Contents lists available atScienceDirect
Gene Reports
journal homepage:www.elsevier.com/locate/genrep
The effect of Curcuma longa extract and its active component (curcumin) on gene expression profiles of lipid metabolism pathway in liver cancer cell line (HepG2)
Reyhaneh Taebi
a,b, Mohammad Reza Mirzaiey
b, Mehdi Mahmoodi
c, Alireza Khoshdel
a,d, Mohammad Ali Fahmidehkar
e,f, Maryam Mohammad-Sadeghipour
a,b,
Mohammad Reza Hajizadeh
a,b,⁎aDepartment of Clinical Biochemistry, Faculty of Medicine, Rafsanjan University of Medical Sciences, Rafsanjan, Iran
bMolecular Medicine Research Center, Institute of Basic Medical Sciences Research, Rafsanjan University of Medical Sciences, Rafsanjan, Iran
cDepartment of Clinical Biochemistry, Afzalipoor Faculty of Medicine, Kerman University of Medical Sciences, Kerman, Iran
dPistachio Safety Research Center, Rafsanjan University of Medical Sciences, Rafsanjan, Iran
eDepartment of Clinical Biochemistry, School of Paramedical Sciences, Torbat Heydariyeh University of Medical Sciences, Torbat Heydariyeh, Iran
fResearch Center of Advanced Technologies in Medicine, Torbat Heydariyeh University of Medical Sciences, Torbat Heydariyeh, Iran
A R T I C L E I N F O Keywords:
Curcumin HepG2 Lipid metabolism Turmeric
A B S T R A C T
Objective:Dyslipidemia is a disorder in lipoprotein metabolism. This disorder could lead to atherosclerosis and it promotes the coronary artery disease and stroke. Turmeric and its active compound, curcumin, modulate the lipid metabolism and also have been used to treat the fatty liver. The present study evaluated the effect of Curcuma longaextract and curcumin on gene expression profiles of lipid metabolism pathway in human HepG2.
Methods:HepG2 cell line was cultured in RpMI-1640 media. The cells in each well were incubated in various concentration of curcumin and hydro-alcoholic extract of Turmeric (15, 30, 60, 125, 250, 1000, 2000 μg/ml).
The cell viability was investigated by MTT assay and the expression of lipid metabolism genes was determined using real-time PCR in IC20 concentration.
Results:The proliferation of HepG2 cells significantly reduced in curcumin-treated and hydro-alcoholic extract of Turmeric-treated groups with increasing the concentrations. The expression of lipogenesis-related genes such as PGC1A, CPT1A and ACOX1 significantly increase in both treatment groups as compared with the control group. Curcumin and hydro-alcoholic extract of Turmeric significantly diminished the expression of lipid synthesis genes such as SCD1, SREBF2, and DGAT1.
Conclusion:According to our study, Turmeric and curcumin reduce the viability of HepG2 cells in a con- centration-dependent manner; in addition, these ingredients decrease the lipogenesis genes while they increase the lipid synthesis genes. This report suggests that Turmeric could remove the lipid and fatty acids. This herbal substance could be a helpful treatment for obesity and fatty liver.
1. Introduction
Abnormalities in the lipid metabolism are growing throughout the world in recent years. These abnormalities are related to dyslipidemia, diabetes, overweight, cardiovascular disease, and inflammation (Dennis Kasper et al., 2015). Dyslipidemia is an abnormal amount of lipids in blood and could be a disorder in lipoprotein metabolism. This disorder
could be a main factor in increasing of total cholesterol (TC), low- density lipoproteins (LDLs), triglycerides (TG) and reducing of high- density lipoproteins (HDLs) (Dennis Kasper et al., 2015). It also could promote atherosclerosis that is a main risk factor for coronary artery disease and stroke (Micah and Nkum, 2012).
Although different treatments have been suggested for dyslipi- demia, combination therapy is considered as a new option for this
https://doi.org/10.1016/j.genrep.2019.100581
Received 11 October 2019; Received in revised form 8 December 2019; Accepted 12 December 2019
Abbreviations:TC, total cholesterol; LDLs, low-density lipoproteins; TG, triglycerides; HDLs, high-density lipoproteins; HepG2, human hepatocellular carcinoma cell line; DMSO, dimethyl sulfoxide; OD, optical density; extract, extract of Turmeric
⁎Corresponding author at: Department of Clinical Biochemistry, Faculty of Medicine, Molecular Medicine Research Center, Rafsanjan University of Medical Sciences, Rafsanjan, Iran.
E-mail address:[email protected](M.R. Hajizadeh).
Available online 17 December 2019
2452-0144/ © 2019 Elsevier Inc. All rights reserved.
T
disorder. This treatment is equally effective in reducing the amount of lipid, drug doses, and side effects (Catapano et al., 2014). Fibrates are a class of amphipathic carboxylic acids which are used in treatment of a wide range of metabolic disorders (Shipman et al., 2016). They de- crease plasma triglyceride levels in the liver (Staels et al., 1998) and elevate HDL-C in patients with hyperlipidemia and diabetes type 2 (Takei et al., 2017). Although some factors such as statins and fibrates could moderate the lipid metabolism and improve the insulin re- sistance, these drugs could lead to develop some adverse effects (Ornato, 2003). Some studies focus on the traditional medicines and have evaluated some medicinal herbs because these medicines are ef- fective low-cost treatments. One of the medical herbs is the root of Turmeric (Curcumalonga) (Araujo et al., 2016).
Turmeric has a wide range of biological properties such as anti- bacterial, anti-inflammatory and antioxidant (Abdel-Tawwab and Abbass, 2017;Nonose et al., 2014;Ramadan et al., 2011;Saccol et al., 2017). Turmeric improves the activities of digestive enzymes and is involved in lipid metabolism (Midhun et al., 2016;Seo et al., 2008).
This plant contains some main components such as sesquiterpenoids, Tumerona, demethoxycurcumin, bisdemethoxycurcumin, and curcu- minoids (Singh et al., 2011). Curcumin is a bioactive curcuminoid in Turmeric (Nguyen et al., 2017). This ingredient is a natural polyphenol which exerts lots of biological activities including antioxidant, anti-in- flammatory, anticancer, and neuronal protection (Ding et al., 2015a;
Wang et al., 2016). Several studies demonstrated that curcumin could lower the blood sugar by diminishing the hepatic glucose production. In addition, curcumin has some effective result on modulation of lipid metabolism (Ding et al., 2015b;Ghorbani et al., 2014;Liu et al., 2015;
Xie et al., 2012). A study showed that this component prevents lipid accumulation in liver and reduces adipose tissue and also can inhibits adiposeness and differentiation of lipid cells (Zhao et al., 2011). Ac- cording to another study, curcumin manages the weight in overweight people affirmatively and has a significant reduction effect on hepatic fatty acid biosynthesis (Jang et al., 2008).
Some genes are involved in lipogenesis and fatty-acid oxidation such as ABCA2, PGC1A, CPT1A and ACOX1. ABCA2 is a member of ABC1 subfamily and is highly expressed in the brain tissue and less in the liver. ABCA2 gene is involved in macrophages fat metabolism, drug resistance and neural growth and also it could regulate the intracellular metabolism of sphingolipids (Davis Jr. and Tew, 2018). PGC1A is transcriptional coactivator of the PPAR which interact with PPARᵧ. This gene interferes in biogenesis of mitochondria, fatty acid oxidation gluconeogenesis and insulin signaling (Petr et al., 2018). CPT1A is a mitochondrial enzyme that has a critical role in beta-oxidation of fatty acids especially long-chain fatty acids. It is involved in synthesis of acylcarnitine through the transfer of the acyl group from coenzyme A to
L-carnitine (Guan et al., 2019). The first enzyme in the beta-oxidation of fatty acids pathway is ACOX1. This gene has an important role in me- tabolization of branched-chain fatty acids and defect on ACOX1 may lead to adrenoleukodystrophy which is characterized by the accumu- lation of long-chain fatty acids (Vamecq et al., 2018).
SCD1, SREBF2 and DGAT1 genes are related to lipid synthesis. One of the main enzymes in the synthesis of monounsaturated fatty acids is SCD1. There are plenty of the main substrates in cholesterol esters, triglycerides and membrane phospholipids. This gene is highly ex- pressed in liver and adipose tissue and its half-life is 3–5 h then it de- generates in the microsomes (Poloni et al., 2015). SREBF2 is an im- portant factor in cholesterol metabolism and lead to expression of rate- limiting enzymes and enhancement of LDL-C and triglyceride level.
Once the cholesterol reduces inside the cells mature form of SREBF activates the LDLR and HMGCR (Ma et al., 2015). DGAT1 is a metabolic enzyme and crosses the membrane. This protein could catalyze the al- teration of diacylglycerol, acyl-CoA into triacylglycerol. DGAT1 is re- lated to obesity and other metabolic disease (Bhatt-Wessel et al., 2018).
With regard to the liver, it has a main role in the lipid metabolism, human hepatocellular carcinoma cell line (HepG2) which include the
liver carcinoma cells are suitable for studying the pathway of lipid metabolism (Moriwaki et al., 2014). In the current study, we try to evaluate the effect ofCurcuma longaextract and its active compound (curcumin) on gene expression profiles of lipid metabolism pathway in HepG2.
2. Material and methods
Rhizome of Turmeric was purchased from commercial markets and confirmed by staff herbarium, Department of Phytology at Vali-e-Asr University of Rafsanjan. The rhizomes were dried at room temperature, and then they were completely powdered by laboratory blender (Waring Products Division model, USA). The powdered Turmeric (5 g) was extracted with water and ethanol (250 ml, ratio 2:8) at 50 °C for 72 h in a Soxhlet extractor (Bakhshi Industries, Iran) (Rabbani Haghighi et al., 2014). Then alcohol was completely extracted and liquid extracts were dried in freeze drier (VaCo5-D model, Zirbus Technology, Ger- many) at −55 °C for 48 h. The yellow powder extracted was kept at
−20 °C until used (Choi et al., 2014).
In current study, the HepG2 cell line was used. The cells were cul- tured in RpMI-1640 media supplemented with 10% fetal bovine serum (FBS), 1% penicillin/streptomycin and incubated in a 5% CO2incubator at 37 °C. When the cells occupied 80% of the flasks, adherent cells were trypsinized with trypsin and cultured in 96-well plates at a density of 5 × 103cells/well (Faedmaleki et al., 2014).
2.1. MTT assay
HepG2 cells in each well were incubated in various concentration of hydro-alcoholic extract of Turmeric (62.5, 125, 250, 500, 1000 μg/ml) and curcumin (5, 10, 20, 40, 80 μg/ml) in a 5% CO2incubator at 37 °C (Abdel-Lateef et al., 2016). After 24 h, the medium of wells was re- moved, and 0.5 mg/ml of MTT added to wells then the plates incubated for 4 h at 37 °C. Then the medium containing MTT was removed and 150 μl DMSO (dimethyl sulfoxide) was added to each well to dissolve Formazan Crystals. The optical density (OD) was measured at 492 nm by using a microplate reader (Fan et al., 2014). The MTT assay was performed in triplicate.
The cells viability was defined by following formula (Dai et al., 2013):
= ×
Cell viability (%) OD (test well)/OD (reference well) 100%.
MTT assay showed that IC20 for hydro-alcoholic extract of Turmeric was 62.5 μg/ml and curcumin was 5 μg/ml which in these concentra- tions, the cell viability was the most. IC50 for hydro-alcoholic extract of Turmeric was approximately 125 μg/ml, and curcumin was 40 μg/ml, so we chose IC20 concentration for real time-PCR.
2.2. Real time-PCR
In the present study, the cells in one group were incubated in con- centrations of 62.5 μg/ml hydro-alcoholic extract of Turmeric, and in another group, concentration of curcumin was 5 μg/ml. After 24 h, total RNA of cultured cells was extracted by TRizol reagent according to the manufacturer's protocol of RNA extraction kit (Pars Tous, Iran). cDNA was synthesized from extracted RNA by cDNA synthesis (Pars Tous, Iran). Real-time PCR was undertaken in triplicate for PGC1a, DGAT1, CPT1L, SCD1, SREBPs, ABCA2, ACOX1 and β-Actin genes. β-Actin was used as a housekeeping gene. Primers of each gene were designed by vector NTI software and confirmed in the BLAST database. The se- quences of primers are demonstrated inTable 1. The real-time PCR reaction was executed by using real-time SYBR Premix Ex TaqTM (Thermo Fisher ABI). The following protocol was programmed on a CFX96 system (Bio-Rad Laboratories Inc., Hercules, CA, USA) for PCR amplification. There was 1 cycle of 95 °C, 40 cycles of 95 °C, and 40 cycles of 60 °C. Relative quantification was computed by the 2−ΔCt
formula, ΔCt = Ct Gene − Ct Control. Data were analyzed using the Bio-Rad CFX manager.
2.3. Statistical analysis
All data were analyzed by SPSS Statistical software version 21. All the results are presented in statistical indices and graphs. The differ- ences between the average gene expressions of the groups were ana- lyzed through one-way analysis of variance (ANOVA) and t-test. All data were measured as statically significant atPvalue of < 0.05.
3. Result 3.1. Cell viability
Cell viability was performed using the MTT assay to investigate the effect of curcumin and hydro-alcoholic extract of Turmeric on after 24 h of treatment. The result showed that the different concentrations of curcumin reduced the cell proliferation in a dose-dependent manner.
The reduction of the viability of HepG2 cells in curcumin-treated groups were statistically significant compared to the control group (P value = .001) (Fig. 1).
The results revealed that the proliferation of HepG2 cells diminished in the treatment groups that were treated with hydro-alcoholic extract of Turmeric (extract). This diminution was promoted with increasing the concentrations of extract. Compared to the control group, the re- duction in the viability of HepG2 cells in the extract-treated groups was statistically significant (Pvalue = .001) (Fig. 2).
3.2. Real-time PCR
In the present study, we evaluated the expression of important genes
in the lipid metabolism such as SCD1, ABCA2, PGC1A, SREBF2, CPT1A, ACOX1 and DGAT1 by real-time PCR assay using the IC20 concentra- tion (a non-toxic concentration in which 80% of Hepg2 cells are able to survive). The expression of fatty-acid oxidation and lipogenesis-related genes such as ABCA2, PGC1A, CPT1A and ACOX1 increased in the curcumin-treated and the extract-treated groups. The levels expression of PGC1A, CPT1A, and ACOX1 were statically significant in both treatment groups as compared with the control group (Pvalue = .018, .001, and .001, respectively) while the expression of ABCA2 was non- significant (Pvalue = .08) (Fig. 3).
Analysis of mRNA for the major genes involved in lipid synthesis such as SCD1, SREBF2, and DGAT1 revealed that curcumin and extract significantly reduced the expression of these genes compared to the control group (Pvalue = .004, .003, and .002, respectively). The ex- pression of SCD1 and SREBF2 genes in the curcumin-treated group was Table 1
The sequence of primers for real-time PCR.
Gene Forward primer Reverse primer
ABCA2 TGACGCAAAACTTGTCGCTG GAATCCAGGGCAGATGAGGG
ACOX1 CTTGCTTCACCAGGCAACTG TTCCAGGCGGGCATGA
CPT1A TTTCCATTCCTTCCCATTCG GGGCTCGTGCGACATTTCT
DGAT1 TGGCGGTCCCCAATCAC GCAGGAGTGGAAGAGCCAGTA
PGC1A CGCACGCACCGAAATTCT ACGGCTGTAGGGCGATCTT
SREBF-2 TCCGCCTGTTCCGATGTAC TGCACATTCAGCCAGGTTCA
SCD1 CCGACGTGGCTTTTTCTTCT TGGGTGTTTGCGCACAAG
β-actin GATCAGCAAGCAGGAGTATG GTGTAACGCAACTAAGTCATAG
Fig. 1.Viability average of Hepg2 cells after 24 h of curcumin treatment.
Fig. 2.Viability average of Hepg2 cells after 24 h of hydro-alcoholic extract of turmeric treatment.
Fig. 3.t-Test for statistical analysis of fatty-acid oxidation and lipogenesis-re- lated genes expression. The results are presented in mean ± SEM. The sig- nificance level was consideredP < .05.
less than the extract-treated group but the level expression of DGAT1 gene in extract-treated group was lower than the curcumin-treated group (Fig. 4).
4. Discussion
In recent years, it has been reported that Turmeric and its active ingredient, curcumin, prevented obesity and associated metabolic dis- orders. It has been shown that curcumin could decrease body-weight and adipose tissue (Alappat and Awad, 2010;Bradford, 2013;Di Pierro et al., 2015;Kizilay et al., 2017;Shehzad et al., 2011;Shehzad et al., 2017). In the present study, the effect of curcumin and hydro-alcoholic extract of Turmeric on HepG2 cells was investigated. The results re- vealed that the extract of Turmeric and curcumin reduced the viability of HepG2 cells.Tian et al., (2014)measured the effect of curcumin on the cell viability of primary rat hepatocytes and showed that the cur- cumin concentrations, 10–70 μM, have no effect on these cells but they showed 25 μM curcumin reduced the cell viability of hepatocytes 36 h after exposure (Tian et al., 2014). A study byChang et al. (2017)was conducted on HepG2 cells. They used curcumin and Glycyrrhetinic acid separately and in combination, for 24, 48 or 72 h. Their results revealed that treating the cells with curcumin can inhibit the cell viability and reduce growth cells. The reduction of cell proliferation in exposure of curcumin might be due to the arrest of G1-phase cell cycle (Chang et al., 2017). The result of Chang study is consistent with our study. Wang et al. (2015)evaluated the effect of curcumin-loaded nanostructured lipid carrier's different concentrations for 48 h on human HepG2 cells proliferation and apoptosis. They observed that this component sig- nificantly diminished the viability of HepG2 cells while it induced apoptosis in HepG2 cell lines (Wang et al., 2015). Olugbami et al.
(2017)reported that curcumin had a biphasic activity on the HepG2 cells proliferation. It means that curcumin elevated cell growth in low concentration; however, it had an antiproliferative effect in high con- centration. They also declared that curcumin could increase the pro- liferation in a time-dependent manner (Olugbami et al., 2017). In our study, low concentrations of curcumin and Turmeric around IC20 killed a few cells while a high-dose more than IC50 had a negative effect on cell viability. Some studies demonstrated that curcumin as a polyphenol natural could deduct obesity and lipid mass and also modified insulin in mice model (Ding et al., 2016; Shao et al., 2012).Liu et al. (2017)
studied the effects of curcumin on clozapine-induced lipid disturbance.
They found that curcumin alleviated the clozapine-induced disturbance of lipid metabolism through interaction with AMPK-SREBP pathway;
however, it did not have any effect on the body weight gain (Liu et al., 2017).
We analyzed the mRNA expressions of main genes involved to lipid metabolism by real time PCR. Our results indicated that curcumin and hydro-alcoholic extract of Turmeric overexpress the PGC1A, CPT1A and ACOX1 genes significantly while they suppress the mRNA expression of SCD1, SREBF2, and DGAT1 genes in HepG2 cell. A study in 2017 was performed on murine HepG2 cell line to determine the anti-nonalco- holic steatohepatitis (NASH) role of Curcuma longa and Artemisia iwayomogi. Their data which are in line with our study, demonstrated that curcumin can diminish SREBP1 gene expression but elevate PPAR- α gene expression (Kim et al., 2017).Singh et al. (2015)evaluated the anti-atherosclerosis effect of curcumin oil in THP1-derived macro- phage. They showed that curcumin inhibited the cholesterol accumu- lation via increasing the lipid-related genes. Some studies showed that curcumin and extract of Turmeric could regulate the lipid metabolism in liver through the activation of AMPK and suppression of SREBF. As regards to SREBF, they are able to regulate the transcription of the involved genes in triglyceride biosynthesis such as GPAT, SCD1 and FAS, so inhibition of SREBF expression may lead to reduction of SCD1 expression and lipogenesis in liver and adipose tissue (Ding et al., 2016;
Um et al., 2013). Activation of AMPK can also inhibit the expression of Acetyl-CoA carboxylase and reduce malonyl-CoA level and it in turn increases the CPT1a and ACOX1expression (Shin et al., 2014; Shin et al., 2011). Overexpression of PPARα, LXRα, ABCA1 and ABCG1 in macrophages may inhibit the progress of atherosclerosis (Singh et al., 2015).Fan et al., (2014)demonstrated that the expression of fatty acids synthase (FAS) decreased in HepG2 cells with exposure to curcumin.
Their data showed that curcumin can prevent fatty acids synthase function (Fan et al., 2014). Another study investigated the effect of KBH-1 on HepG2 cells as an in vitro and on the steatotic liver of high-fat diet-induced obesity rats as an in vivo study. KBH-1, a combination of Saururus chinensis,CurcumalongaandPolygalatenuifolia, diminished the main lipogenesis genes such as SREBP-1c, SCD-1, CD36 and ACC, whereas it increased the expression of main lipolysis gene such as ACOX1, CPT-1 and PPARα. These data showed that KBH-1 could modify the fatty acid catabolism. The results of their study confirm the results of our study (Lee et al., 2016). A study revealed that curcumin may have a role in modulation of PPARα and its target genes expres- sion. Therefore, it could enhance the expression of genes which are related to catabolism of the fatty acids (Shin et al., 2011). Several studies explained that curcumin could reduce plasma low-density li- poprotein-cholesterol (LDL) in three ways: it prohibits the uptake of cholesterol in intestine cells, increases the LDL receptor and in turn removes LDL cholesterol from the blood, and enhances the activity of cholesterol-7-hydroxylase (Feng et al., 2010; Ghosh et al., 2014;
Peschel et al., 2007). Some studies examined the role of curcumin on hepatic gene expression such as low-density lipoprotein receptor (LDLR). They reported that curcumin in Hepg2 cells promoted expres- sion of LDLR gene, but in hepatic stellate cells could suppress the ex- pression of this gene (Peschel et al., 2007;Kang and Chen, 2009).
5. Conclusion
Our result demonstrated that Turmeric and curcumin could reduce the viability of HepG2 cells and also decrease the lipogenesis genes while they increase the lipid synthesis genes. Therefore, Turmeric and its active component could be useful herbal substances to remove the lipid and fatty acids. This report suggests that Turmeric could be a helpful treatment for obesity. In this study, we did not consider positive control testing, so it is better to add some inhibitor of the target genes as the positive control in other studies and also in vivo studies are needed to evaluate the effect of Turmeric and curcumin on humans.
Fig. 4.t-Test for statistical analysis of lipid synthesis genes expression. The results are presented in mean ± SEM. The significance level was considered P < .05.
Declarations of competing interest None.
Author contributions
Reyhaneh Taebi: Conceptualization, Investigation, Resources, Writing - Original Draft.
Mohammad Reza Mirzaiey: Supervision, Visualization, Project ad- ministration.
Mehdi Mahmoodi: Validation, Writing - Review & Editing.
Alireza Khoshdel: Methodology, Software.
Mohammad Ali Fahmidehkar: Formal analysis, Project administra- tion.
Maryam Mohammad-Sadeghipour: Resources, Investigation.
Mohammad Reza Hajizadeh: Corresponding author, Conceptualization, Methodology, Project administration.
Acknowledgement
The authors would like to thank Rafsanjan University of Medical Sciences for its support.
References
Abdel-Lateef, E., Mahmoud, F., Hammam, O., El-Ahwany, E., El-Wakil, E., Kandil, S., Taleb, H.A., El-Sayed, M., Hassenein, H., 2016. Bioactive chemical constituents of Curcuma longaL. rhizomes extract inhibit the growth of human hepatoma cell line (HepG2). Acta Pharma. 66, 387–398.
Abdel-Tawwab, M., Abbass, F.E., 2017. Turmeric powder,Curcuma longaL., in common carp,Cyprinus carpioL., diets: growth performance, innate immunity, and challenge against pathogenicAeromonas hydrophilainfection. J. World Aquacult. Soc. 48, 303–312.https://doi.org/10.1111/jwas.12349.
Alappat, L., Awad, A.B., 2010. Curcumin and obesity: evidence and mechanisms. Nutr.
Rev. 68, 729–738.https://doi.org/10.1111/j.1753-4887.2010.00341.x.
Araujo, L.A., Araujo, R.G., Gomes, F.O., Lemes, S.R., Almeida, L.M., Maia, L.J., Goncalves, P.J., Mrue, F., Silva-Junior, N.J., Melo-Reis, P.R., 2016. Physicochemical/photo- physical characterization and angiogenic properties ofCurcuma longaessential oil.
An. Acad. Bras. Cienc. 88, 1889–1897.https://doi.org/10.1590/0001- 3765201620150600.
Bhatt-Wessel, B., Jordan, T.W., Miller, J.H., Peng, L., 2018. Role of DGAT enzymes in triacylglycerol metabolism. Arch. Biochem. Biophys. 655, 1–11.https://doi.org/10.
1016/j.abb.2018.08.001.
Bradford, P.G., 2013. Curcumin and obesity. BioFactors (Oxford, England) 39, 78–87.
https://doi.org/10.1002/biof.1074.
Catapano, A.L., Farnier, M., Foody, J.M., Toth, P.P., Tomassini, J.E., Brudi, P., Tershakovec, A.M., 2014. Combination therapy in dyslipidemia: where are we now?
Atherosclerosis 237, 319–335.https://doi.org/10.1016/j.atherosclerosis.2014.09.
Chang, M., Wu, M., Li, H., 2017. Curcumin combined with glycyrrhetinic acid inhibits the026.
development of hepatocellular carcinoma cells by down-regulating the PTEN/PI3K/
AKT signalling pathway. Am. J. Transl. Res. 9, 5567–5575.
Choi, W., Lim, H.W., Lee, H.Y., 2014. Effect of balanced low pressure drying ofCurcuma longaleaf on skin immune activation activities. Biomed. Mater. Eng. 24, 2025–2039.
Dai, X.-Z., Yin, H.-T., Sun, L.-F., Hu, X., Zhou, C., Zhou, Y., Zhang, W., Huang, X.-E., Li, X.- C., 2013. Potential therapeutic efficacy of curcumin in liver cancer. Asian Pac. J.
Cancer Prev. 14, 3855–3859.
Davis Jr., W., Tew, K.D., 2018. ATP-binding cassette transporter-2 (ABCA2) as a ther- apeutic target. Biochem. Pharmacol. 151, 188–200.https://doi.org/10.1016/j.bcp.
2017.11.018.
Dennis Kasper, A.F., Hauser, S., Longo, D., Larry Jameson, J., Loscalzo, J., 2015.
Harrison’s Principles of Internal Medicine, 19th ed. McGraw-Hill Education.
Di Pierro, F., Bressan, A., Ranaldi, D., Rapacioli, G., Giacomelli, L., Bertuccioli, A., 2015.
Potential role of bioavailable curcumin in weight loss and omental adipose tissue decrease: preliminary data of a randomized, controlled trial in overweight people with metabolic syndrome. Preliminary study. Eur. Rev. Med. Pharmacol. Sci. 19, 4195–4202.
Ding, L., Ma, S., Lou, H., Sun, L., Ji, M., 2015a. Synthesis and biological evaluation of curcumin derivatives with water-soluble groups as potential antitumor agents: an in vitro investigation using tumor cell lines. Molecules 20, 21501–21514.
Ding, L., Li, J., Song, B., Xiao, X., Zhang, B., Qi, M., Huang, W., Yang, L., Wang, Z., 2016.
Curcumin rescues high fat diet-induced obesity and insulin sensitivity in mice through regulating SREBP pathway. Toxicol. Appl. Pharmacol. 304, 99–109.https://
doi.org/10.1016/j.taap.2016.05.011.
Ding, X.Q., Gu, T.T., Wang, W., Song, L., Chen, T.Y., Xue, Q.C., Zhou, F., Li, J.M., Kong, L.D., 2015b. Curcumin protects against fructose-induced podocyte insulin signaling impairment through upregulation of miR-206. Mol. Nutr. Food Res. 59, 2355–2370.
Faedmaleki, F., Shirazi, F.H., Salarian, A.-A., Ashtiani, H.A., Rastegar, H., 2014. Toxicity
effect of silver nanoparticles on mice liver primary cell culture and HepG2 cell line.
Iran. J. Pharm. Res. 13, 235.
Fan, H., Tian, W., Ma, X., 2014. Curcumin induces apoptosis of HepG2 cells via inhibiting fatty acid synthase. Target. Oncol. 9, 279–286.
Feng, D., Ohlsson, L., Duan, R.D., 2010. Curcumin inhibits cholesterol uptake in Caco-2 cells by down-regulation of NPC1L1 expression. Lipids Health Dis. 9, 40.https://doi.
org/10.1186/1476-511x-9-40.
Ghorbani, Z., Hekmatdoost, A., Mirmiran, P., 2014. Anti-hyperglycemic and insulin sensitizer effects of turmeric and its principle constituent curcumin. Int. J.
Endocrinol. Metab. 12.
Ghosh, S.S., Bie, J., Wang, J., Ghosh, S., 2014. Oral supplementation with non-absorbable antibiotics or curcumin attenuates western diet-induced atherosclerosis and glucose intolerance in LDLR−/− mice — role of intestinal permeability and macrophage activation. PLoS One 9, e108577.https://doi.org/10.1371/journal.pone.0108577.
Guan, L., Chen, Y., Wang, Y., Zhang, H., Fan, S., Gao, Y., Jiao, T., Fu, K., Sun, J., Yu, A., Huang, M., Bi, H., 2019. Effects of carnitine palmitoyltransferases on cancer cellular senescence. J. Cell. Physiol. 234, 1707–1719.https://doi.org/10.1002/jcp.27042.
Jang, E.-M., Choi, M.-S., Jung, U.J., Kim, M.-J., Kim, H.-J., Jeon, S.-M., Shin, S.-K., Seong, C.-N., Lee, M.-K., 2008. Beneficial effects of curcumin on hyperlipidemia and insulin resistance in high-fat-fed hamsters. Metabolism 57, 1576–1583.
Kang, Q., Chen, A., 2009. Curcumin suppresses expression of low-density lipoprotein (LDL) receptor, leading to the inhibition of LDL-induced activation of hepatic stellate cells. Br. J. Pharmacol. 157, 1354–1367.https://doi.org/10.1111/j.1476-5381.2009.
00261.x.
Kim, H.G., Lee, S.B., Lee, J.S., Kim, W.Y., Choi, S.H., Son, C.G., 2017.Artemisia iwayomogi plusCurcuma longasynergistically ameliorates nonalcoholic steatohepatitis in HepG2 cells. Evid. Based Complement. Alternat. Med. 2017, 4390636.https://doi.org/10.
1155/2017/4390636.
Kizilay, G., Uz, Y.H., Seren, G., Ulucam, E., Yilmaz, A., Cukur, Z., Kayisli, U.A., 2017. In vivo effects of curcumin and deferoxamine in experimental endometriosis. Adv. Clin.
Exp. Med. 26, 207–213.https://doi.org/10.17219/acem/31186.
Lee, J.H., Lee, J.J., Cho, W.K., Yim, N.H., Kim, H.K., Yun, B., Ma, J.Y., 2016. KBH-1, an herbal composition, improves hepatic steatosis and leptin resistance in high-fat diet- induced obese rats. BMC Complement. Altern. Med. 16, 355.https://doi.org/10.
1186/s12906-016-1265-z.
Liu, B., Chen, Y., Cheng, H., Wang, Y., Rui, H., Yang, M., Dong, H., Han, D., Dong, J., 2015. The protective effects of curcumin on obesity-related glomerulopathy are as- sociated with inhibition of Wnt/β-catenin signaling activation in podocytes. Evid.
Based Complement. Alternat. Med. 2015.
Liu, Z., Cui, C., Xu, P., Dang, R., Cai, H., Liao, D., Yang, M., Feng, Q., Yan, X., Jiang, P., 2017. Curcumin activates AMPK pathway and regulates lipid metabolism in rats following prolonged clozapine exposure. Front. Neurosci. 11, 558.https://doi.org/
10.3389/fnins.2017.00558.
Ma, W., Ding, H., Gong, X., Liu, Z., Lin, Y., Zhang, Z., Lin, G., 2015. Methyl protodioscin increases ABCA1 expression and cholesterol efflux while inhibiting gene expressions for synthesis of cholesterol and triglycerides by suppressing SREBP transcription and microRNA 33a/b levels. Atherosclerosis 239, 566–570.https://doi.org/10.1016/j.
atherosclerosis.2015.02.034.
Micah, F.B., Nkum, B.C., 2012. Lipid disorders in hospital attendants in Kumasi, Ghana.
Ghana Med. J. 46, 14–21.
Midhun, S.J., Arun, D., Edatt, L., Sruthi, M., Thushara, V., Oommen, O.V., Kumar, V.S., Divya, L., 2016. Modulation of digestive enzymes, GH, IGF-1 and IGF-2 genes in the teleost, Tilapia (Oreochromis mossambicus) by dietary curcumin. Aquac. Int. 24, 1277–1286.
Moriwaki, S., Murakami, H., Takahashi, N., Uemura, T., Taketani, K., Hoshino, S., Tsuge, N., Narukami, T., Goto, T., Kawada, T., 2014. Yamogenin in fenugreek inhibits lipid accumulation through the suppression of gene expression in fatty acid synthesis in hepatocytes. Biosci. Biotechnol. Biochem. 78, 1231–1236.
Nguyen, T.T.H., Si, J., Kang, C., Chung, B., Chung, D., Kim, D., 2017. Facile preparation of water soluble curcuminoids extracted from turmeric (Curcuma longaL.) powder by using steviol glucosides. Food Chem. 214, 366–373.https://doi.org/10.1016/j.
foodchem.2016.07.102.
Nonose, N., Pereira, J.A., Machado, P.R., Rodrigues, M.R., Sato, D.T., Martinez, C.A., 2014. Oral administration of curcumin (Curcuma longa) can attenuate the neutrophil inflammatory response in zymosan-induced arthritis in rats. Acta Cir. Bras. 29, 727–734.
Olugbami, J.O., Damoiseaux, R., France, B., Gbadegesin, M.A., Stieg, A.Z., Sharma, S., Odunola, O.A., Gimzewski, J.K., 2017. Atomic force microscopy correlates anti- metastatic potentials of HepG2 cell line with its redox/energy status: effects of cur- cumin and Khaya senegalensis. J. Integr. Med. 15, 214–230.https://doi.org/10.
1016/s2095-4964(17)60337-6.
Ornato, J.P., 2003. Should you worry about the side effects of statins? Statin dose, health, and other drugs affect side-effect risk. Health News (Waltham, Mass.) 9, 1–2.
Peschel, D., Koerting, R., Nass, N., 2007. Curcumin induces changes in expression of genes involved in cholesterol homeostasis. J. Nutr. Biochem. 18, 113–119.https://doi.org/
10.1016/j.jnutbio.2006.03.007.
Petr, M., Stastny, P., Zajac, A., Tufano, J.J., Maciejewska-Skrendo, A., 2018. The role of peroxisome proliferator-activated receptors and their transcriptional coactivators gene variations in human trainability: a systematic review. Int. J. Mol. Sci. 19, 1472.
https://doi.org/10.3390/ijms19051472.
Poloni, S., Blom, H.J., Schwartz, I.V.D., 2015. Stearoyl-CoA desaturase-1: is it the link between sulfur amino acids and lipid metabolism? Biology 4, 383–396.https://doi.
org/10.3390/biology4020383.
Rabbani Haghighi, N., Naghsh, N., Mehrabani, D., 2014. The comparison of pretreatment effects of boiled coffee andCurcuruma longaon serum albumin as a liver indicator in male rats injected with tioacetamide. J. Fasa Univ. Med. Sci. 4, 58–66.
Ramadan, G., Al-Kahtani, M.A., El-Sayed, W.M., 2011. Anti-inflammatory and anti-oxi- dant properties ofCurcuma longa(turmeric) versusZingiber officinale(ginger) rhi- zomes in rat adjuvant-induced arthritis. Inflammation 34, 291–301.https://doi.org/
10.1007/s10753-010-9278-0.
Saccol, E.M.H., Toni, C., Pês, T.S., Ourique, G.M., Gressler, L.T., Silva, L.V.F., Mourão, R.H.V., Oliveira, R.B., Baldisserotto, B., Pavanato, M.A., 2017. Anaesthetic and an- tioxidant effects ofMyrcia sylvatica(G. Mey.) DC. andCurcuma longaL. essential oils on tambaqui (Colossoma macropomum). Aquac. Res. 48, 2012–2031.https://doi.org/
10.1111/are.13034.
Seo, K.-I., Choi, M.-S., Jung, U.J., Kim, H.-J., Yeo, J., Jeon, S.-M., Lee, M.-K., 2008. Effect of curcumin supplementation on blood glucose, plasma insulin, and glucose home- ostasis related enzyme activities in diabetic db/db mice. Mol. Nutr. Food Res. 52, 995–1004.https://doi.org/10.1002/mnfr.200700184.
Shao, W., Yu, Z., Chiang, Y., Yang, Y., Chai, T., Foltz, W., Lu, H., Fantus, I.G., Jin, T., 2012. Curcumin prevents high fat diet induced insulin resistance and obesity via attenuating lipogenesis in liver and inflammatory pathway in adipocytes. PLoS One 7, e28784.https://doi.org/10.1371/journal.pone.0028784.
Shehzad, A., Ha, T., Subhan, F., Lee, Y.S., 2011. New mechanisms and the anti-in- flammatory role of curcumin in obesity and obesity-related metabolic diseases. Eur. J.
Nutr. 50, 151–161.https://doi.org/10.1007/s00394-011-0188-1.
Shehzad, A., Qureshi, M., Anwar, M.N., Lee, Y.S., 2017. Multifunctional curcumin med- iate multitherapeutic effects. J. Food Sci. 82, 2006–2015.https://doi.org/10.1111/
1750-3841.13793.
Shin, H.S., Han, J.M., Kim, H.G., Choi, M.K., Son, C.G., Yoo, H.R., Jo, H.K., Seol, I.C., 2014. Anti-atherosclerosis and hyperlipidemia effects of herbal mixture,Artemisia iwayomogiKitamura andCurcuma longaLinne, in apolipoprotein E-deficient mice. J.
Ethnopharmacol. 153, 142–150.https://doi.org/10.1016/j.jep.2014.01.039.
Shin, S.K., Ha, T.Y., McGregor, R.A., Choi, M.S., 2011. Long-term curcumin administra- tion protects against atherosclerosis via hepatic regulation of lipoprotein cholesterol metabolism. Mol. Nutr. Food Res. 55, 1829–1840.https://doi.org/10.1002/mnfr.
201100440.
Shipman, K.E., Strange, R.C., Ramachandran, S., 2016. Use of fibrates in the metabolic syndrome: a review. World J. Diabetes 7, 74–88.https://doi.org/10.4239/wjd.v7.
i5.74.
Singh, S., Sankar, B., Rajesh, S., Sahoo, K., Subudhi, E., Nayak, S., 2011. Chemical composition of turmeric oil (Curcuma longaL. cv. Roma) and its antimicrobial activity against eye infecting pathogens. J. Essent. Oil Res. 23, 11–18.https://doi.org/10.
1080/10412905.2011.9712275.
Singh, V., Rana, M., Jain, M., Singh, N., Naqvi, A., Malasoni, R., Dwivedi, A.K., Dikshit,
M., Barthwal, M.K., 2015.Curcumaoil attenuates accelerated atherosclerosis and macrophage foam-cell formation by modulating genes involved in plaque stability, lipid homeostasis and inflammation. Br. J. Nutr. 113, 100–113.https://doi.org/10.
1017/s0007114514003195.
Staels, B., Dallongeville, J., Auwerx, J., Schoonjans, K., Leitersdorf, E., Fruchart, J.C., 1998. Mechanism of action of fibrates on lipid and lipoprotein metabolism.
Circulation 98, 2088–2093.
Takei, K., Han, S., Murayama, Y., Satoh, A., Oikawa, F., Ohno, H., Osaki, Y., Matsuzaka, T., Sekiya, M., Iwasaki, H., Yatoh, S., Yahagi, N., Suzuki, H., Yamada, N., Nakagawa, Y., Shimano, H., 2017. Selective peroxisome proliferator-activated receptor-α mod- ulator K-877 efficiently activates the peroxisome proliferator-activated receptor-α pathway and improves lipid metabolism in mice. J. Diabetes Investig. 8, 446–452.
https://doi.org/10.1111/jdi.12621.
Tian, N., Li, X., Luo, Y., Han, Z., Li, Z., Fan, C., 2014. Curcumin regulates the metabolism of low density lipoproteins by improving the C-to-U RNA editing efficiency of apo- lipoprotein B in primary rat hepatocytes. Mol. Med. Rep. 9, 132–136.https://doi.
org/10.3892/mmr.2013.1754.
Um, M.Y., Hwang, K.H., Ahn, J., Ha, T.Y., 2013. Curcumin attenuates diet-induced he- patic steatosis by activating AMP-activated protein kinase. Basic Clin. Pharmacol.
Toxicol. 113, 152–157.https://doi.org/10.1111/bcpt.12076.
Vamecq, J., Andreoletti, P., El Kebbaj, R., Saih, F.E., Latruffe, N., El Kebbaj, M.H.S., Lizard, G., Nasser, B., Cherkaoui-Malki, M., 2018. Peroxisomal acyl-CoA oxidase type 1: anti-inflammatory and anti-aging properties with a special emphasis on studies with LPS and argan oil as a model transposable to aging. Oxidative Med. Cell. Longev.
2018, 6986984.https://doi.org/10.1155/2018/6986984.
Wang, F., He, Z., Dai, W., Li, Q., Liu, X., Zhang, Z., Zhai, D., Chen, J., Chen, W., 2015. The role of the vascular endothelial growth factor/vascular endothelial growth factor receptors axis mediated angiogenesis in curcumin-loaded nanostructured lipid car- riers induced human HepG2 cells apoptosis. J. Cancer Res. Ther. 11, 597–605.
https://doi.org/10.4103/0973-1482.159086.
Wang, L., Zhang, B., Huang, F., Liu, B., Xie, Y., 2016. Curcumin inhibits lipolysis via suppression of endoplasmic reticulum stress in adipose tissue and prevents hepatic insulin resistance. J. Lipid Res. M067397.
Xie, X.-y., Kong, P.-R., Wu, J.-f., Li, Y., Li, Y.-x., 2012. Curcumin attenuates lipolysis stimulated by tumor necrosis factor-α or isoproterenol in 3T3-L1 adipocytes.
Phytomedicine 20, 3–8.
Zhao, J., Sun, X.-B., Ye, F., Tian, W.-X., 2011. Suppression of fatty acid synthase, dif- ferentiation and lipid accumulation in adipocytes by curcumin. Mol. Cell. Biochem.
351, 19–28.