저작자표시-동일조건변경허락 2.0 대한민국 이용자는 아래의 조건을 따르는 경우에 한하여 자유롭게
l 이 저작물을 복제, 배포, 전송, 전시, 공연 및 방송할 수 있습니다. l 이차적 저작물을 작성할 수 있습니다.
l 이 저작물을 영리 목적으로 이용할 수 있습니다. 다음과 같은 조건을 따라야 합니다:
l 귀하는, 이 저작물의 재이용이나 배포의 경우, 이 저작물에 적용된 이용허락조건 을 명확하게 나타내어야 합니다.
l 저작권자로부터 별도의 허가를 받으면 이러한 조건들은 적용되지 않습니다.
저작권법에 따른 이용자의 권리는 위의 내용에 의하여 영향을 받지 않습니다. 이것은 이용허락규약(Legal Code)을 이해하기 쉽게 요약한 것입니다.
Disclaimer
저작자표시. 귀하는 원저작자를 표시하여야 합니다.
동일조건변경허락. 귀하가 이 저작물을 개작, 변형 또는 가공했을 경우 에는, 이 저작물과 동일한 이용허락조건하에서만 배포할 수 있습니다.
이학석사학위논문
HIF 전사인자가 갈색지방에서 열생산에 미치는 영향
The effect of hypoxia inducible factors on brown adipose tissue thermogenesis
2018년 2월
서울대학교 대학원 생명과학부
최 원 근
i
ABSTRACT
The effect of hypoxia inducible factors on brown adipose tissue thermogenesis
Won Gun Choi
Systemic energy imbalance between energy intake and expenditure lies at the center of obesity pandemic. Brown adipocyte plays an important role in increasing energy expenditure by generating heat. Hypoxia-inducible factor (HIF) regulates the expression of glucose transporter 1 and several glycolytic enzymes, however its role in brown adipose tissues has not been elucidated, yet. There are two major isoforms of HIF in adipocytes, HIF1α and HIF2α. Here, I studied the mechanism of how HIF1α regulates cold-induced thermogenesis in brown adipocytes. HIF1α expression was increased in brown adipose tissue after cold exposure. Moreover, β adrenergic receptor agonist treatment increased HIF1α expression in brown adipocytes in vitro. HIF1α knockdown decreased isoproterenol- induced UCP1 expression. On the other hand, I found that HIF2α is involved in brown pre-adipocyte differentiation. These results suggest that HIF1α and HIF2α can modulate adaptive thermogenesis in brown adipose tissue.
ii
Key words: HIF1α, HIF2α, brown adipose tissue, thermogenesis, UCP1 Student number: 2012-23072
iii
TABLE OF CONTENTS
ABSTRACT...i
TABLE OF CONTENTS...ⅲ LIST OF FIGURES...ⅴ LIST OF TABLES...ⅵ INTRODUCTION...1
MATERIAL AND METHODS...4
1. Animals and treatment...4
2. Induction of differentiation of brown adipocyte cell line and 3T3-L1...4
3. Transfection with small interfering RNA...5
4. Isolation of total RNA and quantitative RT-PCR analysis...6
5. Western blot analysis...6
6. Statistical analysis...7
RESULTS...9
1. HIF1α is induced by beta adrenergic receptor stimulation in brown adipocytes...9
2. Increased HIF1α expression by isoproterenol treatment is not due to increased UCP1 activity...14
3. HIF1α increases UCP1 expression upon β adrenergic stimulation...14 4. HIF2α expression increases during brown adipocytes differentiation but
iv
d o e s n ot a ff e c t t h er mo ge n i c ge n e e x p r es s i o n i n ma t u r e br ow n
adipocytes...25
DISCUSSION...28
REFERENCES...33
ABSTRACT IN KOREAN...39
v
LIST OF FIGURES
Figure 1. HIF1α expression is elevated in brown and inguinal adipose tissue of cold exposed mice...10 Figure 2. HIF1α expression is increased in immortalized brown adipocytes but not in 3T3-L1 by β adrenergic stimulation...12 Figure 3. HIF1α and HIF2α expression in IAT and BAT from time dependently cold exposed mice...13 Figure 4. Accumulation of HIF1α is not mediated by UCP1...15 Figure 5. Knockdown of HIF1in brown adipocytes downregulated UCP1 expression...19 Figure 6. Overexpression of HIF1α in brown adipocytes upregulated UCP1 expression...21 Figure 7. VHL expression decreased in brown adipocytes by β adrenergic stimulation...23 Figure 8. Expression of thermogenesis related genes is negatively affected by hypoxic condition...24 Figure 9. HIF2α is increased but HIF1α is decreased during brown adipogenesis....26 Figure 10. Knockdown of HIF2α does not affect isoproterenol-induced UCP1 expression...27 Figure 11. A proposed model for the mechanisms of HIFα in brown adipose tissue.32
vi
LIST OF TABLES
Table 1. The primer sequences used for the qRT-PCR analysis...8
- 1 -
INTRODUCTION
Brown adipose tissue (BAT) is a specialized organ for energy dissipation with abundant expression of uncoupling protein 1 (UCP1) (Cannon and Nedergaard, 2004).
Upon activation by long-chain fatty acids, UCP1 produces heat rather than ATP by using proton gradient in brown fat mitochondria (Fedorenko et al., 2012). Inducible 'brown-like' adipocytes called beige adipocytes, it is usually occurred in subcutaneous white adipose tissue in response to various activators (Vitali et al., 2012). Similar to brown adipocytes, beige adipocytes contain multilocular lipid droplets, high mitochondrial content and express thermogenic genes such as UCP1, Dio2 and Prdm16.
Recently, it has been suggested that increasing brown fat activity can be an attractive target to promote weight loss.
Heat generation in brown or beige fat is affected by diverse mechanisms such as thermogenic gene expression regulation, vascularization, nerve-branching and immune cell response. Recently, it is also suggested that UCP1+ adipocyte hyperplasia is important for systemic thermogenic activity, and this can be regulated by two mechanisms: white fat to brown fat transition (Barbatelli et al., 2010; Vitali et al., 2012;
Wang et al., 2013) and increased de novo brown or beige adipocyte generation (Bronnikov et al., 1992; Bukowiecki et al., 1982; Vishvanath et al., 2016). During cold exposure, glucose uptake is increased in BAT with increased glucose transporter activity
- 2 -
(Glut1) (Olsen et al., 2014; Pace et al., 2011; Wang et al., 2012) and the expression of several glycolytic enzymes. Therefore, it is likely that glucose metabolism in brown adipose tissue may be critical for heat generation. However, upstream regulator for glucose metabolism in response to cold exposure in brown adipose tissue is largely unknown.
Hypoxia-inducible factors (HIF) are key transcription factors for hypoxic responses such as angiogenesis and glycolysis. There are two major isoforms of HIF in adipocytes: HIF1α and HIF2α. In normoxic conditions, HIF1α and HIF2α are rapidly degraded by an ubiquitin-dependent proteasomal degradation pathway. At low oxygen levels, PHD hydroxylates HIFα protein. Once hydroxylated by prolyl hydroxylases (PHDs), E3 ligase Von Hippel-Lindau tumor suppressor (VHL) binds to and ubiquitinates HIFα, leading to a proteolytic degradation pathway. When oxygen level drops PHD activity is inhibited, increasing HIFα protein stability (West, 2017). In obesity, as adipose tissue expands, oxygen consumption rate increases while oxygen supply decreases in adipose tissue, leading to a state of relative hypoxia. Accumulated HIF1α increases the expression of genes such as LOX, IL-6, IL-1β, NOS2 and contributes to adipose tissue inflammation, fibrosis, and adipocyte dysfunction (Fujisaka et al., 2013; Halberg et al., 2009; Jiang et al., 2011; Lee et al., 2014). In brown adipose tissue, depletion of HIF2α aggravates obesity-induced brown adipose tissue dysfunction and metabolic dysregulation (Garcia-Martin et al., 2015). However, roles of HIF1α
- 3 -
and HIF2α in the regulation of thermogenic activity of brown adipose tissue remains to be elucidated.
In this study, I studied the effect of HIF1α and HIF2α on brown fat thermogenesis, UCP1 expression upon β adrenergic stimulation and brown adipocyte differentiation.
- 4 -
MATERIALS AND METHODS
Animals and treatment
All mice were purchased at 8 weeks of age from Central Laboratory Animal Inc., Seoul, South Korea, and were killed at 15 weeks of age to detect HIF1α in the brown and inguinal adipose tissue. All mice were maintained under pathogen-free conditions and were housed in solid-bottom cages with wood shavings for bedding in a room maintained at 25°C with a 12:12-h light: dark cycle (lights on at 07:00 h). For cold exposure experiments 14 weeks old male mice were individually housed at 4 °C or 30 °C as a thermos-neutral control for a week. All mice were killed and dissected, and tissue specimens were immediately stored at -80°C until analysis. All animal procedures were conducted in accordance with the research guidelines of the Seoul National University and KAIST; Korea Advanced Institute of Science and Technology.
Induction of differentiation of brown adipocyte cell line and 3T3-L1
Brown pre-adipocyte cell line was kindly gifted from Dr. Ge (NIDDK, NIH, Bethesda, MD), and cells were grown at 37°C in a humidified 5% CO2 incubator (Cho et al., 2009). Cells were maintained in DMEM containing 10% FBS before initiating differentiation, and grown to confluence in the differentiation medium (DMEM containing 10% FBS, 0.1 μM insulin, and 1 nM T3). Four days after the induction of
- 5 -
confluence (day 0), cells were stimulated for 2 days with the induction medium (differentiation medium containing 0.5 mM IBMX, 2 μg/ml dexamethasone, and 0.125 mM indomethacin), and then the cultures were subjected to the differentiation medium, and changed every 2 days. Full differentiation was achieved at day 8.
3T3-L1 pre-adipocytes were grown to confluence in DMEM supplemented with 10%
bovine calf serum (HyClone). Two days after confluence, differentiation was stimulated with DMEM containing 10% FBS, 500 mmol/L methylisobutylxanthine, 1 mmol/L dexamethasone, and 5 mg/mL insulin for 2 days. Then the culture medium was replaced with DMEM containing 10% FBS and 5 mg/mL insulin.
Transfection with small interfering RNA
Small interfering RNA (siRNA) was delivered into mature adipocytes by electroporation. After full differentiation of adipocytes, it was detached by TE (Trypsin/EDTA Solution) and then cells were electroporated with siRNA. The sequences of the siRNA targeting HIF1α were sense, 5’-
GUGGUUGGGUCUAACACUA-3’, and antisense, 5’-
UAGUGUUAGACCCAACCAC-3’ HIF2α were sense, 5’-
CUGACUAACCGCCACAGAU-3’, and antisense, 5’-
AUCUGUGGCGGUUAGUCAG-3’. As a negative control, a scrambled siRNA (siNC) was used.
- 6 -
Isolation of total RNA and quantitative RT-PCR analysis
Total RNA was isolated with TRIzol reagent (Invitrogen Life Technologies) according to the manufacturer’s protocol from brown adipocyte cell line, 3T3L1 adipocytes, and epididymal, subcutaneous, brown adipose tissues. cDNA was synthesized using the M-MuLV reverse transcriptase kit according to the manufacturers’
instructions (Thermo Fisher Scientific, Waltham, MA). The primers used for quantitative real-time PCR were obtained from Bioneer (Daejeon, South Korea), and their sequences are provided in Table 1.
Western blot analysis
Brown adipocyte cell lines, 3T3-L1 adipocytes, and epididymal, subcutaneous, brown adipose tissues were lysed with RIPA buffer. The proteins were separated on SDS-PAGE gels and transferred to PVDF (polyvinylidene fluoride) membranes (Millipore). The blots were blocked with 5% BSA and probed with the following primary antibodies: HIF1α (Novus), HIF2α (R&D system), UCP1 (abcam), and β-actin (Sigma-Aldrich). The blots were visualized with horseradish peroxidase– conjugated secondary antibodies (Sigma-Aldrich) developed with chemiluminescence.
- 7 - Statistical analysis
Results represent data from multiple (three or more) independent experiments.
Error bars represent SD, and P values were calculated using Student t test. Differences were considered statistically significant at *p < 0.05 and **p < 0.01.
- 8 - Table 1. Primers sequences for qRT-PCR
Species Gene Sequence (5’ to 3’) Direction
Mouse
HIF1α CAAGATCTCGGCGAAGCAA Forward
GGTGAGCCTCATAACAGAAGCTTT Reverse
HIF2α CGAGAAGAACGACGTGGTGTTC Forward
GTGAAGGCGGGCAGGCTCC Reverse
PGC1α GTAGGCCCAGGTACGACAGC Forward
GCTCTTTGCGGTATTCATCCC Reverse
TFAM CCACAGAACAGCTACCCAAATTT Forward
TCCACAGGGCTGCAATTTTC Reverse
CPT1α TGAGTGGCGTCCTCTTTGG Forward
CAGCGAGTAGCGCATAGTCATG Reverse
COX7a1 AAAACCGTGTGGCAGAGAAG Forward
CCAGCCCAAGCAGTATAAGC Reverse
VEGFα GGAGATCCTTCGAGGAGCACTT Forward
GGCGATTTAGCAGCAGATATAAGAA Reverse
VHL TCAGCCCTACCCGATCTTACC Forward
ATCCCTGAAGAGCC AAAGATGA Reverse
iNOS CACCTTGGAGTTCACCCAGT Forward
ACCACTCGTACTTGGGATGC Reverse
GLUT1 ACTGGGCAAGTCCTTTGAGA Forward
GTCTAAGCCAAACACCTGGGC Reverse
UCP1 CTGGGCTTAACGGGTCCTG Forward
CTGGGCTAGGTAGTGCCAGTG Reverse
DIO2 TGCGCTGTGTCTGGAACAG Forward
CTGGAATTGGGAGCATCTTCA Reverse
36B4 GAGGAATCAGATGAGGATATGGGA Forward
AAGCAGGCTGACTTGGTTGC Reverse
- 9 -
RESULTS
HIF1α is induced by beta adrenergic receptor stimulation in brown adipocytes.
In order to test the effect of cold exposure on HIF1α expression in brown and beige fat tissues, C57B6 WT mice were exposed to cold (4⁰C) for 1 week. Western blot analysis revealed that HIF1α was increased in brown adipose tissue (BAT) and inguinal adipose tissue (IAT) after cold exposure for 1 week (Figure. 1A). HIF2α was slightly increased in brown fat and increased more in inguinal adipose tissue (beige fat) (Figures.
2A and 2B). HIF1α mRNA expression was also increased on cold exposure (Figure. 1B).
Since cold exposure increases sympathetic stimulation in BAT, these results suggest that HIF1α may be able to function in brown fat when it is stimulated by sympathetic signals.
To test the expression of HIF1α upon β adrenergic stimulation, an immortalized brown adipose cell line (BAC) was cultured in vitro and differentiated into adipocytes.
Isoproterenol treatment for 3 and 6 hours significantly increased HIF1α expression compared with control group (Figure. 3A). On the other hand, HIF1α expression was not changed in 3T3-L1 adipocytes, a model of white adipocytes (Figure. 3B), suggesting that βAR stimulation can increase HIF1α expression only in brown adipocytes.
- 10 -
A
B
BAT (Brown adipose tissue)IAT (Inguinal adipose tissue)
- 11 -
Figure 1. HIF1α expression is elevated in brown and inguinal adipose tissue of cold exposed mice. (A) Protein level of HIF1α in brown and inguinal adipose tissue of thermo-neutral exposed (30⁰C) or cold exposed (4⁰C) mice. Whole cell lysate were extracted for western blot analysis. Actin was used as the loading control. (B) Relative mRNA level of HIF1α, HIF2α and thermogenic genes in BAT and IAT from 30⁰C exposed (n=3) or 4⁰C (n=5) exposed mice. Each mRNA level was normalized to 36B4 mRNA. Data represent the mean±SD. *P<0.05, **P<0.01, Student’s t-test.
- 12 -
A
B
Figure 2. HIF1α and HIF2α expression in BAT and IAT from time dependently cold exposed mice. Protein levels of HIF1α, HIF2α, UCP1 and Actin were detected in brown adipose tissue (A) and inguinal adipose tissue (B) after cold exposure (4 ⁰C) for indicated period time. Whole cell lysate were extracted for western blot analysis. Actin was used as the loading control.
BAT (Brown adipose tissue)
IAT (Inguinal adipose tissue)
- 13 -
A
B
Figure 3. HIF1α expression is increased in immortalized brown adipocytes but not in 3T3-L1 by β adrenergic stimulation. (A), (B) Protein level of HIF1α in immortalized brown adipose cell lines and 3T3-L1 treated with vehicle or 2 μM isoproterenol for 3 hours and 6 hours. Whole cell lysate were extracted for western blot analysis. Actin was used as the loading control.
- 14 -
Increased HIF1α expression by isoproterenol treatment is not due to increased UCP1 activity.
Previously, it was reported that increased oxygen consumption, as well as reduced oxygen supply, can lead to local hypoxia in white adipose tissue (Lee et al., 2014). Upon β adrenergic stimulation, UCP1 activation dissipates energy by decreasing proton gradient across the mitochondrial inner membrane and stimulating oxygen consumption without increasing ATP/ADP ratio. Therefore we hypothesized that increased oxygen consumption by β adrenergic receptor activation in brown adipocytes can cause increased HIF1α expression. Interestingly, UCP1 knock down did not change isoproterenol-induced expression level of HIF1α in brown adipocytes (Figure. 4A). In addition, when oxygen consumption is stimulated using a chemical uncoupler of oxidative phosphorylation, the carbonyl cyanide m-chlorophenylhydrazone (cccp), HIF1α expression was not changed (Figure. 4B). These findings suggest that accumulation of HIF1α in brown adipocytes upon β adrenergic receptor stimulation is not due to increased UCP1 activity.
HIF1α increases UCP1 expression upon β adrenergic stimulation.
HIF1α is a well-known transcriptional regulator of the enzymes involved in glucose metabolism (Denko, 2008). To test whether HIF1α could serve as a transcription factor for the expression of genes related to heat generation in brown fat, mature brown adipocytes were transfected by HIF1α siRNA or control siRNA and the expression of thermogenic genes was analyzed. Interestingly, the expression of UCP1 was reduced by
- 15 -
A
B
- 16 -
Figure 4. Accumulation of HIF1α is not mediated by UCP1. (A) Mature brown adipocytes were transfected with negative control siRNA (siNC) or UCP1 siRNA (siUCP1). After 48 hours, treated with isoproterenol for the indicated time periods. (B) DMSO (control), isoproterenol (β-adrenoreceptor agonist, 2 μM), cccp (mitochondrial uncoupler) and hypoxia (1 % O2) were treated to brown adipocytes for indicated time periods. Whole cell lysate were extracted for western blot analysis of using specific antibodies (HIF1α, UCP1 and Actin). Actin was used as the loading control.
- 17 -
HIF1α knockdown (Figures. 5A and 5B), without affecting the expression of DIO2 (Figure. 5B). Isoproterenol treatment also increased the expression of VEGFα, an angiogenic factor regulated by HIF1α, which was slightly decreased by HIF1α knockdown.
HIF1α protein stability is regulated by VHL(von Hippel–Lindau tumor suppressor) and PHD(proline hydroxylase), which are the enzymes involved in ubiquitination-dependent HIF1α degradation mechanism in normoxic conditions (West, 2017). To test the effect of HIF1α overexpression, brown adipocytes were transfected with siRNAs against VHL or PHDs and UCP1 protein and mRNA expression was measured. When VHL expression was reduced by specific siRNA, UCP1 protein level was significantly up-regulated along with increased HIF1α expression (Figure. 6A).
However, knockdown of either PHD 1, 2 or 3 did not affect the expression of both HIF1α and UCP1, probably due to compensation by other PHD isoforms. On the other hand, neither isoproterenol treatment nor VHL knockdown affected HIF2α expression (Figure. 6B). To test the effect of β adrenergic activation on VHL expression, I measured VHL mRNA expression in brown adipocytes treated with isoproterenol time dependently. As shown in Figure. 7, VHL expression was reduced by isoproterenol treatment. These results suggest that β adrenergic receptor stimulation may be able to increase HIF1α expression by suppressing VHL expression. To examine the effect of hypoxia on heat production in brown adipocytes, differentiated brown adipocytes were cultured in hypoxic conditions and thermogenic gene expression was measured. As shown in Figures. 8A and 8B, despite the induction of HIF1α by hypoxic conditions,
- 18 -
expression of thermogenic genes such as UCP1 was not increased.
- 19 -
A
B
- 20 -
Figure 5. Knockdown of HIF1α in brown adipocytes downregulated UCP1 expression. (A), (B) Mature brown adipocytes were transfected with negative control siRNA (siNC) or HIF1α siRNA (siHIF1α). After 48 hours, treated with or without isoproterenol (2μM) for 3 hours and then protein (A) and mRNA (B) were analyzed. (A) Whole cell lysate were extracted for western blot analysis of using specific antibodies (HIF1α, UCP1 and Actin). Actin was used as the loading control. (B) HIF1α, UCP1 and thermogenic genes mRNA levels were analyzed by quantitative RT-PCR. Data represent mean±SD for n = 3 in each group. *P < 0.05 and **P < 0.01, Student t test. mRNA expression levels were normalized to the level of 36B4 mRNA.
- 21 -
A
B
** **
- 22 -
Figure 6. Overexpression of HIF1α in brown adipocytes upregulated UCP1 expression. (A) Mature brown adipocytes were transfected with negative control siRNA (siNC), VHL, PHD1, 2 and3 siRNA for 48 hours. (B) Mature brown adipocytes were transfected with negative control siRNA (siNC) and VHL siRNA (siVHL) for 48 hours and treated with vehicle or isoproterenol (2 μM) for 3 hours. Relative gene expression was measured for VHL knockdown efficiency. Total RNA was harvested and analyzed by RT-qPCR. Data represent mean±SD for n = 3 in each group. *P < 0.05 and **P <
0.01, Student t test. mRNA expression levels were normalized to the level of 36B4 mRNA. (A), (B) Whole cell lysate were extracted for western blot analysis of using specific antibodies (HIF1α, HIF2α, UCP1 and Actin). Actin was used as the loading control.
- 23 -
Figure 7. VHL expression decreased in brown adipocytes by β adrenergic stimulation. Mature brown adipocytes were treated with isoproterenol for indicated time periods. Total RNA was harvested and analyzed by RT-qPCR. Relative gene expression was measured for VHL. Data represent mean±SD for n = 3 in each group. *P
< 0.05 and **P < 0.01, Student t test. mRNA expression levels were normalized to the level of 36B4 mRNA.
- 24 -
A
B
Figure 8. Expression of thermogenesis related genes is negatively affected by hypoxic condition. Western blot (A) and RT-qPCR (B) analysis for mature brown adipocytes following isoproterenol (2 μM) or hypoxic (1 % O2) treatment for 12 hours.
(A) Whole cell lysate were extracted for western blot analysis of using specific antibodies (HIF1α, UCP1 and Actin). Actin was used as the loading control. (B) Data represent mean±SD for n = 3 in each group. *P < 0.05 and **P < 0.01, Student t test.
mRNA expression levels were normalized to the level of 36B4 mRNA.
- 25 -
HIF2α expression increases during brown adipocytes differentiation but does not affect thermogenic gene expression in mature brown adipocytes.
It is reported that HIF2α deficiency exacerbates obesity-induced brown adipose tissue dysfunction and metabolic dysregulation (Garcia-Martin et al., 2015). However, it is not known how HIF2α regulates UCP1 expression in brown adipocytes. The thermogenic activity of brown fat tissue requires both thermogenic activation of mature adipocytes and adipogenic differentiation of pre-adipocytes into UCP1+ adipocytes (Bronnikov et al., 1992; Bukowiecki et al., 1982; Vishvanath et al., 2016). Therefore, we asked whether HIF2α is involved in the activation of brown adipocyte thermogenesis or brown adipogenesis. During brown adipocyte differentiation, the expression of HIF1α and HIF2α were differently changed. HIF2α was upregulated during brown adipogenesis whereas HIF1α was decreased in both mRNA and protein levels (Figures. 9A and 9B).
siRNA knockdown experiments demonstrated that knockdown of HIF2α does not affect isoproterenol-induced UCP1 expression (Figure. 10). These data suggest that HIF2α may be able to affect brown adipocyte differentiation, but does not affect directly thermogenic gene expression in mature brown adipocytes upon β-adrenergic stimulation.
- 26 -
A
B
Figure 9. HIF2α is increased but HIF1α is decreased during brown adipogenesis.
Protein (A) and relative mRNA levels (B) of HIF1α and HIF2α in brown adipocytes during differentiation (Day0, Day2, Day4). Relative mRNA level was analyzed by quantitative RT-PCR. Data represent mean±SD for n = 3 in each group. *P < 0.05 and
**P < 0.01, Student t test. mRNA expression levels were normalized to the level of 36B4 mRNA.
*
*
- 27 -
Figure 10. Knockdown of HIF2α does not affect isoproterenol-induced UCP1 expression. Mature brown adipocytes were transfected with negative control siRNA (siNC) or HIF2α siRNA (siHIF2α) for 48 hours. After that, treated with or without isoproterenol (2 μM) for 3 hours. Relative mRNA level of UCP1 were analyzed by quantitative RT-PCR. Data represent mean±SD for n = 3 in each group. *P < 0.05 and
**P < 0.01, Student t test. mRNA expression levels were normalized to the level of 36B4 mRNA.
- 28 -
Discussion
A negative correlation between BAT function and blood glucose concentrations has been published in human (Matsushita et al., 2014). Besides, the expression of glucose transporter and glycolytic enzyme is increased by β-adrenergic stimulation in brown adipocytes (Dallner et al., 2006; Olsen et al., 2014). In previous study, the transcription factor HIFα which regulates the expression of glycolysis related genes is also increased by norepinephrine stimulation in brown adipocytes (Basse et al., 2017;
Nikami et al., 2005). This means that it is possibility of functional role for BAT in glucose homeostasis, and BAT activation have been indicated to diminish insulin resistance (Chondronikola et al., 2014). Although utilization of glucose source is mediated in thermogenesis and HIFα is a transcription factor of glycolytic enzymes, it is not well understood the role of HIF1α and HIF2α in brown adipose tissue. In this study, I show that HIF1α is increased in brown adipocytes by β adrenergic receptor stimulation and this is necessary for cold-induced brown fat thermogenesis. VHL expression level was decreased by isoproterenol treatment in brown adipocytes, which can lead to upregulation of HIF1α expression. Knockdown of VHL, increased not only HIF1α expression, but also UCP1 expression. In addition, UCP1 mRNA and protein expression was decreased by HIF1α knockdown in brown adipocytes. Taken together, these results suggest that β-adrenergic stimulation can regulate UCP1 expression and heat production in brown adipocytes by decreasing VHL and increasing HIF1α.
Previously, it is reported that hypoxic conditions have a negative effect on heat
- 29 -
production in brown adipose tissue (Mortola and Naso, 1997; Schnakenberg and Hoffman, 1972). Consistently, in this study, I observed that thermogenic gene expression is reduced in brown fat cells when expose to hypoxia, although HIF1α was elevated (Figures 6A and 6B).
Although hypoxic condition lead to negative effect on brown adipocytes, hypoxia is detected by hypoxy probe staining in brown adipose tissue of cold exposure mice according to published paper. Hypoxy probe staining was reduced in UCP1 knock out mice (Xue et al., 2009). It is likely that uncoupling via UCP1 could leads to hypoxia.
However, angiogenesis is still active in UCP1 deleted mice upon cold exposure.
According to these data, it is possible that angiogenic factors were induced regardless of hypoxia. VEGFα is angiogenic factor and well known common target of HIF1α and HIF2α. VEGFα is closely related to thermogenic activity of brown adipose tissue (Elias et al., 2012; Fredriksson et al., 2000; Fredriksson et al., 2005; Xue et al., 2009).
However, it is controversial whether hypoxia mediates the increase in VEGFα or only HIF1α without hypoixa leads VEGFα expression when brown fat is stimulated. So, contribution of HIF1α to VEGFα expression need to be studied. In my data (Figure 4B), VEGFα is increased by isoproterenol treatment and decreased by HIF1α knockdown. It is suggest that HIF1α expression is involved in vascularization via VEGFα.
I observed no change in HIF1α level between control and UCP1 knockdown cells in response to β-adrenergic stimulation (Figure 3A). It has been reported to uncoupling is not related to glucose uptake in thermogenesis in BAT of UCP1 K.O mice (Hankir et al., 2017). It is indirectly suggested that uncoupling does not lead to HIF1α
- 30 -
expression. However, this observation is still a matter of discussion.
Hydroxylation of HIFα proteins by Factor Inhibiting HIF1α (FIH) blocks association of HIFs with the transcriptional co-activators CBP/p300, thus inhibiting transcriptional activation. Zhang et al., 2010 have created mice with a null mutation in the FIH gene, and found that it is an essential regulator of metabolism: mice lacking FIH exhibit reduced body weight, elevated metabolic rate, improved glucose and lipid homeostasis, and are resistant to high fat diet-induced weight gain. Especially, UCP1 expression is increased in FIH K.O mice. These data demonstrates that UCP1 expression is elevated when HIF1α is functionally active.
Different from HIF1α, HIF2α was not involved in β-adrenergic regulation of thermogenic genes (Figure 7C). Instead, HIF2α expression level was increased during brown adipocytes differentiation. Previously, it was reported that HIF1α expression decreases during adipocyte differentiation in 3T3-L1 cell line, and that both hypoxia and activation of HIF1α inhibit white adipocyte differentiation. (Lin et al., 2006; Yun et al., 2002). On the other hands, HIF2α level increases during 3T3-L1 adipogenic differentiation and HIF2α increases adipogenesis (Akeno et al., 2002; Shimba et al., 2004). Therefore, it is possible that HIF2α can modulate to brown fat formation by increasing brown fat differentiation.
It is reported that glucose tolerance is enhanced in response to increased HIF1α expression in adipose tissue (Matsuura et al., 2013). Other groups insisted that insulin sensitivity improves in adipocyte specific HIF1α K.O mice (Jiang et al., 2011; Krishnan et al., 2012; Regazzetti et al., 2009). The effect of HIF1α in adipose tissue on metabolic
- 31 -
disease is still controversial. My study is the first time for the role of HIF1α on isoproterenol induced UCP1 expression. If HIF1α have thermogenic effect on brown and beige fat, it could be positive effect on anti-obesity and diabetes therapy. Since HIF1α protein is unstable molecule; quickly accumulation and easily degradation, the function of HIF1α in vivo should be interpreted more delicately. Due to subtle difference of experimental conditions, it is possible that the experimental results will be opposite exactly. To verify the distinct function of HIF1α in adipocyte metabolism, additional studies are required.
In summary, HIF1α expression is increased by cold exposure in brown adipocytes and regulates UCP1 expression. HI2α is involved in brown adipogenesis. It is suggested that HIF1α and HIF2α might be a regulator of thermogenesis in brown adipose tissue (Figure 11).
- 32 -
Figure 11. A proposed model for the mechanisms of HIFα in brown adipose tissue.
When brown adipocytes are stimulated by cold exposure or beta adrenergic receptor agonist, HIF1α protein level is increased due to downregulation of VHL which is E3 ligase for proteasomal degradation of HIF1α. Once protein level of HIF1α is stabilized, its target genes such as VEGFα, GLUT1 and PDK1 are increased to accommodate heat generation. Moreover, HIF1α could regulate UCP1 expression. HIF2α is involved in brown adipogenesis. My study demonstrates that HIF1α and HIF2α are important for thermogenesis in brown adipose tissue.
- 33 -
Reference
Akeno, N., Robins, J., Zhang, M., Czyzyk-Krzeska, M.F., and Clemens, T.L. (2002).
Induction of vascular endothelial growth factor by IGF-I in osteoblast-like cells is mediated by the PI3K signaling pathway through the hypoxia-inducible factor-2alpha.
Endocrinology 143, 420-425.
Barbatelli, G., Murano, I., Madsen, L., Hao, Q., Jimenez, M., Kristiansen, K., Giacobino, J.P., De Matteis, R., and Cinti, S. (2010). The emergence of cold-induced brown adipocytes in mouse white fat depots is determined predominantly by white to brown adipocyte transdifferentiation. Am J Physiol Endocrinol Metab 298, E1244-1253.
Basse, A.L., Isidor, M.S., Winther, S., Skjoldborg, N.B., Murholm, M., Andersen, E.S., Pedersen, S.B., Wolfrum, C., Quistorff, B., and Hansen, J.B. (2017). Regulation of glycolysis in brown adipocytes by HIF-1alpha. Sci Rep 7, 4052.
Bronnikov, G., Houstek, J., and Nedergaard, J. (1992). Beta-adrenergic, cAMP-mediated stimulation of proliferation of brown fat cells in primary culture. Mediation via beta 1 but not via beta 3 adrenoceptors. J Biol Chem 267, 2006-2013.
Bukowiecki, L., Collet, A.J., Follea, N., Guay, G., and Jahjah, L. (1982). Brown adipose tissue hyperplasia: a fundamental mechanism of adaptation to cold and hyperphagia. Am J Physiol 242, E353-359.
Cannon, B., and Nedergaard, J. (2004). Brown adipose tissue: function and physiological significance. Physiol Rev 84, 277-359.
Chondronikola, M., Volpi, E., Borsheim, E., Porter, C., Annamalai, P., Enerback, S.,
- 34 -
Lidell, M.E., Saraf, M.K., Labbe, S.M., Hurren, N.M., et al. (2014). Brown adipose tissue improves whole-body glucose homeostasis and insulin sensitivity in humans.
Diabetes 63, 4089-4099.
Dallner, O.S., Chernogubova, E., Brolinson, K.A., and Bengtsson, T. (2006). Beta3- adrenergic receptors stimulate glucose uptake in brown adipocytes by two mechanisms independently of glucose transporter 4 translocation. Endocrinology 147, 5730-5739.
Denko, N.C. (2008). Hypoxia, HIF1 and glucose metabolism in the solid tumour. Nat Rev Cancer 8, 705-713.
Elias, I., Franckhauser, S., Ferre, T., Vila, L., Tafuro, S., Munoz, S., Roca, C., Ramos, D., Pujol, A., Riu, E., et al. (2012). Adipose tissue overexpression of vascular endothelial growth factor protects against diet-induced obesity and insulin resistance. Diabetes 61, 1801-1813.
Fedorenko, A., Lishko, P.V., and Kirichok, Y. (2012). Mechanism of fatty-acid- dependent UCP1 uncoupling in brown fat mitochondria. Cell 151, 400-413.
Fredriksson, J.M., Lindquist, J.M., Bronnikov, G.E., and Nedergaard, J. (2000).
Norepinephrine induces vascular endothelial growth factor gene expression in brown adipocytes through a beta -adrenoreceptor/cAMP/protein kinase A pathway involving Src but independently of Erk1/2. J Biol Chem 275, 13802-13811.
Fredriksson, J.M., Nikami, H., and Nedergaard, J. (2005). Cold-induced expression of the VEGF gene in brown adipose tissue is independent of thermogenic oxygen consumption. FEBS Lett 579, 5680-5684.
Fujisaka, S., Usui, I., Ikutani, M., Aminuddin, A., Takikawa, A., Tsuneyama, K.,
- 35 -
Mahmood, A., Goda, N., Nagai, Y., Takatsu, K., et al. (2013). Adipose tissue hypoxia induces inflammatory M1 polarity of macrophages in an HIF-1alpha-dependent and HIF-1alpha-independent manner in obese mice. Diabetologia 56, 1403-1412.
Garcia-Martin, R., Alexaki, V.I., Qin, N., Rubin de Celis, M.F., Economopoulou, M., Ziogas, A., Gercken, B., Kotlabova, K., Phieler, J., Ehrhart-Bornstein, M., et al. (2015).
Adipocyte-Specific Hypoxia-Inducible Factor 2alpha Deficiency Exacerbates Obesity- Induced Brown Adipose Tissue Dysfunction and Metabolic Dysregulation. Mol Cell Biol 36, 376-393.
Halberg, N., Khan, T., Trujillo, M.E., Wernstedt-Asterholm, I., Attie, A.D., Sherwani, S., Wang, Z.V., Landskroner-Eiger, S., Dineen, S., Magalang, U.J., et al. (2009). Hypoxia- inducible factor 1alpha induces fibrosis and insulin resistance in white adipose tissue.
Mol Cell Biol 29, 4467-4483.
Hankir, M.K., Kranz, M., Keipert, S., Weiner, J., Andreasen, S.G., Kern, M., Patt, M., Kloting, N., Heiker, J.T., Brust, P., et al. (2017). Dissociation Between Brown Adipose Tissue 18F-FDG Uptake and Thermogenesis in Uncoupling Protein 1-Deficient Mice. J Nucl Med 58, 1100-1103.
Jiang, C., Qu, A., Matsubara, T., Chanturiya, T., Jou, W., Gavrilova, O., Shah, Y.M., and Gonzalez, F.J. (2011). Disruption of hypoxia-inducible factor 1 in adipocytes improves insulin sensitivity and decreases adiposity in high-fat diet-fed mice. Diabetes 60, 2484- 2495.
Krishnan, J., Danzer, C., Simka, T., Ukropec, J., Walter, K.M., Kumpf, S., Mirtschink, P., Ukropcova, B., Gasperikova, D., Pedrazzini, T., et al. (2012). Dietary obesity-associated
- 36 -
Hif1alpha activation in adipocytes restricts fatty acid oxidation and energy expenditure via suppression of the Sirt2-NAD+ system. Genes Dev 26, 259-270.
Lee, Y.S., Kim, J.W., Osborne, O., Oh, D.Y., Sasik, R., Schenk, S., Chen, A., Chung, H., Murphy, A., Watkins, S.M., et al. (2014). Increased adipocyte O2 consumption triggers HIF-1alpha, causing inflammation and insulin resistance in obesity. Cell 157, 1339-1352.
Lin, Q., Lee, Y.J., and Yun, Z. (2006). Differentiation arrest by hypoxia. J Biol Chem 281, 30678-30683.
Matsushita, M., Yoneshiro, T., Aita, S., Kameya, T., Sugie, H., and Saito, M. (2014).
Impact of brown adipose tissue on body fatness and glucose metabolism in healthy humans. Int J Obes (Lond) 38, 812-817.
Matsuura, H., Ichiki, T., Inoue, E., Nomura, M., Miyazaki, R., Hashimoto, T., Ikeda, J., Takayanagi, R., Fong, G.H., and Sunagawa, K. (2013). Prolyl hydroxylase domain protein 2 plays a critical role in diet-induced obesity and glucose intolerance.
Circulation 127, 2078-2087.
Mortola, J.P., and Naso, L. (1997). Brown adipose tissue and its uncoupling protein in chronically hypoxic rats. Clin Sci (Lond) 93, 349-354.
Nikami, H., Nedergaard, J., and Fredriksson, J.M. (2005). Norepinephrine but not hypoxia stimulates HIF-1alpha gene expression in brown adipocytes. Biochem Biophys Res Commun 337, 121-126.
Olsen, J.M., Sato, M., Dallner, O.S., Sandstrom, A.L., Pisani, D.F., Chambard, J.C., Amri, E.Z., Hutchinson, D.S., and Bengtsson, T. (2014). Glucose uptake in brown fat cells is dependent on mTOR complex 2-promoted GLUT1 translocation. J Cell Biol 207,
- 37 - 365-374.
Pace, L., Nicolai, E., D'Amico, D., Ibello, F., Della Morte, A.M., Salvatore, B., Pizzuti, L.M., Salvatore, M., and Soricelli, A. (2011). Determinants of physiologic 18F-FDG uptake in brown adipose tissue in sequential PET/CT examinations. Mol Imaging Biol 13, 1029-1035.
Regazzetti, C., Peraldi, P., Gremeaux, T., Najem-Lendom, R., Ben-Sahra, I., Cormont, M., Bost, F., Le Marchand-Brustel, Y., Tanti, J.F., and Giorgetti-Peraldi, S. (2009).
Hypoxia decreases insulin signaling pathways in adipocytes. Diabetes 58, 95-103.
Schnakenberg, D.D., and Hoffman, R.A. (1972). Hypoxic inactivation of cold-induced brown fat thermogenesis. Experientia 28, 1172-1173.
Shimba, S., Wada, T., Hara, S., and Tezuka, M. (2004). EPAS1 promotes adipose differentiation in 3T3-L1 cells. J Biol Chem 279, 40946-40953.
Vishvanath, L., MacPherson, K.A., Hepler, C., Wang, Q.A., Shao, M., Spurgin, S.B., Wang, M.Y., Kusminski, C.M., Morley, T.S., and Gupta, R.K. (2016). Pdgfrbeta+ Mural Preadipocytes Contribute to Adipocyte Hyperplasia Induced by High-Fat-Diet Feeding and Prolonged Cold Exposure in Adult Mice. Cell Metab 23, 350-359.
Vitali, A., Murano, I., Zingaretti, M.C., Frontini, A., Ricquier, D., and Cinti, S. (2012).
The adipose organ of obesity-prone C57BL/6J mice is composed of mixed white and brown adipocytes. J Lipid Res 53, 619-629.
Wang, Q.A., Tao, C., Gupta, R.K., and Scherer, P.E. (2013). Tracking adipogenesis during white adipose tissue development, expansion and regeneration. Nat Med 19, 1338-1344.
- 38 -
Wang, X., Minze, L.J., and Shi, Z.Z. (2012). Functional imaging of brown fat in mice with 18F-FDG micro-PET/CT. J Vis Exp.
West, J.B. (2017). Physiological Effects of Chronic Hypoxia. N Engl J Med 376, 1965- 1971.
Xue, Y., Petrovic, N., Cao, R., Larsson, O., Lim, S., Chen, S., Feldmann, H.M., Liang, Z., Zhu, Z., Nedergaard, J., et al. (2009). Hypoxia-independent angiogenesis in adipose tissues during cold acclimation. Cell Metab 9, 99-109.
Yun, Z., Maecker, H.L., Johnson, R.S., and Giaccia, A.J. (2002). Inhibition of PPAR gamma 2 gene expression by the HIF-1-regulated gene DEC1/Stra13: a mechanism for regulation of adipogenesis by hypoxia. Dev Cell 2, 331-341.
Zhang, N., Fu, Z., Linke, S., Chicher, J., Gorman, J.J., Visk, D., Haddad, G.G., Poellinger, L., Peet, D.J., Powell, F., et al. (2010). The asparaginyl hydroxylase factor inhibiting HIF-1alpha is an essential regulator of metabolism. Cell Metab 11, 364-378.
- 39 -
국문 초록
HIF 전사인자가 갈색지방에서 열생산에 미치는 영향
최 원 근
체내의 에너지 섭취와 소비의 불균형은 비만을 유발하는 중요한 원인이다. 갈색 지방은 열 생산을 통해 에너지를 소비 하는 중요한 기관이다.
Hypoxia-inducible factor (HIF) 포도당 수송체 및 당 분해 효소의 발현을 조절하는데, 갈색 지방에서 HIF의 역할은 잘 연구 되지 않았다.
HIF는 대표적으로 HIF1α와 HIF2α, 두 가지 동형 단백질을 가지고 있다.
본 연구에서는 추위 유발성 열생산에 있어서 HIF1α가 어떤 역할을 하는지 조사하였다. 추위에 노출 시킨 쥐의 갈색지방에서 HIF1α 의 발현량이 증가하였고, 베타 아드레날린 수용체의 길항제를 갈색지방 세포 주에 처리 시에도 Hif1α의 발현이 증가 하였다. HIF1α를 knockdown 후 아이소프로테레놀을 처리 했을 때는 UCP1 발현이 비교군에 비해 감소했다.
- 40 -
반면 HIF2α는 갈색지방세포가 분화되는 동안 발현이 증가 하였다. 이러한 결과를 통해 HIF1α와 HIF2α가 서로 다르게 갈색지방조직의 형성에 영향을 미침으로서 적응적열생산을 조절 한다는 것을 제시해 주고 있다.
주요어: HIF1α, HIF2α, 갈색지방조직, 열생산, UCP1 학 번: 2012-23072
