molecular methods like PCR amplification, DNA sequencing and multiple sequence analysis. Maximum likelihood molecular phylogeny was reconstructed to define the evolutionary relationship among studied isolates and isolates from other parts of Southeast Asia.

Results: Molecular study revealed that all five subject specimens belonged to Ae. albopictus species as per both ITS1 and COI genes. Maximum likelihood tree based on ITS1 and COI genes showed that isolates were distinctly grouped into separate clusters. Almost similar pattern of amino acid frequencies in COI gene was found amongst the five studied isolates. However, amino acid frequency in ITS1 gene was found to be dissimilar, indicating polymorphisms in this gene, among the isolates.

Interpretation & conclusion: This is the first report among the Northeastern states of India describing the genetic make-up of Ae. albopictus species by virtue of highly conserved mitochondrial (mt) DNA and ribosomal (r) DNA gene sequences. This study also illustrates that the sequence diversity of these two genes in this mosquito species differs geographically which differentiate a population and brings unique identity.

Key words Aedes albopictus; COI; ITS1; molecular phylogeny; sequence analysis

(2)

differentiating Ae. aegypti and Ae. albopictus. Molecular detection method is accurate, quicker and economical in identifying the species. While the use of nuclear genes is not remarkable^21–24, mitochondrial (mt) genes have gained wide acceptance for analyzing genetic diversity in mosquitoes^25–26; since mitochondrial genome has specific advantages such as maternal lineage, lack of recombina- tion and lack of introns²⁷. Among the mt genes, cytochrome c oxidase subunit I (COI) is reported to be the most conserved gene in terms of amino acid sequences, and hence has distinct advantage for taxonomic studies²⁸. The COI gene is also used as molecular marker to distinguish unknown species, and enhance the identification and discovery of new species²⁹, when morphological traits do not clearly discriminate species³⁰. Besides COI, ribosomal DNA (rDNA) has been also used for molecular identification of species because it is one of the multigene families which are frequently distributed in the genome. Many researchers have used rDNA regions for molecular studies of Aedes mosquitoes^31–32. Eukaryotic rDNA contains two internal transcribed spacer (ITS) regions, i.e. ITS1 and ITS2, flanked by 18S and the 28S ribosomal region. Amongst them, the ITS1 region is one of the most variable parts of the genome, which is able to affirm and align sequences according to the conserved parts of rRNAs. Hence, for phylogenetic analysis of closely related species it is the most suitable sequence³³. Gene sequences such as ITS1 and ITS2 of rDNA, COI and COII are helpful in constructing phylogenetic relationship in between species^34–49. Hence, molecular tools that could identify mosquito species even from a small piece of tissue from any developmental stage would be of great importance in mosquito taxonomy.

The objective of the study was molecular identification of the most abundant species of Aedes vectors collected from different breeding spots of Sonitpur district,

Assam and to establish the phylogenetic relationship with same species reported earlier from other parts of South- east Asia.

MATERIAL & METHODS Mosquito collection

Wild type Ae. albopictus larvae were collected from different geographical areas of Sonitpur district of Assam in pre-monsoon, monsoon and post-monsoon seasons during the period 2010–12. Dark plastic containers (15 cm diam; 12 cm depth) were used as an ovitrap. Larvae were collected from the natural breeding habitats as well as from the ovitraps set in residential areas using Pasteur pipette. Samples were collected from different areas of Sonitpur district, namely Tezpur (26.63°N, 92.80°E), Bihaguri (26.11°N, 91.83°E), Dhekiajuli (26.70°N, 92.5°E), Balipara (26.82°N, 92.77°E), Rangapara (26.82°N, 92.65°E), Biswanath Chariali (26.73°N, 93.15°E), North Jamuguri (26.78°N, 92.91°E), Gogra T.E.

(26.82°N, 92.68°E), Sirajuli (26.7°N, 92.54°E), Behali (26.85°N, 93.38°E) and Gohpur (26.88°N, 96.63°E) (Fig.

1). The collected larvae were reared to adult in the mosquito rearing room at the Defence Research Laboratory, Tezpur, Assam.

Morphological identification

The larvae collected from different sampling sites were identified using morphological characteristics such as comb scale and pecten teeth, and the adults reared from larvae were identified using standard keys⁵⁰_.

Molecular identification

Adult specimens were identified as Ae. albopictus by morphological characteristics. Individual adults from different areas were selected for molecular characterization.

Fig. 1:GPS map of Sonitpur district, Assam showing sampling sites.

(3)

Genomic and mitochondrial DNA extraction

Whole DNA was isolated from individual adult mosquito, reared from the collected larvae by DNeasy^® Blood and Tissue Kit (QIAGEN, USA) according to manufacturer’s standard protocol. Isolated DNA was eluted with provided elution buffer and preserved at –20°C till further molecular analysis.

PCR amplification of ITS1 and COI partial DNA sequence A 577 bp partial sequence of ITS1 gene from genomic DNA and a 520 bp partial sequence of COI gene from mitochondrial DNA was amplified from morphologically identified adult Ae. albopictus mosquitoes. The ITS1 partial sequence was amplified using AUF and AUR primer sequences, whereas COI partial fragment was amplified using the primers as described earlier⁵¹. For both ITS1 and COI, amplification was carried out in total of 50 µl reaction volume containing PCR reaction buffer at 1x concentration, both forward and reverse primers at 20 pmol final concentrations (Bioserve Biotechnologies, Hyderabad), 3 mM MgCl₂(Sigma-Aldrich, USA), 200 µM of each dNTP (Wraught, Germany) and 1 U/ml Taq DNA polymerase (Sigma-Aldrich, USA). About 2 µl of purified DNA was added as template to each amplification reaction. For amplification of these two gene fragments, two different thermal profiles were used. Table 1 illustrates about the oligonucleotide primers and PCR thermal profiles used for this study. All amplified PCR products were subjected to agarose gel electrophoresis (1.5%, prepared in 1x TAE buffer stained with ethidium bro- mide) with reference to a 50 bp DNA ladder. The DNA fragments were visualised in gel documentation system (Syngene, UK) under UV trans-illumination.

For DNA isolation, PCR master mix preparation and template addition, three different laminar air flow (LAF) hood (Labconco, Germany) were used. All LAF hoods were UV sterilised properly prior to use.

DNA sequencing and multiple sequence alignment For each gene, a total of five PCR products were selected for DNA sequencing. Amplified PCR products were purified using the QIAquick PCR purification kit

(QIAGEN, USA) according to the manufacturer’s standard protocol. Purified PCR products were outsourced to Biolink, New Delhi, India for capillary sequencing involving Sanger’s chain termination reaction. Double pass sequencing for both forward and reverse strand was performed for each of selected samples. Nucleotide sequences, thus obtained were edited in BioEdit software version 6.0.7 and consensus sequence was created isolate wise by aligning the forward and reverse nucleotide strand. Consensus sequences thus obtained were searched in basic local alignment search tool (BLAST) for similarity and deposited in GenBank, NCBI under accession number KC527656-KC527660 (ITS1) and KT260197- KT260201 (COI). Multiple sequence alignment (MSA) for both ITS1 and COI genes sequence was performed separately with sequences available in GenBank from other parts of Southeast Asia. The MSA was carried out in molecular evolutionary genetics analysis (MEGA) software version 6.06 using ClustalW tool following default parameters. Distance amongst multiple aligned sequences was calculated using Tamura 3-parameter model^52–53. Molecular phylogenetic tree reconstruction and relation- ship elucidation

Morphological data can fetch the related species, but molecular phylogeny can help in revealing closely related as well as sibling species under a genus. In molecular phylogenetic analysis, rDNA ITS1 and mt COI genes sequences of Ae. albopictus were used for construction of phylogenetic tree using Tamura 3-parameter model in MEGA 6.0 software⁵⁴. Also, each sequence was subjected to 1000 bootstrap replications for accuracy of the con- structed phylogenetic tree. A cluster was considered sig- nificant if it contain >50% permutated tree.

RESULTS

The morphological characteristics of both larvae and adult mosquitoes elucidated the subject specimens as Ae.

albopictus. Figure 2 shows morphological characters of larvae used for identification of species. The 577 bp partial coding fragment of rDNA ITS1 gene and 520 bp of

Table 1. PCR primer sequences and thermal cycle sequences used for amplification of ITS1 and COI genes from Ae. albopictus

Target Primer Primer sequence; 5'–3' Size PCR thermal profile

sequence name

ITS1 AUF TCAAAATTAAGGGTAGTGGT 577 bp 94°C for 5 min; 30 cycles of 94°C for 30 sec;

AUR GACTTCAACTGGCTTGAACT 55°C for 30 sec; 72°C for 2 min; 72°C for 4 min

COI For-COI GGAGGATTTGGAAATTGATTAGTTC 520 bp 94°C for 10 min; 30 cycles of 94°C for 30 sec;

Rev-COI CCCGGTAAAATTAAAATATAAACTTC 55°C for 30 sec; 72°C for 2 min; 72°C for 4 min

(4)

partial coding fragment of mt COI gene were success- fully amplified by the PCR protocol (Figs. 3 a and b).

The DNA sequencing result revealed that only five isolates were of high quality and the rest were not found suitable. BLAST results of the subject specimens indi- cated identity with Ae. albopictus species for both ITS1 gene (99% maximum identity) and COI gene (100% maximum identity). In MSA analysis, a single base mutation (Adenine instead of Guanine) in COI gene was observed at nucleotide position 2118 in two of the collected isolates, viz. isolate KT260199 and KT260201 and rest three isolates were found to have similar nucleotide sequences to that of other isolates from India and Southeast Asia.

On the contrary, MSA of ITS1 region revealed notice- able information about deletion, insertion and mutation in the collected samples. In BLAST analysis, maximum six base deletion was recorded in two isolates (KC527656 and KC527660) followed by a five base deletion in one isolate (KC527660). Number of other deletions present in the isolates has been given in Table 2. For reconstruction of the phylogeny, the Southeast Asian isolates which showed similarity and identity in BLAST result were in- cluded. Phylogenetic tree was built in two different ways, i.e. one in between the isolates investigated in present study; and the other in between isolates studied and the isolates reported from Southeast Asia, which provided a better picture about the diversity and evolutionary relationships. To the best of our knowledge this is the first report from Northeast region of India depicting the molecular phylogenetic relationship of Ae. albopictus mosquito species based on ITS1 and COI genes.

Based on ITS1 gene, maximum likelihood (ML) tree showed that these five isolates have been distinctly sepa- rated into two clusters, i.e. two isolates (KC527656 and KC527660) lie in a same cluster but three isolates (KC527657, KC527658, and KC527659) fall into two sub-clusters under another cluster. Whereas, in ML tree with two other Southeast Asian isolates, it was observed

Fig. 2:Larval identification of Aedes mosquitoes. Microscopic image (10×) of larvae showing differences in morphology of comb scales on the eighth segment of the abdomen and the shape of the pecten teeth on the siphon.

Fig. 3 (a): Amplification of 577 bp ITS1 region of Aedes albopictus collected from different areas of Sonitpur district. Lane M: 50 bp step ladder; Lane 1–7 and Lane 8–14: ITS1 gene from adult mosquito reared from larvae of different sampling spot; and Lane NTC: No template control.

Fig. 3(b): Amplification of 520 bp COI region of Ae. albopictus collected from different areas of Sonitpur district. Lane M: 50 bp step ladder; Lane 1–10: COI gene from adult mosquito reared from larvae of different sampling spot;

and Lane NTC: No template control.

Table 2. Transition and deletion recorded in COI and ITS1 genes sequences

Gene Isolates Transition Deletion

sequence

COI KT260199 * ---

KT260201 * ---

KC527656 */1 (******)

ITS1 KC527657 3 (**)

KC527658 3 (**) / (***)

KC527659 3 (**)/ (***)

KC527660 */2 (***)/(*****)/

(******)

Asterisk (*) in parentheses indicate numbers of base deletions and transitions within a sequence; and numeric before the parentheses indicate the number of presence of a transition or deletion.

that isolate KC527656 and KC527659 were grouped into a single cluster with two isolates from Malaysia, within which only one isolate from Assam (KC527656) was

(5)

found sub-clustered together with isolates from Malaysia and others (KC527657-KC527659) were grouped into a separate sub-cluster. But isolate KC527660 individually assorted into a single cluster showing that it is distinct from other isolates (Figs. 4 a and b). For COI gene, these studied isolates showed different relationship scenario with other isolates from Southeast Asia (Figs. 4 c and d).

The two isolates, i.e. KT260199 and KT260201 sub-clustered with isolates from Singapore as they are closely related. Other three isolates were found to have sub-clustered separately into two different group, viz. isolate KT260198 and KT260200 with Karnataka and Maharashtra, and isolate KT260197 with another isolate from Singapore. Constructing relationship among these studied isolates, it was found that these isolates have grouped into two separate clusters; KT260199 and KT260201 in one cluster and isolate KT260197, KT260198 and KT260200 in another cluster.

Almost similar pattern of amino acid frequencies in COI gene was found amongst the five studied isolates.

One of the isolate showed low lysine content in this coding gene, which is supplemented with increased number of other amino acids (Fig. 5a). On the contrary, amino acid frequency in ITS1 gene was found to be dissimilar indicating that polymorphisms in this gene differentiate each of these isolates. However, arginine was found high- est in frequencies in one isolate (KC527657) and isoleu- cine, methionine and tryptophan were recorded as nil in isolates KC527657, KC527656 and KC527660 respectively (Fig. 5b).

DISCUSSION

Morphological identification methods have limited capacity in differentiating sibling and closely related species of mosquitoes and this could be overcome by DNA- based identification methods such as rDNA region and mt gene COI. DNA-based identification methods use molecular markers such as nuclear ribosomal ITS, cytochrome b (Cyt-b) and cytochrome c oxidase subunits, COI, COII. Thus, this method can be used for the identification of adult as well as aquatic stages of the Aedes vectors during vector surveillance in arboviral outbreaks like dengue. In this present study, though all individual specimens were identified as Ae. albopictus both by morphological and molecular determination, but variations in nucleotide compositions were observed both in COI and ITS1 genes. Nucleotide variation was observed high in ITS1 gene from all the isolates in comparison to that of the COI implying that ITS1 is more polymorphic than COI gene³³. However, the COI gene is highly conserved

that has distinct advantage for taxonomic studies but it is species specific. Although, diversity in nucleotide sequence may be notable for geographically discriminating sibling species from a species under a genus. No signifi- cant change was seen in COI encoded amino acid com- position, but decrease in lysine content was recorded in

Fig. 4:Reconstruction of molecular phylogeny for rDNA ITS1 gene (a and b); and mitochondrial COI gene (c and d); bootstrap view. The evolutionary history was inferred by using the maximum likelihood method based on the Tamura 3-parameter model. The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa analyzed. Bullets indicate isolates from Northeast region of India.

(a)

(c)

(d) (b)

(6)

one of the isolates. On the contrary, considerable fluctua- tions in amino acid content in between isolates were no- ticed in the ITS1 region.

During the retrieval of sequences from gene bank data base, only 11 representative COI gene sequences could be retrieved from Southeast Asia. In contrast to this, only two ITS1 gene sequence from Malaysia were obtained from the data base as a representative of Southeast Asia for molecular phylogenetic analysis. In case of ITS1 gene though we found only two other isolates from Malaysia, but phylogenetic analysis showed that genetic diversity between these isolates was less and hence they are in close proximity in the phylogenetic tree. However, in case of COI gene, studied isolates were found distantly grouped into separate clusters. Though, the two selected marker genes are useful in genetic characterization of this mosquito species, but mt COI gene reflects a better picture

for genetic characterization and molecular phylogenetic analysis and the data obtained in present study are con- sistent in case of COI gene. However, the phylogenetic analysis of the isolates showed close relation among the isolates in both ITS1 and COI genes (Figs. 4 b and d for ITS1 and COI genes respectively). But, they are distantly related when compared with Southeast Asian isolates (Figs. 4 a and c for ITS1 and COI genes respectively). .

CONCLUSION

Mosquito identification using molecular tools and phylogeny related information are lacking from North- east region of India. The molecular data of conserved gene not only identify the species, subspecies but also help in describing the relationship among species and sibling species. Proper information of biogeography, diversity, and

Fig. 5:Variation in amino acid frequencies in COI and ITS1 gene sequences of Ae. albopictus from Northeast India—(a) COI gene (Similar frequency); and (b) ITS1 gene (Variable frequency).

(7)

population genetic structure of the prevailing mosquito species might decipher their origin, spread and distance wise genetic relationship resulting in proper taxonomic information. Keeping in view, the increased incidence of dengue in India, the molecular information of dengue vector need to be explored extensively.

Conflict of interest

The authors declare that they have no conflict of interest.

ACKNOWLEDGEMENTS

The authors would like to sincerely thank the Director, Defence Research Laboratory, Tezpur, Assam for providing research facility and constant encourage- ment. Ms. Momi Das was supported by research fellow- ship from the Defence Research and Development Organisation, New Delhi.

REFERENCES

1. Kumari R, Kumar K, Chauhan LS. First dengue virus detection in Aedes albopictus from Delhi, India: It’s breeding ecology and role in dengue transmission. Trop Med Int Health 2011; 16(8):

949–54.

2. Tewari SC, Thenmozhi V, Katholi CR, Manavalan R, Munirathinam A, Gajanana A. Dengue vector prevalence and virus infection in a rural area in south India. Trop Med Int Health 2004; 9(4): 499–507.

3. Dar L, Broor S, Sengupta S, Xess I, Seth P. The first major outbreak of dengue hemorrhagic fever in Delhi, India. Emerg Infect Dis 1999; 5(4): 589–90.

4. Agarwal R, Kapoor S, Nagar R, Misra A, Tandon R, Mathur A, et al. A clinical study of the patients with dengue haemorrhgic fever during the epidemic of 1996 at Lucknow, India. Southeast Asian J Trop Med Public Health 1999; 30(4): 735–40.

5. Shah I, Deshpande GC, Tardeja PN. Outbreak of dengue in Mumbai and predictive markers for dengue shock syndrome. J Trop Pediatr 2004; 50(5): 301–5.

6. Singh J, Balakrishnan N, Bhardwaj M, Amuthadevi P, George EG, Subramani K, et al. Silent spread of dengue and dengue haemorrhagic fever to Coimbatore and Erode districts in Tamil Nadu, India, 1998: Need for effective surveillance to monitor and control the disease. Epidemiol Infect 2000; 125(1): 195–200.

7. Das M, Gopalakrishnan R, Kumar D, Gayan J, Baruah I, Veer V, et al. Spatiotemporal distribution of dengue vectors and identification of high risk zones in District Sonitpur, Assam, India.

Indian J Med Res 2014; 140(2): 278–84.

8. Rohani A, Azahary ARA, Malinda M, Zuainee MN, Rozilawati H, Najdah WMW, et al. Eco-virological survey of Aedes mosquito larvae in selected dengue outbreak areas in Malaysia. J Vector Born Dis 2014; 51 (4): 327–32.

9. Walton C, Sharpe RG, Pritchard SJ, Thelwell NJ, Butlin RK.

Molecular identification of mosquito species. Biol J Linn Soc 2008; 68: 241–56.

10. Reinert JF. New classification for the composite genus Aedes

(Diptera: Culicidae: Aedini), elevation of subgenus Ochlerotatus to generic rank, reclassification of the other subgenera, and notes on certain subgenera and species. J Am Mosq Control Assoc 2000;

16(3): 175–88.

11. Savage HM, Strickman D. The genus and subgenus categories within Culicidae and placement of Ochlerotatus as a subgenus of Aedes. J Am Mosq Control Assoc 2004; 20(2): 208–14.

12. Reinert JF, Harbach RE, Kitching IJ. Phylogeny and classification of tribe Aedini (Diptera: Culicidae). Zool J Linnean Soc 2009;

157: 700–94.

13. Manonmani A, Townson H, Adeniran T, Jambulingam P, Sahu S, Vijayakumar T. rDNA-ITS2 polymerase chain reaction assay for the sibling species of Anopheles fluviatilis. Acta Trop 2001;

78(1): 3–9.

14. Singh OP, Chandra D, Nanda N, Raghavendra K, Sunil S, Sharma SK, et al. Differentiation of members of Anopheles fluviatilis species complex by an allele specific polymerase chain reaction based on 28S ribosomal DNA sequences. Am J Trop Med Hyg 2004; 70(1): 27–32.

15. Kang D, Sim C. Identification of Culex complex species using SNP markers based on high-resolution melting analysis. Mol Ecol Res 2013; 13(3): 369–76.

16. Low VL, Lim PE, Chen CD, Lim YA, Tan TK, Norma-Rashid Y, et al. Mitochondrial DNA analysis reveal low genetic diversity in Culex quinquefasciatus from residential areas of Malay- sia. Med Vet Entomol 2014; 28(2): 157–68. doi: 10.1111/

mve.12022.

17. Pfeiler E, Flores-Lopez CA, Mada-Velez JG, Escalante-Verdugo J, Markow TA. Genetic diversity and population genetics of mosquitoes (Diptera: Culicidae: Culex spp.) from the Sonoran Desert of North America. Scientific World Journal 2013; 2013:

724609.

18. Shepard JJ, Andreadis TG, Vossbrinck CR. Molecular phylogeny and evolutionary relationships among mosquitoes (Diptera:

Culicidae) from the northeastern United States based on small subunit ribosomal DNA (18S ribosomal DNA) sequences. J Med Entomol 2006; 43(3): 443–54.

19. Sharma AK, Chandel K, Tyagi V, Mendki MJ, Tikar SN, Sukumaran D. Molecular phylogeny and evolutionary relationship among four mosquito (Diptera: Culicidae) species from In- dia using PCR–RFLP. J Mosquito Res 2013; 3(8): 58–64.

20. Beebe NW, Whelan PI, Van den Hurk AF, Ritchie SA, Corcoran S, Cooper RD. A polymerase chain reaction-based diagnostic to identify larvae and eggs of container mosquito species from the Australian region. J Med Entomol 2007; 44(2): 376–80.

21. Proft J, Maier WA, Kampen H. Identification of six sibling species of the Anopheles maculipennis complex (Diptera: Culicidae) by a polymerase chain reaction assay. Parasitol Res 1999; 85(10):

837–43.

22. Chen B, Harbach RE, Butlin RK. Molecular and morphological studies on the Anopheles minimus group of mosquitoes in south- ern China: Taxonomic review, distribution and malaria vector status. Med Vet Entomol 2002; 16(3): 253–65.

23. Alam MT, Das MK, Dev V, Ansari MA, Sharma YD. Identifica- tion of two cryptic species in the Anopheles (Cellia) annularis complex using ribosomal DNA PCR-RFLP. Parasitol Res 2007;

100(5): 943–8.

24. Surendran SN, Gajapathy K, Kumaran V, Tharmatha T, Jude PJ, Ramasamy R. Molecular evidence for the presence of malaria vector species a of the Anopheles annularis complex in Sri Lanka.

Parasit Vectors 2011; 4: 239.

25. Wan Q-H, Wu H, Fujihara T, Fang SG. Which genetic marker

(8)

for which conservation genetics issue? Electrophoresis 2004;

25(14): 2165–76.

26. Galtier N, Nabholz B, Glemin S, Hurst GD. Mitochondrial DNA as a marker of molecular diversity: A reappraisal. Mol Ecol 2009;

18(22): 4541–50.

27. Saccone C, De Giorgi C, Gissi C, Pesole G, Reyes A. Evolution- ary genomics in metazoa: The mitochondrial DNA as a model system. Gene 1999; 238(1): 195–209

28. Knowlton N, Weight LA. New dates and new rates for diver- gence across the Isthmus of Panama. Proc R Soc Lond B 1998;

265(1412): 2257–63.

29. Hebert PDN, Ratnasingham S, Dewaard JR. Barcoding animal life: Cytochrome c oxidase subunit 1 divergences among closely related species. Proc Biol Sci 2003; 270 (Suppl 1): S96–9.

30. Kumar NP, Rajavel AR, Natarajan R, Jambulingam P. DNA barcodes can distinguish species of Indian mosquitoes (Diptera:

Culicidae). J Med Entomol 2007; 44(1): 1–7. doi: 10.1603/0022- 2585(2007)44[1:DBCDSO]2.0.CO;2.

31. Hill LA, Davis JB, Hapgood G, Whelan PI, Smith GA, Ritchie SA, et al. Rapid identification of Aedes albopictus, Aedes scutellaris, and Aedes aegypti life stages using real-time polymerase chain reaction assays. Am J Trop Med Hyg 2008; 79(6):

866–75.

32. De Jong L, Moreau X, Dalia J, Coustau C, Thiery A. Molecular characterization of the invasive Asian tiger mosquito, Aedes (Ste- gomyia) albopictus (Diptera: Culicidae) in Corsica. Acta Trop 2009; 112(3): 266–9.

33. Coleman AW, Vacquier VD. Exploring the phylogenetic utility of ITS sequences for animals: A test case for abalone (Haliotis). J Mol Evol 2002; 54(2): 246–57.

34. Kaura T, Sharma M, Chaudhry S, Chaudhry A. Sequence poly- morphism in spacer ITS2 of Anopheles (Cellia) subpictus Grassi (Diptera: Culicidae). Caryologia 2010; 63(2): 124–33

35. Cornel AJ, Porter CH, Collins FH. Polymerase chain reaction species diagnostic assay for Anopheles quadrimaculatus cryptic species (Diptera: Culicidae) based on ribosomal DNA ITS2 sequences. J Med Entomol 1996; 33(1): 109–16.

36. Walton C, Hardley JM, Kuvangkadilok C, Collins FH. Harbach RE, Baimai V, et al. Identification of five species of the Anopheles dirus complex from Thailand, using allele-specific polymerase chain reaction. Med Vet Entomol 1999; 13(1): 24–32.

37. Garros C, Koekemoer LL, Coetzee M, Coosemans M, Manguin S. A single multiplex assay to identify major malaria vectors within the African Anopheles funestus and the oriental An.

minimus groups. Am J Trop Med Hyg 2004; 70(6): 583–90.

38. Sallum MAM, Foster PG, Li C, Sithiprasasna R, Wilkerson RC.

Phylogeny of the leucosphyrus group of Anopheles (Cellia) (Diptera: Culicidae) based on mitochondrial gene sequences. Ann Entomol Soc Am 2007; 100(1): 27–35.

39. Paredes-Esquivel C, Donnelly MJ, Harbach RE, Townson H. A molecular phylogeny of mosquitoes in the Anopheles barbirostris subgroup reveals cryptic species: Implications for identification of disease vectors. Mol Phylogenet Evol 2009; 50(1): 141–51.

40. Mohanty A, Swain S, Kar SK, Hazra RK. Analysis of the phylogenetic relationship of Anopheles species, subgenus Cellia (Diptera: Culicidae) and using it to define the relationship of

morphologically similar species. Infect Genet Evol 2009; 9(6):

1204–24.

41. Takano KT, Nguyen NT, Nguyen BT, Sunahara T, Yasunami M, Nguyen MD, et al. Partial mitochondrial DNA sequences sug- gest the existence of a cryptic species within the Leucosphyrus group of the genus Anopheles (Diptera: Culicidae), forest malaria vectors, in northern Vietnam. Parasit Vectors 2010; 3: 41.

42. Sarma DK, Prakash A, O’Loughlin SM, Bhattacharyya DR, Mohapatra PK, Bhattacharjee K, et al. Genetic population structure of the malaria vector Anopheles baimaii in Northeast India using mitochondrial DNA. Malar J 2012; 11: 76.

43. Huang ZH, Wang JF. Cloning and sequencing of cytochrome c oxidase II (COII) gene of three species of mosquitoes. Zhongguo Ji Sheng Chong Xue Yu Ji Sheng Chong Bing Za Zhi 2001; 19(2):

90–2 (In Chinese).

44. Whang IJ, Jung J, Park JK, Min GS, Kim W. Intragenomic length variation of the ribosomal DNA intergenic spacer in a malaria vector, Anopheles sinensis. Mol Cells 2002; 14(1): 158–62.

45. Min GS, Choochote W, Jitpakdi A, Kim SJ, Kim W, Jung J, et al. Intraspecific hybridization of Anopheles sinensis (Diptera:

Culicidae) strains from Thailand and Korea. Mol Cells 2002;

14(2): 198–204.

46. Park SJ, Choochote W, Jitpakdi A, Junkum A, Kim SJ, Jariyapan N, et al. Evidence for a conspecific relationship between two morphologically and cytologically different forms of Korean Anopheles pullus mosquito. Mol Cells 2003; 16: 354–60.

47. Wilkerson RC, Li C, Rueda LM, Kim HC, Klein TA, Song GH et al. Molecular confirmation of Anopheles (Anopheles) lesteri from the Republic of South Korea and its genetic identity with An. (An.) anthropophagus from China (Diptera: Culi- cidae). Zootaxa 2003; 378: 1–14.

48. Li C, Lee JS, Groebner JL, Kim HC, Klein TA, O’Guinn ML, et al. A newly recognized species in the Anopheles hyrcanus group and molecular identification of related species from the Repub- lic of South Korea (Diptera: Culicidae). Zootaxa 2005; 939:

1–8.

49. Park MH, Choochote W, Kim SJ, Somboon P, Saeung A, Tuetan B, et al. Nonreproductive isolation among four allopatric strains of Anopheles sinensis in Asia. J Am Mosq Control Assoc 2008;

24(4): 489–95.

50. Barraud PJ. The Fauna of British India including Ceylon and Burma (Diptera: Culicidae), v V, Tribe Megarhinini and Culicini.

London: Taylor Francis 1934; p. 463.

51. Kamgang B, Brengues C, Fontenille D, Njiokou F, Simard F, Paupy C. Genetic structure of the tiger mosquito, Aedes albopictus, in Cameroon (central Africa). PLoS One 2011; 6(5):

e20257.

52. Tamura K. Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G+C-content biases. Mol Biol Evol 1992; 9(4): 678–87.

53. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S.

MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011; 28(10): 2731–9.

54. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6:

Molecular evolutionary genetic analysis version 6.0. Mol Biol Evol 2013; 30(12): 2725–9

Correspondence to: Dr Prafulla Dutta, Scientist 'G', Regional Medical Research Centre (ICMR), Northeast Region, Dibrugarh–786 001, Assam, India.

E-mail: [email protected]

Received: 30 July 2015 Accepted in revised form: 28 June 2016