Phytochemistry 181 (2021) 112586
Available online 21 November 2020
0031-9422/© 2020 Elsevier Ltd. All rights reserved.
Molecular characterization and evaluation of the antibacterial activity of a plant defensin peptide derived from a gene of oat (Avena sativa L.)
Sara Emamifar
a, Shamsozoha Abolmaali
a, Seyyed Mohsen Sohrabi
b, Mohsen Mohammadi
c,*, Maasume Shahmohammadi
daDepartment of Cell and Molecular Biology, Faculty of Basic Sciences, Semnan University, Semnan, Iran
bYoung Researchers and Elite Club, Khorramabad Branch, Islamic Azad University, Khorramabad, Iran
cDepartment of Pharmacognosy and Pharmaceutical Biotechnology, Faculty of Pharmacy, Lorestan University of Medical Sciences, Khorramabad, Iran
dRazi Herbal Medicines Research Center and Department of Medical Biotechnology, Faculty of Medicine, Lorestan University of Medical Sciences, Khorramabad, Iran
A R T I C L E I N F O Keywords:
Avena sativa Poaceae
Antibacterial activity Antimicrobial peptides Defensin
Transcriptome
A B S T R A C T
Plant defensins are a group of small disulfide-rich cationic peptides that exhibit a broad spectrum of antimi- crobial activities. In the present study, an antibacterial plant defensin peptide was successfully identified and characterized from the transcriptome of the oat (Avena sativa L.), and called AsDef1. The complete nucleotide sequence of AsDef1 was determined (321 bp) and found to contain an open reading frame (ORF) encoding a peptide of 77 aa with a putative 22 aa signal peptide sequence that addresses the mature defensin to the apoplast.
Further in silico analyses revealed that the structure of the identified defensin (AsDef1) consists of the Knot1 functional domain with eight conserved cysteine residues and four disulfide bonds. The highest expression of AsDef1 was observed in the developing seeds of the A. sativa plant. AsDef1 also showed antibacterial activity against both Gram-positive and Gram-negative bacteria. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) values ranged from 0.15625 μM to 0.625 μM. In this study, we identified and characterized an antibacterial defensin from A. sativa for the first time. The findings of the present study offer insights that can be used in producing pathogen-resistant transgenic plants and in developing po- tential antibacterial agents in the future using AsDef1 from A. sativa.
1. Introduction
The discovery of antibiotics revolutionized the treatment of infec- tious diseases and dramatically reduced human morbidity and mortality (Andersson and Hughes, 2010; Hutchings et al., 2019). The increasing resistance of pathogenic bacteria to conventional antibiotics necessitates efforts to identify and develop new anti-infective drugs (Hadizadeh et al., 2018; Sohrabi et al., 2019). Hence, recent studies have focused on alternatives to these compounds. Antimicrobial peptides (AMPs) are one of the alternatives to conventional antibiotics (Mahlapuu et al., 2016;
Mishra et al., 2017). AMPs are important components of the innate defense system that have been identified in most living organisms, including insects, plants, and animals (Lei et al., 2019). Since AMPs target multiple bacterial components, they can be suitable alternatives to antibiotics in the fields of medicine and agriculture (Pag et al., 2008).
AMPs have captured the attention of researchers as novel antibiotics (Ladha and Jeevaratnam, 2020; Mahlapuu et al., 2016). AMPs are a large and diverse class of defense peptides that form a vital part of the innate immune system in eukaryotic organisms (Castro and Fontes, 2005; Zasloff, 2002; Zhang and Gallo, 2016). AMPs show considerable structural and functional diversity in various organisms (Edilia Avila, 2017; Goyal and Mattoo, 2016; Tassanakajon et al., 2015; Wu et al., 2018). Defensins are members of a large family of AMPs, which are found in plants, invertebrates, and mammals (Aerts et al., 2008; Broe- kaert et al., 1995; Lay and Anderson, 2005; Shafee et al., 2016; Wilson et al., 2013; Wu et al., 2014). Among all living organisms, plants are the richest sources of various AMPs (Goyal and Mattoo, 2016). Plant AMPs are small cysteine-rich cationic peptides with wide-spectrum deterrent effects against bacteria, fungi, and pests (Goyal and Mattoo, 2016;
Schuerholz et al., 2012; Vriens et al., 2014). Based on features, such as
* Corresponding author. Department of Pharmacognosy and Pharmaceutical Biotechnology, Faculty of Pharmacy, Lorestan University of Medical Sciences, Khorramabad, Postal code: 6813833946, Iran.
E-mail addresses: [email protected] (S. Emamifar), [email protected] (S. Abolmaali), [email protected] (S. Mohsen Sohrabi), mohamadi419@
yahoo.com, [email protected], [email protected] (M. Mohammadi), [email protected] (M. Shahmohammadi).
Contents lists available at ScienceDirect
Phytochemistry
journal homepage: www.elsevier.com/locate/phytochem
https://doi.org/10.1016/j.phytochem.2020.112586
Received 17 January 2020; Received in revised form 2 November 2020; Accepted 5 November 2020
tertiary structure and disulfide bonding patterns, these peptides can be classified into eight groups, including thionins, lipid transfer proteins, defensins, knottins, snakins, cyclotides, α-hairpinins, and hevein-like peptides (Goyal and Mattoo, 2016; Tam et al., 2015; Tavormina et al., 2015). Plant defensins are a major and diverse group of plant AMPs.
They are small cationic AMPs with 45–54 amino acid residues and molecular weights of less than 6 kDa. There are eight conserved cysteine residues in the primary structure of plant defensins that form four di- sulfide bonds (Lacerda et al., 2014). Defensins are found in all monocot and dicot plants. They play an important role in host defense responses and in plant growth and development processes (Cools et al., 2017).
Antimicrobial activity is the most important feature of plant defensins.
Many studies have reported that plant defensins exert their antimicro- bial activity by binding to components of bacterial and fungal mem- branes (Goyal and Mattoo, 2016; Poon et al., 2014; Vriens et al., 2014;
Wilmes et al., 2011; Zhang and Gallo, 2016). Up to now, numerous defensins have been identified and characterized from various sources, such as the radish, pea, tobacco, sunflower, potato, petunia, and other plants (Broekaert et al., 1995; de Oliveira Carvalho and Gomes, 2009;
Goyal and Mattoo, 2016; Lay and Anderson, 2005; Urdangarín et al., 2000). In a study, a novel defensin was identified in the germinating seeds of the lentil (Lens culinaris). The identified defensin displayed inhibitory effects against the fungal pathogen Aspergillus niger (Finkina et al., 2008). Zhang and Lewis (1997) identified two novel defensins in the broad bean (Vicia faba) that displayed antimicrobial activity against Gram-positive and Gram-negative bacterial strains. In a study by Gao et al. (2000), a novel defensin was identified in the seeds of Medicago sativa that displayed inhibitory activity against the fungal pathogen Verticillium dahlia. In another study, four novel defensins were found in Heliophila coronopifolia that displayed different inhibitory effects against fungal pathogens (De Beer and Vivier, 2011). Drikvand et al. (2019) identified and characterized six defensin genes from L. culinaris.
Oat (Avena sativa L., Poaceae) is the sixth most important cereal in
the world. It is distinct among cereals due to its nutritional value and multifunctional characteristics (Ahmad et al., 2014; Butt et al., 2008).
However, an annotated reference genome is not yet available for this plant. Therefore, this study was conducted to identify and characterize an antibacterial defensin gene in the oat plant. Here, for the first time, the coding sequence of a defensin gene was identified and its coded peptide was called AsDef1. The antibacterial activity and the expression level of AsDef1 were evaluated. Furthermore, signal peptide, subcellular localization, disulfide bonds, its functional domain, and intron-exon boundaries were predicted for the identified defensin.
2. Results
The assembly of the A. sativa EST library resulted in one contig that comprised the complete ORF of the defensin. PCR on the cDNA template showed an approximately 261 bp long band (Fig. 1A) and confirmed the assembly results. The cDNA sequence comprised a full-length ORF with a length of 234 bp (Fig. 2A). The ORF began with an ATG codon and ended in a TAG stop codon (Fig. 2B). PCR on DNA template displayed an approximately 348 bp long band (Fig. 1B). In the gene sequence (length 321 pb), the ORF was interrupted by an 87 bp long GT-AG intron (Fig. 2B). The AsDef1 was submitted to the GenBank with the accession numbers MF170232 (for cDNA sequence) and MF170231 (for DNA sequence). The translation of AsDef1 ORF produced a peptide of 77 amino acids with a predicted molecular weight of 8.5 kDa. The theo- retical value of the isoelectric point (pI) was calculated as 7.6 for AsDef1.
Further analyses revealed an instability index of 36.89, an aliphatic index of 78.31 and a GRAVY value of 0.068 for AsDef1. The analysis of the functional domain by the Pfam, CDD, and Interproscan tools showed the presence of a Knot1 conserved domain in AsDef1 (Fig. 3). Protein secondary structure prediction exhibited β-strand structures in AsDef1 (Fig. 4). Subcellular localization prediction using CELLO2GO indicated an extracellular localization for AsDef1. The SignalP server predicted a
Fig. 1.Agarose gel electrophoresis of PCR products of AsDef1. (A) PCR on cDNA template, M: 100 bp marker, C-: Negative control, D: AsDef1. (B) PCR on DNA
Fig. 2.Identification and characterization of AsDef1 (A) The identification steps of AsDef1. (B) Complete ORF of AsDef1. The exons and intron sequences have been shown in black and grey, respectively.
Fig. 3.Multiple sequence alignment of AsDef1 and defensins from mono- and dicotyledon plants. Gaps (− ) were introduced to improve the alignment. The numbers above the sequences show the position of amino acids and the numbering must take into account the gaps. Black and grey colors indicate identical and conservative amino acids, respectively. The red box shows the conserved γ-core motif. Disulfide bonds are indicated by bidirectional arrows. Knot1 functional domain and signal sequence have been shown by grey and black lines, respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
22 amino-acid signal sequence in AsDef1 (Fig. 3). Gene ontology pre- diction showed that AsDef1 is involved in response to pathogens, the killing of pathogens, and the response to biotic stresses. Protein struc- ture prediction showed one α-helix and three β-strands in the three- dimensional structure of AsDef1 (Fig. 4).
Multiple sequence alignment (MSA) results showed that the Knot1 domain was partly conserved among defensins, while signal sequences were vastly diverse (Fig. 3). The MSA also showed eight conserved cysteine residues that formed four disulfide bonds. Furthermore, three glycines, two arginines, two serines, one asparagine, one glutamic acid, and one alanine residue were found conserved for the shown defensins (Fig. 3).
The phylogenetic analysis showed two groups of defensins (mono and dicot groups) (Fig. 5). The A. sativa defensin, along with Panicum hallii, Sorghum bicolor, Triticum aestivum, and Zea mays defensins, was categorized into the monocot group. On the other hand, Arabisopsis thaliana, Nicotiana tabacum, Glycine max, Solanum lycopersicum, Phaseo- lus vulgaris, Vigna unguiculata, Rosa chinensis, and Coffea arabica were classified into the dicot group (Fig. 5).
The prediction of antimicrobial activity in CAMP suggested AsDef1 has antimicrobial activity. An antimicrobial value of 0.898 (maximum probability =1) was obtained by the Discriminant Analysis (DA) algo- rithm. The Random Forest (RF) algorithm computed the antimicrobial value as 0.503 (maximum probability =1). The Support Vector Machine (SVM) algorithm predicted an antimicrobial value of 0.806 (maximum probability =1). The Artificial Neural Network (ANN) algorithm pre- dicted antimicrobial activity for AsDef1.
Gene expression analysis revealed that AsDef1 had the highest expression level in the developing seeds and did not show expression in the leaves, stems and root tissues (Fig. 6).
The antimicrobial activity analysis results showed that AsDef1 inhibited the growth of both Gram-positive and Gram-negative bacteria.
The AsDef1 peptide inhibited the growth of E. coli by 50%, E. faecalis by 72%, P. carotovorum by 42% and L. plantarum by 48% (Fig. 7) at 0.078125 μM. The highest inhibitory activity was found in the case of E.
faecalis, while the lowest growth inhibition was observed in the case of P. carotovorum (Fig. 7). The MIC and MBC values of AsDef1 were the same for the tested strains. The tested strains showed different suscep- tibilities to AsDef1 with MIC values ranging from 0.15625 μM to 0.625
the highest MIC value was found against P. carotovorum (Table 1).
3. Discussion
Defensin peptides are vital components of the plant defense mech- anism. They play diverse roles in the growth and development of plants and their response to environmental stresses (Cools et al., 2017; Lacerda et al., 2014; Vriens et al., 2014). Defensins have been identified in mono- and dicotyledon plants. The reference genome and information about the defensin gene family are not available for the A. sativa plant.
Therefore, in the current study, the cDNA and gene sequences of an antibacterial defensin gene were identified and characterized using the EST library of A. sativa (Fig. 1). The exact members of the defensin gene family in A. sativa can be determined only when the reference genome becomes available. The defensin gene family in A. thaliana contains 15 members that are divided into three groups (Thomma et al., 2002).
Sixteen members of the defensin gene family have been identified and characterized in Medicago trancatula (Hanks et al., 2005).
The phylogenetic tree assigned AsDef1 to the monocot group (Fig. 5).
Several structural studies have grouped plant defensins into four sub- families (Finkina et al., 2008; Thomma et al., 2002). Subfamily 1 com- prises antibacterial and antifungal defensins that cause hyphal deformation (Finkina et al., 2008). Members of subfamily 2 display antifungal activity without any morphological changes in hyphal structure (Finkina et al., 2008). Subfamily 3 comprises antibacterial and insecticidal defensins. Members of subfamily 4 exhibit antibacterial and antifungal activities (Finkina et al., 2008; Thomma et al., 2002).
The gene structure of AsDef1 consisted of one intron and two exons (Fig. 1). The intron sequence of AsDef1 is located within the signal sequence of the peptide. Plant defensins share a typical exon-intron- exon arrangement, although exceptions have been previously reported (Giacomelli et al., 2012; Goyal and Mattoo, 2016). Plant defensin genes often include only one intron in their structures; thus, alternative splicing is unlikely in these genes (Black, 2000; Goyal and Mattoo, 2016). In silico subcellular localization analysis indicated a probable extracellular signal sequence in AsDef1 (Fig. 3). Plant defensins are grouped into two subfamilies based on the pre-protein structure. The first subfamily includes defensins with a mature peptide and a signal sequence. The signal sequence directs the mature peptide to the secre- Fig. 4. Amino acid sequence, secondary and 3D structures of AsDef1 without signal sequence. The α-helix and β-strands has been indicated within the sequence by color shading. The N- and C-terminals of AsDef1 peptide have been indicated by black circles. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
to localize in the extracellular space where they present their activities (Cools et al., 2017; Vriens et al., 2014; Zasloff, 2016). The second sub- family consists of defensins with an additional pro-domain near the C-terminus of the peptide (Vriens et al., 2014). AsDef1 belonged to the first group of plant defensins.
MSA showed eight conserved cysteine residues in AsDef1 (Fig. 3).
These conserved residues are essential for the formation of disulfide bonds. The disulfide bonds stabilize the defensin structure for proper biological activities (Agrawal et al., 2017; Van der Weerden and
Anderson, 2013). The conserved glycine residues form the γ-core motif (GXCX3-9C) in AsDef1 (Fig. 3). The prediction of secondary and 3D structures showed that the structure of AsDef1 was similar to other plant defensins (Fig. 4). The γ-core motif, GKCVGFRHRC, was located be- tween the β2 and β3 strands of the identified defensin (Yount and Yea- man, 2004). The γ-core motif is a group of positively charged residues that is crucial for antimicrobial activity. The γ-core motifs are usually present in the disulfide bond-forming AMPs (Lacerda et al., 2014; Van der Weerden and Anderson, 2013; Yount and Yeaman, 2004).
AsDef1 was highly expressed in the developing seeds (Fig. 6).
Defensin genes are differentially expressed in plant tissues. However, they are more abundantly expressed in the developing seeds than in other tissues. The high expression of defensins protects seeds from pathogenic microorganisms (Stotz et al., 2009; Thomma et al., 2002).
AsDef1 displayed different inhibitory activity against both Gram- positive and Gram-negative bacterial strains. The different antibacte- rial activities are due to differences in the structure and organization of the membrane in the Gram-positive and Gram-negative bacteria. It is also due to different resistance mechanisms in these bacteria. Most antimicrobial peptides kill bacteria via membrane damage (Boman, 1995; Bradshaw, 2003; Brogden, 2005; Castro and Fontes, 2005; Zasloff, 2002; Zhang and Gallo, 2016). Gram-negative bacteria have more complex cell walls than Gram-positive bacteria. Due to the presence of outer membranes, Gram-negative bacteria display numerous resistance mechanisms against antimicrobial agents (Silhavy et al., 2010). In contrast, Gram-positive bacteria do not have outer membranes and form simpler cell walls. They also have thicker peptidoglycan layers compared with Gram-negative bacteria (Silhavy et al., 2010).
So far, many antimicrobial defensins have been identified in various plants. To our knowledge, the present study is the first report of the identification and characterization of a member of the defensin gene family in A. sativa. In this study, an antibacterial defensin was identified and characterized from A. sativa. The gene structure, phylogenetic relationship, gene expression pattern, and antimicrobial activity of AsDef1 were characterized in the present study. AsDef1 probably exerts its antibacterial activities by membrane damage. The reference genome of A. sativa and information about the defensin gene family of this plant is not currently available. Therefore, the exact number of genes in the defensin gene family of A. sativa has not been determined. It can only be determined when the annotated reference genome becomes available for this plant. However, the other members of the defensin gene family in A. sativa can be identified and characterized from the transcriptome of the plant. The results of the current study can advance the available knowledge about the antimicrobial role of defensins. The identification and functional classification of the defensin gene family in A. sativa provide an opportunity to develop new effective antimicrobial agents.
4. Experimental
4.1. Plant materials and growth conditions
The seeds of Avena sativa L. (Poaceae) Calibre cultivar were grown in a soil mixture (50% peats: 50% clay). The seedlings were fertilized with a standard fertilizer (NPK 20:20:20) and kept under standard green- house conditions. Fourteen days after planting, the seedlings were har- vested for genomic DNA extraction. Ten days after pollination, leaves, stems, roots, and developing seed tissues were collected for RNA extraction. The harvested tissues were frozen in liquid N2 and stored at
− 80 ◦C until nucleic acid extraction.
4.2. Nucleic acid extraction and the synthesis of cDNA
Genomic DNA was extracted from the whole seedlings using the CTAB protocol (Doyle, 1991). Total RNA was extracted from the leaves, stems, roots, and developing seed tissues using the RNX-Plus buffer (SinaClon BioScience, Iran) according to the manufacturer’s Fig. 5. Maximum Likelihood phylogenetic tree of AsDef1 and defensins from
mono- and di-cotyledon plants. Blue (monocot group) and red (dicot group) highlights are two groups of defensins. The AsDef1 has been indicated by blue triangle. Below each defensin name, their GenBank accession number is shown.
(For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
Fig. 6. Tissue-specific gene expression analysis of the AsDef1. Bars represent standard errors.
instructions. The quality and quantity of the extracted genomic DNA and RNA were evaluated by agarose gel electrophoresis and spectropho- tometer. DNase I was used to eliminate DNA from total RNA. The complete removal of DNA from total RNA was verified by PCR on an
RNA template with the specific primers of the Elongation factor 1 alpha (Ef1α) gene (Table 2). The first-strand cDNA was synthesized from 1 μg of total RNA using the RevertAid first strand cDNA synthesis kit (Thermo Fisher Scientific, Lenexa, USA) according to the manufacturer’s instructions.
4.3. Identification of defensin and Ef1α cDNAs from the EST library of A.
sativa
The protein sequences of several defensins and Elongation factor 1 alpha (Ef1α) of monocot plants were downloaded from the NCBI Gen- Bank database. The protein sequences were aligned against the A. sativa EST library using the NCBI tBLASTn tool. The BLAST results for each gene were separately pooled and assembled in the Vector NTI 10.3 software (Invitrogen, Carlsbad, USA). The assembly results were aligned against the GenBank nr/nt database using the BLASTn tool to confirm the accuracy of gene identification. The BLAST results were further investigated for the presence of full-length ORFs. Sequences with full- length defensin and Ef1α ORFs were used for primer design. The spe- cific PCR primers (Table 2) were designed using the AlleleID 7.0 soft- ware (Premier Biosoft, Palo Alto, USA). The Ef1α gene was used as the reference gene in real-time PCR.
4.4. The cloning of cDNA and gene sequences
Fig. 7. The results of primary evaluation of the growth rate of bacteria under the effect of AsDef1 at 0.078215 μM. All assays were done in three replications. The bars represent standard errors. The star indicates a significance at p <0.05 level. The values above the bars show inhibition percentage.
Table 1
Minimum inhibitory concentration (MIC) of A. sativa defensin peptide.
Bacterial strain MIC (μM)
E. coli 0.3125
P. carotovorum 0.625
L. plantarum 0.3125
E. faecalis 0.15625
Table 2
Primers used for gene identification and gene expression analysis.
Primer
name Sequences (5′-3′) Ta
(◦C) Application
Def-F TTCATAAGAAATCTCAACAATGC 56.5 Gene identification
Def-R AAGGTCCTCTAGCAGTTCC
RT-Def-F TGGTCATCCTCCTCGTTCTTCTG 59.1 Gene expression analysis RT-Def-R CCCTCGGTGTAGCAAACATTCG
RT- Ef1α-F TCTGGCAAGGAGATTGAGAAGGAG 56 RT- Ef1α-
R ACGGCGAAACGACCAAGAGG
gene-specific primers (Table 2). The amplification reaction was carried out on a BioRad thermocycler (BioRad, CA, USA) using Taq DNA poly- merase (SinaClon BioScience, Tehran, Iran). The negative controls of PCR were double-distilled water. The amplification results were analyzed by agarose gel electrophoresis. The size of the cDNA and gene bands was determined using 100 bp and 1 Kbp gene markers, respec- tively. The bands of cDNA and gene sequences were excised and purified from agarose gel using the GeneJET Gel Extraction Kit (Thermo Fisher Scientific, Lenexa, USA). The purified fragments were ligated into pTZ57 R/T plasmid using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific, Lenexa, USA) and were subsequently sequenced by Bioneer Company (Daejeon, Korea). The sequencing results of cDNA and gene sequences were separately assembled in the Vector NTI 10.3 software (Invitrogen, Carlsbad, USA). The assembly results were compared with GenBank using the BLASTn tool to confirm the accuracy of the sequencing results.
4.5. In silico analysis of cDNA and gene sequences
The presence of full-length ORF in the defensin cDNA sequence was determined using the Vector NTI 10.3, ORF finder, and CDD softwares (Marchler-Bauer et al., 2014). The intron-exon boundaries of the defensin gene sequence were identified by the pairwise alignment of cDNA and gene sequences in the Vector NTI 10.3 and FGENESH server (Salamov and Solovyev, 1998). The subcellular localization and signal sequence of the defensin peptide was predicted by CELLO2GO and SignalP servers, respectively (Yu et al., 2014). The protein features of the defensin peptide, including molecular weight, isoelectric pH (pI), instability index, aliphatic index, and grand average of hydropathicity (GRAVY) were predicted by the Expasy ProtParam server (Gasteiger et al., 2005). Functional domains in the defensin peptide structure were predicted using the Pfam, CDD, and InterProScan tools (Finn et al., 2016; Jones et al., 2014; Marchler-Bauer et al., 2014).
The secondary and three-dimensional (3D) structures of AsDef1 were predicted using the Phyre2 protein fold recognition server and CLC Main Workbench 5.5 software (Kelley et al., 2015). The disulfide bridges in the defensin peptide structure were predicted by the DiANNA server (Ferr`e and Clote, 2005). The potential antimicrobial activity of the defensin peptide was assessed using the Collection of Anti-Microbial Peptides (CAMP) database (Waghu et al., 2014).
4.6. Multiple sequence alignment and phylogenetic analysis
The protein sequence of the identified defensin was aligned against the protein bank of NCBI using the BLASTp tool. Resulting proteins with the highest similarity to AsDef1 including AIA67013.1 (Triticum aesti- vum), NP_001152925.1 (Zea mays), NP_001234987.2 (Glycine max), NP_001297247 (Solanum lycopersicum), NP_178319.1 (Arabidopsis thaliana), XP_002459603.1 (Sorghum bicolor), XP_007156391.1 (Pha- seolus vulgaris), XP_015628800.1 (Oryza sativa), XP_016451209.1 (Nicotiana tabacum), XP_024197805.1 (Rosa chinensis), XP_025800124 (Panicum hallii), XP_027070696.1 (Coffea arabica), and XP_027916869.1 (Vigna unguiculata) were selected. Multiple sequence alignment (MSA) was performed using Vector NTI 10.3. The phyloge- netic analysis was carried out by the MEGA X software (Kumar et al., 2018). The phylogenetic tree was constructed using the Maximum-Likelihood method and assessed by the bootstrap test (1000 replications).
4.7. Gene expression analysis
The diluted cDNAs obtained from the leaf, stem, root and the developing seed tissues of three individual plants were used for gene expression analysis. Real-time quantitative PCR was performed and replicated twice using the Corbett RotorGene machine (Qiagen) and SYBR Premix Ex Taq II. In each replication, two tubes were used for each
tissue. The specificity of the primers was evaluated using melting curve analysis and agarose gel electrophoresis. The dynamic range, repro- ducibility and efficiency of real-time amplification were determined by a standard curve. The cycle thresholds (Ct) were normalized by the Ct
values of the reference gene. The mean of the Ct values was calculated across biological and technical replications. The relative gene expression was determined using the 2ΔΔCt method (Schmittgen and Livak, 2008).
4.8. The chemical synthesis of the peptide
The predicted defensin peptide used in this study was chemically synthesized, modified, and activated by pepMic company (Suzhou, China). The synthesized peptide was activated by the selective forma- tion of disulfide bond. The activated peptide was evaluated by mass spectrometry and purified (up to 95%) using HPLC. The purified peptide was dissolved in double-distilled sterile water (60 μM stock) and kept at
− 80 ◦C for subsequent experiments.
4.9. Antibacterial assay
The dissolved peptide was used in the primary test at the final con- centration of 0.078125 μM to assess antimicrobial activity. Two Gram- negative strains (i.e. Escherichia coli (PTCC 1330) and Pectobacterium carotovorum (PTCC 1675)) and two Gram-positive strains (i.e. Entero- coccus faecalis (PTTC 1609) and Lactobacillus plantarum (PTCC, 1896)) were selected for the assay. Bacterial strains were grown in LB broth until the optical density of 600 nm (OD600) reached 0.4. Then, the defensin peptide was added into the tubes. An equal volume of sterile distilled water was added into the control tubes. Then, the tubes were incubated until OD600 of the control tubes reached 1.0. After incuba- tion, colony-forming units (CFU) of each bacterial strain were counted by serial dilution on nutrient agar plates. All assays were replicated three times. Four tubes were used for each treatment in each replication.
The minimum inhibitory concentration (MIC) and minimum bacteri- cidal concentration (MBC) were determined by the micro-broth serial- dilution technique (Andrews, 2001). Briefly, the different dilutions (10, 5, 2.5, 1.25, 0.625, 0.3125, 0.15625, and 0.078125 μM) of the defensin peptide and 50 μL of 0.5 McFarland bacterial suspensions (approxi- mately 1.5 ×108 CFU/mL) were added to each well of sterile 96-well cell culture plates. A bacterial culture without defensin and a non-inoculated broth medium served as the positive and negative con- trols, respectively. The plates were incubated overnight at the optimum temperature. Bacterial growth was measured at 600 nm using a spec- trophotometer. All assays were replicated three times. Four tubes were used for each treatment in each replication.
Declaration of competing interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Acknowledgements
This work was supported by the Department of Cellular and Molec- ular Biology of Semnan University, Semnan, Iran (Grant Number: 6944).
The authors would like to express their gratitude for the financial support.
References
Aerts, A., François, I., Cammue, B., Thevissen, K., 2008. The mode of antifungal action of plant, insect and human defensins. Cell. Mol. Life Sci. 65, 2069–2079. https://doi.
org/10.1007/s00018-008-8035-0.
Agrawal, S., Acharya, D., Adholeya, A., Barrow, C.J., Deshmukh, S.K., 2017.
Nonribosomal peptides from marine microbes and their antimicrobial and anticancer potential. Front. Pharmacol. 8 https://doi.org/10.3389/fphar.2017.00828.
Ahmad, M., Dar, Z., Habib, M., 2014. A review on oat (Avena sativa L.) as a dual-purpose crop. Sci. Res. Essays 9, 52–59. https://doi.org/10.5897/SRE2014.5820.
Andersson, D.I., Hughes, D., 2010. Antibiotic resistance and its cost: is it possible to reverse resistance? Nat. Rev. Microbiol. 8, 260. https://doi.org/10.1038/
nrmicro2319.
Andrews, J.M., 2001. Determination of minimum inhibitory concentrations.
J. Antimicrob. Chemother. 48, 5–16. https://doi.org/10.1093/jac/48.suppl_1.5.
Black, D.L., 2000. Protein diversity from alternative splicing. Cell 103, 367–370. https://
doi.org/10.1016/S0092-8674(00)00128-8.
Boman, H.G., 1995. Peptide antibiotics and their role in innate immunity. Annu. Rev.
Immunol. 13, 61–92. https://doi.org/10.1146/annurev.iy.13.040195.000425.
Bradshaw, J.P., 2003. Cationic antimicrobial peptides. BioDrugs 17, 233–240. https://
doi.org/10.2165/00063030-200317040-00002.
Broekaert, W.F., Terras, F., Cammue, B., Osborn, R.W., 1995. Plant defensins: novel antimicrobial peptides as components of the host defense system. Plant Physiol. 108, 1353. https://doi.org/10.1104/pp.108.4.1353.
Brogden, K.A., 2005. Antimicrobial peptides: pore formers or metabolic inhibitors in bacteria? Nat. Rev. Microbiol. 3, 238. https://doi.org/10.1038/nrmicro1098.
Butt, M.S., Tahir-Nadeem, M., Khan, M.K.I., Shabir, R., Butt, M.S., 2008. Oat: unique among the cereals. Eur. J. Nutr. 47, 68–79. https://doi.org/10.1007/s00394-008- 0698-7.
Castro, M., Fontes, W., 2005. Plant defense and antimicrobial peptides. Protein Pept.
Lett. 12, 11–16. https://doi.org/10.2174/0929866053405832.
Cools, T.L., Struyfs, C., Cammue, B.P., Thevissen, K., 2017. Antifungal plant defensins:
increased insight in their mode of action as a basis for their use to combat fungal infections. Future Microbiol. 12, 441–454. https://doi.org/10.2217/fmb-2016-0181.
De Beer, A., Vivier, M.A., 2011. Four plant defensins from an indigenous South African Brassicaceae species display divergent activities against two test pathogens despite high sequence similarity in the encoding genes. BMC Res. Notes 4, 459. https://doi.
org/10.1186/1756-0500-4-459.
de Oliveira Carvalho, A., Gomes, V.M., 2009. Plant defensins—prospects for the biological functions and biotechnological properties. Peptides 30, 1007–1020.
https://doi.org/10.1016/j.peptides.2009.01.018.
Doyle, J., 1991. DNA Protocols for Plants. Molecular Techniques in Taxonomy. Springer, pp. 283–293. https://doi.org/10.1007/978-3-642-83962-7_18.
Drikvand, R.M., Sohrabi, S.M., Samiei, K., 2019. Molecular cloning and characterization of six defensin genes from lentil plant (Lens culinaris L.). 3. Biotec 9, 104. https://doi.
org/10.1007/s13205-019-1617-8.
Edilia Avila, E., 2017. Functions of antimicrobial peptides in vertebrates. Curr. Protein Pept. Sci. 18, 1098–1119. https://doi.org/10.2174/1389203717666160813162629.
FGENESH, 1998. Multiple Gene Prediction Program. http://linux1.softberry.com/berry.
phtml?.
Finkina, E.I., Shramova, E.I., Tagaev, A.A., Ovchinnikova, T.V., 2008. A novel defensin from the lentil Lens culinaris seeds. Biochem. Biophys. Res. Commun. 371, 860–865.
https://doi.org/10.1016/j.bbrc.2008.04.161.
Finn, R.D., Coggill, P., Eberhardt, R.Y., Eddy, S.R., Mistry, J., Mitchell, A.L., Potter, S.C., Punta, M., Qureshi, M., Sangrador-Vegas, A., 2016. The Pfam protein families database: towards a more sustainable future. Nucleic Acids Res. 44, D279–D285.
https://doi.org/10.1093/nar/gkv1344.
Gao, A.-G., Hakimi, S.M., Mittanck, C.A., Wu, Y., Woerner, B.M., Stark, D.M., Shah, D.M., Liang, J., Rommens, C.M., 2000. Fungal pathogen protection in potato by expression of a plant defensin peptide. Nat. Biotechnol. 18, 1307–1310. https://doi.org/
10.1038/82436.
Gasteiger, E., Hoogland, C., Gattiker, A., Duvaud, S.e., Wilkins, M.R., Appel, R.D., Bairoch, A., 2005. Protein Identification and Analysis Tools on the ExPASy Server.
Springer. https://doi.org/10.1385/1-59259-890-0:571.
Giacomelli, L., Nanni, V., Lenzi, L., Zhuang, J., Serra, M.D., Banfield, M.J., Town, C.D., Silverstein, K.A., Baraldi, E., Moser, C., 2012. Identification and characterization of the defensin-like gene family of grapevine. Mol. Plant Microbe Interact. 25, 1118–1131. https://doi.org/10.1094/MPMI-12-11-0323.
Goyal, R.K., Mattoo, A.K., 2016. Plant antimicrobial peptides. In: Epand, R.M. (Ed.), Host Defense Peptides and Their Potential as Therapeutic Agents. Springer, pp. 111–136.
https://doi.org/10.1007/978-3-319-32949-9_5.
Hadizadeh, M., Tabatabaiepour, S.N., Tabatabaiepour, S.Z., Hosseini Nave, H., Mohammadi, M., Sohrabi, S.M., 2018. Genome-wide identification of potential drug target in enterobacteriaceae family: a homology-based method. Microb. Drug Resist.
24, 8–17. https://doi.org/10.1089/mdr.2016.0259.
Hanks, J.N., Snyder, A.K., Graham, M.A., Shah, R.K., Blaylock, L.A., Harrison, M.J., Shah, D.M., 2005. Defensin gene family in Medicago truncatula: structure, expression and induction by signal molecules. Plant Mol. Biol. 58, 385–399. https://doi.org/
10.1007/s11103-005-5567-7.
Hutchings, M.I., Truman, A.W., Wilkinson, B., 2019. Antibiotics: past, present and future.
Curr. Opin. Microbiol. 51, 72–80. https://doi.org/10.1016/j.mib.2019.10.008.
Jones, P., Binns, D., Chang, H.-Y., Fraser, M., Li, W., McAnulla, C., McWilliam, H., Maslen, J., Mitchell, A., Nuka, G., 2014. InterProScan 5: genome-scale protein function classification. Bioinformatics 30, 1236–1240. https://doi.org/10.1093/
bioinformatics/btu031.
Kelley, L.A., Mezulis, S., Yates, C.M., Wass, M.N., Sternberg, M.J., 2015. The Phyre2 web portal for protein modeling, prediction and analysis. Nat. Protoc. 10, 845. https://
doi.org/10.1038/nprot.2015.053.
Kumar, S., Stecher, G., Li, M., Knyaz, C., Tamura, K., 2018. Mega X: molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 35, 1547–1549. https://doi.org/10.1093/molbev/msy096.
Lacerda, A.F., Vasconcelos, E.A., Pelegrini, P.B., de Sa, M.F.G., 2014. Antifungal ´ defensins and their role in plant defense. Front. Microbiol. 5, 1–10. https://doi.org/
Ladha, G., Jeevaratnam, K., 2020. Characterization of purified antimicrobial peptide produced by Pediococcus pentosaceus LJR1, and its application in preservation of white leg shrimp. World J. Microbiol. Biotechnol. 36, 1–12. https://doi.org/
10.1007/s11274-020-02847-w.
Lay, F., Anderson, M., 2005. Defensins-components of the innate immune system in plants. Curr. Protein Pept. Sci. 6, 85–101. https://doi.org/10.2174/
1389203053027575.
Lei, J., Sun, L., Huang, S., Zhu, C., Li, P., He, J., Mackey, V., Coy, D.H., He, Q., 2019. The antimicrobial peptides and their potential clinical applications. Am. J. Tourism Res.
11, 3919. PMCID: PMC6684887.
Mahlapuu, M., Håkansson, J., Ringstad, L., Bj¨orn, C., 2016. Antimicrobial peptides: an emerging category of therapeutic agents. Frontiers in Cellular and Infection Microbiology 6, 194. https://doi.org/10.3389/fcimb.2016.00194.
Marchler-Bauer, A., Derbyshire, M.K., Gonzales, N.R., Lu, S., Chitsaz, F., Geer, L.Y., Geer, R.C., He, J., Gwadz, M., Hurwitz, D.I., 2014. CDD: NCBI’s conserved domain database. Nucleic Acids Res. 43, D222–D226. https://doi.org/10.1093/nar/
gku1221.
Mishra, B., Reiling, S., Zarena, D., Wang, G., 2017. Host defense antimicrobial peptides as antibiotics: design and application strategies. Curr. Opin. Chem. Biol. 38, 87–96.
https://doi.org/10.1016/j.cbpa.2017.03.014.
Pag, U., Oedenkoven, M., Sass, V., Shai, Y., Shamova, O., Antcheva, N., Tossi, A., Sahl, H.-G., 2008. Analysis of in vitro activities and modes of action of synthetic antimicrobial peptides derived from an α-helical ‘sequence template’. J. Antimicrob.
Chemother. 61, 341–352. https://doi.org/10.1093/jac/dkm479.
Poon, I.K., Baxter, A.A., Lay, F.T., Mills, G.D., Adda, C.G., Payne, J.A., Phan, T.K., Ryan, G.F., White, J.A., Veneer, P.K., 2014. Phosphoinositide-mediated oligomerization of a defensin induces cell lysis. Elife 3. https://doi.org/10.7554/
eLife.01808.001.
Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 3, 1101–1108. https://doi.org/10.1038/nprot.2008.73.
Schuerholz, T., Brandenburg, K., Marx, G., 2012. Antimicrobial peptides and their potential application in inflammation and sepsis. Crit. Care 16, 207. https://doi.org/
10.1007/978-3-642-25716-2_9.
Shafee, T., Lay, F.T., Phan, T.K., Anderson, M.A., Hulett, M.D., 2016. Convergent evolution of defensin sequence, structure and function. Cell. Mol. Life Sci. 74, 663–682. https://doi.org/10.1007/s00018-016-2344-5.
Silhavy, T.J., Kahne, D., Walker, S., 2010. The bacterial cell envelope. Cold Spring Harbor perspectives in biology 2, a000414. https://doi.org/10.1101/cshperspect.
a000414.
Sohrabi, S.M., Mohammadi, M., Tabatabaiepour, S.N., Tabatabaiepour, S.Z., Hosseini- Nave, H., Soltani, M.F., Alizadeh, H., Hadizadeh, M., 2019. A systematic in silico analysis of the Legionellaceae family for identification of novel drug target candidates. Microb. Drug Resist. 25, 157–166. https://doi.org/10.1089/
mdr.2017.0328.
Stotz, H.U., Thomson, J., Wang, Y., 2009. Plant defensins: defense, development and application. Plant Signal. Behav. 4, 1010–1012. https://doi.org/10.4161/
psb.4.11.9755.
Tam, J.P., Wang, S., Wong, K.H., Tan, W.L., 2015. Antimicrobial peptides from plants.
Pharmaceuticals 8, 711–757. https://doi.org/10.3390/ph8040711.
Tassanakajon, A., Somboonwiwat, K., Amparyup, P., 2015. Sequence diversity and evolution of antimicrobial peptides in invertebrates. Dev. Comp. Immunol. 48, 324–341. https://doi.org/10.1016/j.dci.2014.05.020.
Tavormina, P., De Coninck, B., Nikonorova, N., De Smet, I., Cammue, B.P., 2015. The plant peptidome: an expanding repertoire of structural features and biological functions. Plant Cell 27, 2095–2118. https://doi.org/10.1105/tpc.15.00440.
Thomma, B.P., Cammue, B.P., Thevissen, K., 2002. Plant defensins. Planta 216, 193–202.
https://doi.org/10.1007/s00425-002-0902-6.
Urdangarín, M.C., Norero, N.S., Broekaert, W.F., de la Canal, L., 2000. A defensin gene expressed in sunflower inflorescence. Plant Physiol. Biochem. 38, 253–258. https://
doi.org/10.1016/S0981-9428(00)00737-3.
Van der Weerden, N.L., Anderson, M.A., 2013. Plant defensins: common fold, multiple functions. Fungal Biology Reviews 26, 121–131. https://doi.org/10.1016/j.
fbr.2012.08.004.
Vriens, K., Cammue, B., Thevissen, K., 2014. Antifungal plant defensins: mechanisms of action and production. Molecules 19, 12280–12303. https://doi.org/10.3390/
molecules190812280.
Waghu, F.H., Gopi, L., Barai, R.S., Ramteke, P., Nizami, B., Idicula-Thomas, S., 2014.
CAMP: Collection of sequences and structures of antimicrobial peptides. Nucleic Acids Res. 42, D1154–D1158. https://doi.org/10.1093/nar/gkt1157.
Wilmes, M., Cammue, B.P., Sahl, H.-G., Thevissen, K., 2011. Antibiotic activities of host defense peptides: more to it than lipid bilayer perturbation. Nat. Prod. Rep. 28, 1350–1358. https://doi.org/10.1039/C1NP00022E.
Wilson, S.S., Wiens, M.E., Smith, J.G., 2013. Antiviral mechanisms of human defensins.
J. Mol. Biol. 425, 4965–4980. https://doi.org/10.1016/j.jmb.2013.09.038.
Wu, J., Gao, B., Zhu, S., 2014. The fungal defensin family enlarged. Pharmaceuticals 7, 866–880. https://doi.org/10.3390/ph7080866.
Wu, Q., Patoˇcka, J., Kuˇca, K., 2018. Insect antimicrobial peptides, a mini review. Toxins 10, 461. https://doi.org/10.3390/toxins10110461.
Yount, N.Y., Yeaman, M.R., 2004. Multidimensional signatures in antimicrobial peptides.
Proc. Natl. Acad. Sci. Unit. States Am. 101, 7363–7368. https://doi.org/10.1073/
pnas.0401567101.
Yu, C.-S., Cheng, C.-W., Su, W.-C., Chang, K.-C., Huang, S.-W., Hwang, J.-K., Lu, C.-H., 2014. CELLO2GO: a web server for protein subcellular localization prediction with functional gene ontology annotation. PloS One 9, e99368. https://doi.org/10.1371/
journal.pone.0099368.
Zasloff, M., 2002. Antimicrobial peptides of multicellular organisms. Nature 415, 389–395. https://doi.org/10.1038/415389a.
Zasloff, M., 2016. Antimicrobial peptides: do they have a future as therapeutics?
Antimicrobial Peptides. Springer, pp. 147–154. https://doi.org/10.1007/978-3-319- 24199-9_10.
Zhang, L.-j., Gallo, R.L., 2016. Antimicrobial peptides. Curr. Biol. 26, R14–R19. https://
doi.org/10.1016/j.cub.2015.11.017.
Zhang, Y., Lewis, K., 1997. Fabatins: new antimicrobial plant peptides. FEMS (Fed. Eur.
Microbiol. Soc.) Microbiol. Lett. 149, 59–64. https://doi.org/10.1111/j.1574- 6968.1997.tb10308.x.
