• Tidak ada hasil yang ditemukan

Untitled - Journal of Horticultural Sciences

N/A
N/A
Protected

Academic year: 2024

Membagikan "Untitled - Journal of Horticultural Sciences"

Copied!
8
0
0

Teks penuh

(1)
(2)

C O N T E N T S

JOURNAL OF HORTICULTURAL SCIENCES

Volume 16 Issue 1 June 2021

In this Issue

i-ii

Review

Moringa (Moringa oleifera L.): An underutilized and traditionally valued

1-13

tree holding remarkable potential

Jattan M., Kumari N., Raj Kumar, Kumar A., Rani B., Phogat D.S., Kumar, S. and Kumar, P.

Original Research in Papers

Characterization and evaluation of mountain sweet thorn 14-25

(Flacourtia montana J. Grah) collections

Tripathi P.C., Ganeshan S., Radhika V. and Shetti D.L.

Optimization of methodology for the extraction of polyphenolic compounds 26-35 with antioxidant potential and á-glucosidase inhibitory activity from jamun

(Syzygium cumini L.) seeds

Arivalagan M., Priyanka D.R. and Rekha A.

Genetic variability studies in amaranthus (Amaranthus spp.) 36-44 Agadi A.H., Kolakar S., Lakshmana D., Nadukeri S. and Hanumanthappa M.

Morpho-physiological parameters associated with chlorosis resistance to 45-52 iron deficiency and their effect on yield and related attributes in potato

(Solanum tuberosum L.)

Challam C., Dutt S., Sharma J., Raveendran M. and Sudhakar D.

Responses of different Okra (Abelmoschus esculentus) cultivars to water 53-63 deficit conditions

Ayub Q., Khan S.M., Hussain I., Naveed K., Ali S., Mehmood A., Khan M.J., Haq N.U., Shehzad Q.

Induced variability for yield and its attributing traits in cluster bean 64-68 [Cyamopsis tetragonoloba (L. ) Taub] through gamma irradiation

Lavanya H.N., Mishra S., Sood M., Aghora T.S., Anjanappa M., Rao V.K. and Reddy A.B.

In vitro multiplication protocol for Curcuma mangga : Studies on carbon, 69-76 cytokinin source and explant size

Waman A.A., Bohra P., Karthika Devi R. and Pixy J.

(3)

Effect of fungicide and essential oils amended wax coating on quality and shelf life 77-90 of sweet orange (Citrus sinensis Osbeck)

Bhandari M., Bhandari N. and Dhital M.

Post-harvest quality and quantification of betalains, phenolic compounds and 91-102 antioxidant activity in fruits of three cultivars of prickly pear

(Opuntia ficus-indica L. Mill)

Gonzalez F.P.H., Saucedo V.C., Guerra R.D., Suarez E.J., Soto H.R.M. Lopez J.A., Garcia C.E. and Hernandez R.G.

Soil microbial community dynamics as influenced by integrated nutrient 103-113 management practices in sweet basil (Ocimum basilicum L.) cultivation

Baraa AL-Mansour and D. Kalaivanan

Effect of spectral manipulation and seasonal variations on cut foliage production 114-120 and quality of Philodendron (Philodendron ‘Xanadu’)

Sujatha A. Nair, Laxman R.H. and Sangama

Short Communications

Studies on mutagenic sensitivity of seeds of pummelo (Citrus maxima Merr.) 121-124 Sankaran M., Kalaivanan D. and Sunil Gowda D.C.

Isolation and characterization of microsatellite markers from 125-129 Garcinia indica and cross species amplification

Ravishankar K.V., Vasudeva R., Hemanth B., Nischita P., Sthapit B.R., Parthasarathy V.A. and Rao V.R.

(4)

125

J. Hortl. Sci.

Vol. 16(1) : 125-129, 2021

Short Communication

Garcinia indica Choisy (Thouars; Family Clusia- ceae), is a perennial tree. G. indica is commonly known as a Brindonia Tallow tree or ‘Kokum Butter’ tree in English. Kokum has many uses in cuisines and an important ingredient in locally prepared medicines. The seeds are a rich source of Kokum butter, which is nutritive, demulcent, agent for smoothening, softening and used for cosmetic, confectionery, culinary purposes. Raw fruits, young leaves and bark are also used as medications against several disorders. The fruit rind is a rich source of Hydroxy Citric Acid (HCA) that prevents accumulation of fat in the human body cells. Therefore, G. indica has become the natural source for production of anti-obesity drugs.

(Baliga et al. , 2011). Garcinia species ar e

endemic and distributed in tropical rain forests of the Western Ghats. Perceiving the threat of over exploitation, FRLHT (Foundation for Revitalization of Loca l Hea lt h Tr a dit ions) a nd IUC N (International Union for Conservation of Nature) have recognized this species as ‘Vulnerable’ and

Threatened’ category respectively (Hareesh and Vasudeva, 2010). A few studies examined diversity in this species using general DNA markers like RAPD and ISSR markers (Thatte et al. 2012;

Palkar and Sellappan, 2019). However, so far there are no efforts to develop species specific, highly repr oducible micr osatellite ma rkers or S SR markers in this species. Keeping this in view, an attempt has been made to develop microsatellite or SSR markers using next generation sequencing

This is an open access article distributed under the terms of Creative Commons Attribution-NonCommer cial-ShareAlike 4.0 International License, which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original author and source are credited.

Isolation and characterization of microsatellite markers from Garcinia indica and cross species amplification

Ravishankar K.V.

*1

, Vasudeva R.

2,

, Hemanth B.

1

, Nischita P., Sthapit B.R.

3

Parthasarathy V.A.

4

and Rao V.R.

5

1ICAR-Indian Institute of Horticultural Research, Bengaluru - 560 089 India

2Department of Forest Biology and Tree Improvement, College of Forestry Sirsi - 581 401 University of Agricultural Sciences (Dharwad), India,

3 Regional project coordinator (UNEP-GEF), Bioversity International, Pokhara, Nepal,

4 National project coordinator (UNEP-GEF), ICAR-Indian Institute of Horticultural Research , Bengaluru, India

5Bioversity International, Rome

*Corresponding author e-mail : [email protected], [email protected]

ABSTRACT

Garcinia indica popularly known as ‘Kokum’ or Murugalu”, is a medium sized evergreen tree found in western-ghats of India. This tree species is highly exploited to produce anti-obesity drugs and culinary purposes. Its population is threatened by over exploitation and loss of habitat. Development of microsatellite markers would help in understanding genetic structure and further to develop appropriate conservation strategies. In this study, using next generation sequencing platform Illumina Hiseq 2000, we have sequenced partial genome of G. indica and identified 3725 microsatellites. Forty-eight microsatellite markers were analyzed using 30 accessions. Polymorphism information content (PIC) values ranged from 0.718 to 0.968 with a mean value of 0.922. Allele per locus ranged from 3 to 33 per locus. Probability of identity values ranged from 0.00329 to 0.30489.

Cross species amplification SSR primers in the related species, showed a moderate transferability from 12.5 % (for G. morella) to 18.7%(for G. gummigutta)

Key words : Cross-species amplification Garcinia indica; Microsatellite markers and Next-generation sequencing (NGS)

(5)

126

Ravishankar et al

J. Hortl. Sci.

Vol. 16(1) : 125-129, 2021

t echnology. T he development of molecula r markers would help in studying its diversity, analyzing the genetics of traits, and further help in evolving conservation strategies and improvement.

T he pla nt ma t er ia l wa s obt a ined fr om t he germplasm collection of the College of Forestry, S ir si (Univer sit y of Agr icult ur a l S ciences, Dharwad), Karnataka state, India. Total genomic DNA was isolated from the leaves of G. indica genot ypes using modified C TAB met hod (Ravishankar et al., 2000). Genomic DNA was sequenced using Illumina HiSeq2000 platform at M/

s Genotypic Pvt. Ltd, Bengaluru facility following manufactures instructions. High quality sequence data was used for assembly into contigs. De novo assembly of reads into contigs was performed using SOAPdenovo2-src-r240 software (Luo et al., 2012). This has resulted in 92125 contigs. The total assembled size of the contigs is approximately 25.6 Mbp. An SSR survey of genomic sequences using MIS A soft wa r e (ht t p:/ / pgr c. ipk- gatersleban.de/misa), showed that 3590 contigs contained at least one microsatellite (Ravishankar et al. 2015). A total of 3725 microsatellite was identified. A total of 1374 microsatellites (ESM1) primers were designed using Primer3 software (http://bioinfo.ut.ee/primer3-0.4.0/; Untergrasser et al., 2012). From these, randomly 50 loci were selected for initial screening. Finally, 48 SSR primers were selected for genetic analysis based on clea r amplification of P CR products. We employed Thirty genotypes of Garcinia indica for assessing polymorphism at each locus. The fluorescence based M13 tailed PCR method of Schuelke (2000) was followed to amplify the microsatellites in a quick, accurate and efficient manner. PCR was carried out in the 20µl reaction volume containing 2µl of 10X reaction buffer, 2.0µl of 1 mM dNTPs, 0.9µl (5 pmol) of forward, 0.9µl reverse primers (5 pmol), labeled M13 probe 1.2µl (5 pmol), 5.0 µl (50-75 ng) of template genomic DNA, 0.8 µl (2 U) of Taq DNA polymerase and 7.2 µl of nuclease free water. The PCR cycling profile was: initial denaturation at 94°C for 2 min, followed by 35 cycles of 94°C for 30sec., 55°C for

30 Sec., 72°C for 1 min and a final extension at 72°C for 5 min. Amplified pr oduct s wer e sepa r a t ed on 96 ca pilla r y Aut oma t ed DNA Sequencer (Applied Biosystems, ABI 3730 DNA Analyzer) at M/S Eurofin facility, Bengaluru.

T he r a w da t a gener a t ed wa s a na lyzed a nd compiled using Peak Scanner V1. 0 soft wa re (Applied Biosystems, USA) for estimating the allele size in bp. The allele size data was used for genetic analysis using Cervus 3.0 software (Kalinowski et al. 2007). We ha ve ca lcula t ed obser ved het er ozygosit y, expect ed het er ozygosit y, polymor phic infor ma t i on cont ent (P IC ). T he probability of identity (PI) was calculated using IDENTITY1.0 software (http://www.uni-graz.at/

~sefck/: Wagner and Sefc, 1999). Genetic analysis of 48 SSR loci, showed PIC values ranging from 0.718 to 0.968 with a mean value of 0.922. The mea n va lu es of obser ved a nd expect ed heterozygosity are 0.2813 (Table 1) and 0.933 respectively (Table 1 and 2). The allele per locus ranged from 13 to 41 with a mean of 16.395. The probability of identity (PI) values ranged from 0.00329 to 0.304896 with a mean of 0.03506. The total probability of identity is 8.132729x 10-80. In cross species amplification, out of 48 SSR primers, 6 amplified in G. morella , accounting 12.5 per cent transferability and 9 amplified in G. gummigutta accounting 18.8 percent transferability (ESM2).

This relatively low cross-species transferability compar ed t o wha t has been observed in G.

gummigutta species (Ravishankar et al., 2017).

T his is t he first repor t of S S R ma r ker s for Garcinia indica, where 3725 microsatellites were identified and primers were designed for 1374 microsatellites. The genetic analysis showed that the majority of the SSR primers developed have high PIC values indicating high heterozygosity in the species. The low probability of identity values of ma ny S S R loci is useful for molecula r characterization. Finally, the SSR developed will be useful in studying genetic diversity, mapping and fingerprinting of Garcinia indica and related species.

(6)

127

Microsatellite markers from Garcinia indica

LocusForward SequenceReverse SequenceRepeatNumberAllele sizeObservedExpectedPolymorphicProbability 5I 3I5I 3ITypeof AllelerangeHeterozygosityHeterozygosityInformationof Identity (k)(bp)(Ho)(He)Content (PIC)(PI) GI_KVRa577TTTGGCGAGGGTGTTGGTGAGTACACGTGTAGGCTGACACCAACC(GT)620140-2300.3450.9240.9020.012828 GI_KVRa614TGTGAGTTGTTTGGCATGGGTGAGGAGGGTGAGCAAATCACAGCTCA(TG)2226197-2900.1850.9620.9410.005254 GI_KVRa615TGTGAGGGGTGAGGTTGAGGCTACAAACGCATCCCCACTCTCGG(AT)627283-3790.2590.9530.9330.006829 GI_KVRa651TGGGTGGCAAATTTGGGAGGAAATGCCGCCCAAGGAGAGAGGAAA(AC)824185-2770.20.9710.950.006622 GI_KVRa723TGCACCAGGAGGGTCACAGACTACAACGAGGCCTTCCAACAGGA(AC)1021412-4880.1430.9260.9040.011916 GI_KVRa747TGACAGATCGACAGGCTAGACTCGAATCGCCCCCGTCTATGTATCAGTC(AT)625432-5310.1920.9620.9410.006535 GI_KVRa748TGAATGCCGAGAGCAATTGTGCCTCACATCACAAGGCTTGCTCAAACA(TA)633140-2140.5190.9790.960.003290 GI_KVRa834GTGCACATGTCGCCATAAAGATGGAACCTACCCCTCCATAACATGCCTT(AT)616105-1800.1330.8530.8280.036897 GI_KVRa861GGCCCATGGCCTCCTCTCATACAATGGGGAAGGACAATTAAGTCGGGA(TA)615103-1850.1380.7210.6950.087401 GI_KVRa862GGCACATGTGTCTACACCGCACTGTGGACAGGTAGGGTCACAGGT(AT)79233-2940.1430.8550.8190.037316 GI_KVRa961CCACACACAAAATGCCACAATTCCATGTGCGTGTGTGGTTGACAGGT(CA)61499-1240.2860.8470.8160.036213 GI_KVRb069AGACATCCGTCACCGGGCTCATTGCCATTTGTATGTGTTGTTGGCGG(CA)71099-1250.2140.8730.8410.029837 GI_KVRb130ACCCGCATTCACAATGCACATACAGTGGCGCTATTGGGAAATGAGTACA(CA)78233-3410.0000.860.8230.033681 GI_KVRb131ACCCCTAACGGTGGGTTCGTCATCGAGGGTCCTTGAGTTCTCCCCT(AT)61399-1900.1480.9050.8790.017689 GI_KVRb132ACCCCTAACGGTGGGTTCGTCATGGCCTTCGGTTGAGTTGTCCC(AT)610117-1570.4290.7740.7330.067668 GI_KVRb174ACACCGGTAAGGTGGTGAGAAGGAACACACAGAGTACCCCATATACGCACA(TG)712101-1480.250.7830.7490.054954 GI_KVRb175ACACCGGTAAGGTGGTGAGAAGGAACACAGAGTACCTCACATACGCACA(TG)718100-1650.5170.9150.8910.016365 GI_KVRb176ACACCCGATCCCATTCCGACCTACACCAACCACGCTCCCTTCCT(TA)724453-5240.2760.9450.9250.008223 GI_KVRb200AACTACCATCAAACATCACCAACACGATGGAAGGTGTTGAGGTCGGCCA(CA)622430-5140.320.9570.9340.009077 GI_KVRb201AACGGCTAGCTTTTCAACTGACTGTTGGTAAGTCGATTGTTGGGCTTCG(TA)617116-1790.160.9130.8870.017850 GI_KVRa975CACCCCATACACAACCACATTCCCGGTGTATGTGCCTGGATAAATGAAGGT(CA)623201-2850.1030.9380.9180.009212 GI_KVRa976CACATCCTTACATGTACACGGTCCACCTGACCGGCTAAACATACAAGTTCCA(TA)720316-3970.0830.9260.9010.016775 GI_KVRa977CACATAAGGAACAACAACAAGGCCTCAGCCGGAGGCCGTACAATTGTGTT(AT)72499-1710.4330.8560.8350.031996 GI_KVRa978CAATCTCATTCCTAGACAACCTGCACAAGTTGATCCAGGATTTGGCGAGGGT(AC)62099-1480.4140.9330.9120.011202 GI_KVRa979CAAGGCTGCTCGGACGTCGAATATCCCACCGGCTCGAGCAAGAA(CT)623428-5820.2860.9050.8830.015518 GI_KVRa980CAACATGCTTCAACCAAGCACATACAATGCTACTACCTTAGGAGACATGCATCA(TG)1121112-1980.4440.9420.920.009296 GI_KVRa981CAACAAAGGGCATTCATGCACACATTGGGGGAGGAACCAAGCAAGT(AT)624313-3990.6330.9550.9360.006817 GI_KVRb047AGCGAGGACAAGGGAAAGGACGTGGCGGATATGTGTGCTTGGCG(TA)719323-3650.360.9110.8850.018187

Table 1: Genetic analysis of microsatellite markers developed for Garcinia indica

J. Hortl. Sci.

Vol. 16(1) : 125-129, 2021

Referensi

Dokumen terkait

Haemophilus influenzae Type b/ Polyribosylribitol Phosphate-Tetanus (Hib/PRP-T) Vaccine Safety, Phase I Study.. Kusnandi Rusmil, 1 Eddy Fadlyana, 1 Rachmat Gunadi, 2

Anti-hepatitis B surface (anti-HBs) seroprotection in children with acute lymphoblastic leukemia post hepatitis B vaccination in Indonesia.. Yustinah 1 *, Nenny Sri Mulyani 2 ,

Perbandingan efek bakterisidal ekstrak mengkudu (morinda citrifolia linn.) 100% dan Povidone Iodine 1% terhadap streptococcus mutans in vitro.. Gupta R,

Adapun simpulan penelitian ini adalah (1)hasil belajar matematika siswa kelas V lebih baik menggunakan model pembelajaran CTL daripada model pembelajaran konvensional yaitu kelas

ORIGINAL ARTICLE Fuzzy cross-entropy, mean, variance, skewness models for portfolio selection Rupak Bhattacharyya a,*, Sheikh Ahmed Hossain b, Samarjit Kar c aDepartment of Applied

EDIT ORIAL 156 r e v c o l o m b a n e s t e s i o l .2 0 1 7;4 53:155–158 In 2007, Current Opinion in Anaesthesiology devoted a sup- plement to sedation outside the operating room in

SP6 Bagian belakang sisi medial tibia, 3 B-cun diatas tonjolan maleolus medial ST6 1 jari tengah anterosuperior ke arah angulus mandibula ST7 Pada wajah, lekukan antara titik tengah

Persentasi hasil belajar siswa kelas V B yang tidak menerapkan media audiovisual Mata pelajaran SBdP di SDN Ujungtibu No Kategori Frekuensi Presentase P x 100% 1 Tinggi Baik