Title Localization and expression patterns of TRP channels in submandibular gland development
Author(s) 藤関, 元也 Journal
URL http://hdl.handle.net/10130/6147 Right
Description 博士（歯学）・第２１４４号（甲 第１３４９号）・平
成２８年３月３１日
TRP expression in early developmental stage of rat submandibular gland demonstrated by
real-time polymerase chain reaction and immunohistochemistry
Tokyo Dental College Department of Histology and Developmental Biology
Fujiseki Motoya
Abstract
Transient receptor potential (TRP) channels are involved in the reception of chemical and physical stimulations, and their multifunctional properties have been reported. In addition, their involvement in the development of various organs and cell differentiation has been reported. The primordium of rat submandibular gland is formed at about embryonic day 14. Cells repeat differentiation and maturation, with which the development progresses and it has been reported that cells constituting the submandibular gland in early development are different from those in adult animals.
Expression of TRP channels: TRP vanilloid (TRPV)3, TRPV4 and TRP melastatin (TRPM)8, in adult rat salivary gland has recently been reported. In addition to the TRP channels described above, expression of TRP canonical (TRPC)1 in the salivary gland has also been reported. The authors investigated expression of these TRP channels in the submandibular gland during early developmental stage in which the cell constitution is different, and discussed the function of TRP in the submandibular gland in early development. Using rat submandibular gland at embryonic days (E)18 and E20 and postnatal days (PN)0 and PN5 when cells constituting the submandibular gland alter, and PN28 when functional maturation of the acinar region of the submandibular gland completes, expression of TRPV3, TRPV4, TRPC1 and TRPM8 was investigated using real-time polymerase chain reaction (RT-PCR) and immunohistochemistry. All TRP channels were expressed in cells constituting the submandibular gland in early developmental stage, but an increase in the expression level at PN5 on RT-PCR was significant compared with those at E18, PN0 and PN28 in TRPC1 and TRPV4 channels, whereas an increase was observed but not significant in the others. On immunohistochemical staining at PN5, positive reaction for anti-TRPC1 antibody was
observed in the duct region, whereas strong reactions of anti-TRPM8 antibody, anti-TRPV3 and anti-TRPV4 antibodies were observed in cells which proliferated from a terminal portion of cells arranged tubular structure which previously constituted mostly the submandibular gland. It was clarified that TRP channels are expressed in the rat submandibular gland in early developmental stage although cells constituting the submandibular gland are different from those in adult animals, suggesting that these TRP channels are involved in cell differentiation in at PN5 into the adult submandibular gland during early development.
Introduction
The primordium of the salivary gland is formed in the embryonic period, but it matures to saliva secretion after birth in most experimental animals (Carpen & Papilian, 1980; Devi & Jacoby, 1966; Jacoby & Leeson, 1959; Kay, 1960; Leeson & Jacoby, 1959). Development of rat submandibular gland has been investigated light microscopically (Jacoby & Leeson, 1959; Srivastava, 1977) and electron microscopically (Leeson & Jacoby, 1959). The primordium formed by epithelial invagination at embryonic day (E)14 showed a bud-like structure comprised of parts termed a stalk and terminal bulb (Cutler & Chaudhry, 1974). Differentiation into secretory cells starts in bud-like tissue at E17 and E18, organelles necessary to produce and secrete exocrine proteins develop, and secretory granules have been confirmed at E18 (Cutler & Chaudhry, 1973, 1974). Cells formed bulb-like structure proliferate and form a tubular structure. These are the main cells constituting the submandibular gland immediately after birth. Cells of the tip of the tubular structure proliferate and differentiate at postnatal days (PN) 2-6, forming a pouch structure. This pouch structure formation continued until PN8-12, and cells constituting the main structure of the terminal region: the tubular and pouch structure, differentiate into acinar cells and duct cells in interstitial regions. Therefore, these cells decrease and disappear after PN14 (Srivastava, 1977). The acinar cells have been shown to require about one month to functionally mature (Moreira, Ball, Mirels, & Hand, 1991).
In the duct region, cells showing a stem-like structure from E16 form a duct-like structure. A lumen is formed at bifurcation regions at E17, striated ducts are observed at E20, and striated ducts completely mature by one week after birth (Cutler & Chaudhry, 1975). During this period, catecholamine-containing nerves are present along the duct
branches establishing the functional connection with acinar secretory cells (Cutler &
Bottaro, 1984).
Transient receptor potential (TRP) channels are nonselective cation channels. Their presence has been confirmed in most animal species, and these are classified into 6 subfamilies (Minke, 2002; Nilius & Voets, 2005). These channels have various physiological functions, and their involvement in sensing chemical (including hormone ligands and arachidonic acid metabolites) and physical/mechanical (temperature, light, and pressure) stimulations has been confirmed (Clapham, 2003). In addition, interactions with various proteins have been clarified, and a function as scaffolds adjusting diverse stimulations corresponding to the environment, in addition to signal conversion of a single stimulation, has been reported (Cheryl et al., 2009). Moreover, since TRP expressed transiently in cells and tissues during developmental process (Che, Yue, Tse, & Li, 2014; Huang, Young, & Glitsch, 2007; Masuyama et al., 2008;
Sánchez-Ramos et al., 2012; Shibasaki, Tominaga, & Ishizaki, 2015; Valero, Mello de Queiroz, Stühmer, Viana, & Pardo, 2012; Wang & Poo, 2005; Yee, Zhou, & Lee, 2010), it is thought that TRP participates in the development, differentiation and maturation of cells and tissues.
Sobhan et al. (2013) recently reported that temperature-sensitive TRP channels are expressed in the adult rat salivary gland. In addition, expression of TRP canonical (TRPC)1 in the salivary gland was reported (Liu et al., 2000), and saliva secretion decreases in TRPC1-knockout mice (Liu et al., 2007).
Thus, in this study, the authors investigated expression of TRP channels that expressed in adult rat submandibular gland: TRPC1, TRP melastain (TRPM)8, TRP vanilloid (TRPV)3, and TRPV4, in the submandibular gland in early development
constituted by cells different from those in the salivary gland in adult animals, using real-time polymerase chain reaction (RT-PCR) and immunohistochemical staining.
Materials and Methods
This study was approved by the Tokyo Dental College Experimental Animal Committee and performed in conformity with the specified guidelines for animal experiments (No. 25026).
Animals
Eight Wister rats at E18 and E20, PN0, PN5 and PN28 (5 for PCR and 3 for histology and immunohistochemistry, 40 in total) were used, and the submandibular gland was investigated.
RT-PCR
Dams were deeply anesthetized with diethyl ether and euthanized by an intraperitoneal injection of sodium barbiturate (50 mg/kg), and the fetuses were excised.
Postnatal rats were anesthetized with diethyl ether and euthanized by an intraperitoneal injection of sodium barbiturate (50 mg/kg).
The submandibular gland was excised from fetal and postnatal rats immediately after they had been sacrificed. Total RNA was extracted following the manual attached to the RNeasy mini kit (QIAGEN, Limburg, NED), and cDNA was synthesized using the QuantiTect Reverse Transcription Kit (QIAGEN, Limburg, NED). RT-PCR was performed using the LightCycler Taqman master (Roche Diagnostics, Basel, CH) as a hot start PCR reaction solution and LightCycler (Roche Diagnostics, Basel, CH).
Samples were prepared as follows: 10 μL of sterile water enclosed in the kit, 5.0 μL of cDNA, 4.0 μL of TaqMan master, 0.2 μL of Universal Probe Library Probes, and 0.4 μL of forward and reverse primers designed using the Probe Finder software (Roche
Diagnostics, Basel, CH) were combined and the final volume was adjusted to 20 μL.
The base sequences of the primers are shown in Table 1. RT-PCR was performed under the following conditions: Enzyme activation, 95C for 10 minutes; amplification process, 95C for 10 seconds, 60C for 30 seconds, and then 72C for 1 second; number of cycles, 45; and cooling, 40C for 30 seconds. Fluorescent signals were detected at 72C and the amplification level was continuously observed.
Each mRNA expression level relative to the GAPDH mRNA expression level in the sample was determined using the 2(-∆∆CT) method.
Relative values were compared using one-way ANOVA and tukey’s test.
Histology and Immunohistochemistry
Fetal and postnatal rats were sacrificed as described above, and the submandibular gland was immediately excised and fixed in 4% paraformaldehyde in 0.1 M PBS (pH 7.4) at 4C for 12 hours. Paraffin-embedded blocs were prepared following the standard method and 5-μm-thick serial sections were prepared. Standard hematoxylin-eosin double staining was applied, and some sections were subjected to immunohistochemical staining as follows:
Sections were deparaffinized with xylene and alcohol series and activated twice with a 400-W microwave in 0.01% citrate buffer (pH 6.0) within 15 minutes, followed by washing with 0.1 M PBS (pH 7.4). These sections were then immersed in methanol containing 0.3% hydrogen peroxide (H2O2) at room temperature for 30 minutes to remove endogenous H2O2. Immunostaining was performed using the VECTASTAIN Elite ABC Kit (Vector Laboratories, Inc., California, USA) with rabbit anti-rat TRPC1
polyclonal (NOVUS, Littleton, USA, 1/500) rabbit anti-rat TRPM8 polyclonal (Abcam, Cambridge, UK, 1/500), rabbit anti-rat TRPV3 polyclonal (Abcam, Cambridge, UK, 1/500), and rabbit anti-rat TRPV4 polyclonal (Abcam, Cambridge, UK, 1/500) antibodies as primary antibodies, and the color was developed with 3,3'-diaminobenzidine tetrahydrochloride, followed by counter staining with hematoxylin. Normal rabbit serum was used instead of the primary antibody as the control.
Results
RT-PCR (Figure 1)
The relative expression level of each channel regarding the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression level as “1” was measured at each age in days.
TRPC1
The overall expression level was high. Expression was noted from E18 and the level increased at E20 and then decreased at PN0, but the highest level was noted at PN5. The level at PN5 was significantly higher than those at E18, PN0 and PN28.
TRPM8
It was expressed from E18, the level unchanged at E20, increased at PN0, and reached the maximum level at PN5. At PN28, the expression level decreased to a level equivalent to that in the embryonic period. Although no significant difference was noted among the ages in days, it tended to increase from the embryonic period to PN5.
TRPV3
The expression level was low at E18 and E20, but it increased at PN0 and reached the maximum level at PN5. At PN28, the level was similar to that in the embryonic period. No significant difference was noted among the ages in days.
TRPV4
It was expressed already at E18. It tended to increase at E20 but decreased at PN0 and the level at PN28 was similar to that at E18. The level at PN5 was significantly higher than those at E18, PN0 and PN28.
Histology and Immunohistochemistry
Since all TRP channels expressed at PN5 in RT-PCR, the authors show data of PN5 as representative data of immunohistochemistry. At PN5, large cells formed cells at the tip of the tubule structure were observed (Fig. 2A). Weak immunological reaction for anti-TRPV4 antibody was observed in the acinus-like regions (Fig.2C), whereas cells derived from the tubule structure showed strong positive reactions for anti-TRPM8 and anti-TRPV3 antibodies (Fig.2 E,F). For anti-TRPC1 antibody, strong reaction was observed in the duct region (Fig.2D).
Discussion
Although TRPM8, TRPV3 and TRPV4 are temperature sensitive channels and TRPC1 is involved in saliva secretion, it has been reported that TRPC is involved in differentiation and extension of nerve cells (Huang, Young, & Glitsch, 2007; Wang &
Poo, 2005), TRPV3 and TRPV4 are involved in differentiation and proliferation of adipocytes and osteoclasts (Che, Yue, Tse, & Li, 2014; Masuyama et al., 2008), and TRPM8 is involved in cancer cell proliferation and apoptosis (Valero, Mello de Queiroz, Stühmer, Viana, & Pardo, 2012; Yee, Zhou, & Lee, 2010). In addition, TRPV4 and TRPC1 were reported to transiently appear in the developmental processes of the retina, hippocampus and heart muscle (Sánchez-Ramos et al., 2012; Shibasaki, Tominaga, &
Ishizaki, 2015). From these findings, it suggested that round and large cells was formed from the cells arranged as tubule-like structure. These channels are multifunctional and involved in the development, differentiation and maturation processes of cells and tissue.
In our study, the following periods were observed in the early development of rat submandibular gland: Periods in which cells constituting the submandibular gland are the secretory type (E18), secretory granules alter and striated ducts start differentiation (E20), reception of external stimulation starts immediately after birth (PN0), cell division and differentiation occur from the end of the tubular structure and form a pouch structure, and striated ducts functionally maturate (PN5), and acinar cells complete maturation (PN28). As a result, the TRPC1 and TRPV4 expression levels on RT-PCR at PN5 were significantly higher than those at E18, PN0 and PN28, and the levels also increased at E20, compared with those at E18, PN0 and PN28 although the differences were not significant. No significant changes were noted in expression of TRPM8 and TRPV3 throughout the observation period, but an increase peaking at PN5 was noted.
At PN5, positive reactions with anti-TRPC1 antibody were detected around the striated duct, and positive reactions with anti-TRPV3, anti-TRPV4 and anti-TRPM8 antibodies were detected in cells of the tip of the tubular structure forming a pouch structure. These findings suggested that the TRPM8, TRPV3 and TRPV4 channels are involved in the differentiation of cells constituting the salivary gland, particularly in the early period in which acinar cells differentiate from the cells arranged tubule structure. In addition, involvement of the TRPC1 channel in nerve cell differentiation and neurite extension (Wang & Poo, 2005), and catecholamine-containing nerve extension along the duct at PN5 (Cutler & Bottaro, 1984) were observed, suggesting association between TRPC1 and the nerve distribution in the duct region.
Although the difference was not significant, it is possible that increases in TRPC1 and TRPV4 at E20 are involved in differentiation of the striated duct, changes in secretory granules in the acinus, and subsequent changes in organelles.
Sobhan et al. (2013) reported that the TRP channels observed by us are expressed in the salivary gland in adult animals, suggesting these channels are associated with saliva secretion. In the rat submandibular gland, the presence of secretory cells from E18 and saliva secretion at PN1 have been observed, suggesting that the TRP channels observed in our study are associated with saliva secretion immediately after birth, in addition to the cell differentiation in the salivary gland described above.
Acknowledgement
The authors are grateful to the staff of the Department of Histology and Developmental Biology, Tokyo Dental College.
Figure legends
Figure 1: Relative quantification of each channel using RT-PCR
Submandibular gland cells at E18, E20, PN0, PN5 and PN28 were subjected to RT-PCR, and the DNA amplification rate of each TRP channel was presented as a value relative to the GAPDH amplification rate using the 2-[ΔΔCt] method. The values of TRPC1 and TRPV4 at PN5 were significantly higher than those at E18, E20 and PN28.
*: P>0.05
Figure 2: Immunohistochemistry at PN5
Large cells formed by proliferation of cells at the tip of the tubule structure were observed (A arrow). Overall immunological reaction for anti-TRPV4 antibody was weak (C), but cells which formed pouch structure strongly reacted for anti-TRPM8 and anti-TRPV3 antibodies (E arrow, F arrow). The duct region showed a strong reaction for anti-TRPC1 antibody (D).
A: H-E staining, B: control, C: anti-TRPV4 antibody, D: anti-TRPC1 antibody, E:
anti-TRPM8 antibody, F: anti-TRPV3 antibody, Bars: 50 μm
References
Carpen, E., & Papilian, V. V. (1980). Histological and histochemical study of rat salivary glands during their postnatal development. Morphologie et Embryologie, 26(3), 259–264.
Che, H., Yue, J., Tse, H. F., & Li, G. R. (2014). Functional TRPV and TRPM channels in human preadipocytes. Pflügers Archiv - European Journal of Physiology, 466(5), 947–959.
Cheryl, L. S., Adrienne, E. D., Nathaniel, A. J., Sacha, A. M., David, D. M., & Gina, M.
S. (2009). Roles of transient receptor potential channels in pain. Brain Research Reviews, 60(1), 2–23.
Clapham, D. E. (2003). TRP channels as cellular sensors. Nature, 426(6966), 517–524.
Cutler, L. S., & Bottaro, B. F. (1984). An electrophysiological study of the postnatal development of the autonomic innervation of the rat submandibular salivary gland.
Archives of Oral Biology, 29(3), 237–242.
Cutler, L. S., & Chaudhry, A. P. (1973). Intercellular contacts at the
epithelial-mesenchymal interface during the prenatal development of the rat submandibular gland. Developmental Biology, 33(2), 229–240.
Cutler, L. S., & Chaudhry, A. P. (1974). Cytodifferentiation of the acinar cells of the rat submandibular gland. Developmental Biology, 41(1), 31–41.
Cutler, L. S., & Chaudhry, A. P. (1975). Cytodifferentiation of striated duct cells and secretory cells of the convoluted granular tubules of the rat submandibular gland.
American Journal of Anatomy, 143(2), 201–217.
Devi, N. S., & Jacoby, F. (1966). The submaxillary gland of the golden hamster and its post-natal development. Journal of Anatomy, 100(2), 269–85.
Huang, W. C., Young, J. S., & Glitsch, M. D. (2007). Changes in TRPC channel expression during postnatal development of cerebellar neurons. Cell Calcium, 42(1), 1–10.
Jacoby, F., & Leeson, C. R. (1959). The postnatal development of the rat submaxillary gland. Journal of Anatomy, 93(2), 201–216.
Kay, R. N. (1960). The development of parotid salivary secretion in young goats. The Journal of Physiology, 150(3), 538–45.
Leeson, C. R., & Jacoby, F. (1959). An electron microscopic study of the rat
submaxillary gland during its post-natal development and in the adult. Journal of Anatomy, 93(3), 287–295.
Liu, X., Cheng, K. T., Bandyopadhyay, B. C., Pani, B., Dietrich, A., Paria, B. C.,
Swaim, W. D., Beech, D., Yildrim, E., Singh, B. B., Birnbaumer, L., & Ambudkar, I. S. (2007). Attenuation of store-operated Ca2+ current impairs salivary gland fluid secretion in TRPC1(-/-) mice. Proceedings of the National Academy of Sciences of the United States of America, 104(44), 17542–17547.
Liu, X., Wang, W., Singh, B. B., Lockwich, T., Jadlowiec, J., O’Connell, B., Wellner, R., Zhu, M. X., & Ambudkar, I. S. (2000). Trp1, a candidate protein for the store-operated Ca2+ influx mechanism in salivary gland cells. Journal of Biological Chemistry, 275(5), 3403–3411.
Masuyama, R., Vriens, J., Voets, T., Karashima, Y., Owsianik, G., Vennekens, R., Lieben, L., Torrekens, S., Moermans, K., Vanden Bosch, A., Bouillon, R., Nilius, B., & Carmeliet, G. (2008). TRPV4-mediated calcium influx regulates terminal differentiation of osteoclasts. Cell Metabolism, 8(3), 257–265.
Minke, B. (2002). The TRP calcium channel and retinal degeneration. Advances in
Experimental Medicine and Biology, 514, 601–622.
Moreira, J. E., Ball, W. D., Mirels, L., & Hand, A. R. (1991). Accumulation and localization of two adult acinar cell secretory proteins during development of the rat submandibular gland. American Journal of Anatomy, 191(2), 167–184.
Nilius, B., & Voets, T. (2005). TRP channels: A TR(I)P through a world of
multifunctional cation channels. Pflügers Archiv - European Journal of Physiology, 451(1), 1–10.
Sánchez-Ramos, C., Guerrera, M. C., Bonnin-Arias, C., Calavia, M. G., Laurà, R., Germanà, A., & Vega, J. A. (2012). Expression of TRPV4 in the zebrafish retina during development. Microscopy Research and Technique, 75(6), 743–748.
Shibasaki, K., Tominaga, M., & Ishizaki, Y. (2015). Hippocampal neuronal maturation triggers post-synaptic clustering of brain temperature-sensor TRPV4. Biochemical and Biophysical Research Communications, 458(1), 168–173.
Srivastava, H. C. (1977). Development of acinar cells in the rat submandibular gland.
Journal of Anatomy, 123(2), 459–465.
Valero, M. L., Mello de Queiroz, F., Stühmer, W., Viana, F., & Pardo, L. A. (2012).
TRPM8 Ion Channels Differentially Modulate Proliferation and Cell Cycle Distribution of Normal and Cancer Prostate Cells. PLoS ONE, 7(12), e51825.
Wang, G. X., & Poo, M. M. (2005). Requirement of TRPC channels in netrin-1-induced chemotropic turning of nerve growth cones. Nature, 434(7035), 898–904.
Yee, N. S., Zhou, W., & Lee, M. (2010). Transient receptor potential channel TRPM8 is over-expressed and required for cellular proliferation in pancreatic adenocarcinoma.
Cancer Letters, 297(1), 49–55.
Primer sequence probe
TRPa1 Forward primer ggcctgagtttttgcagatg ＃9
Reverse primer gcgtacatccatcattgtcct
TRPc1 Forward primer ctattttgggcccactgc ＃123
Reverse primer cctagaaatttcccaaaatcttgtaac
TRPm8 Forward primer gatcaacacgaaggccaac ＃82
Reverse primer tccagttgtctgaaccgatg
TRPv3 Forward primer tcgtctacaacaccaacattgac ＃110
Reverse primer tccacttcatatgcagcagtg
TRPv4 Forward primer acctctcctccctggatacg ＃69
Reverse primer tgtaaaccaggatctccagca
GAPDH Forward primer agctggtcatcaatgggaaa ＃9
Reverse primer atttgatgttagcgggatcg table.1
※ ※
※ :p≦0.05
Fig.1
Fi g. 2
C
F E
B A
D