Genetic Diversity of Philippine Native Pigs (Sus scrofa L.) from Quezon and Marinduque Based on Morphological and Microsatellite Markers
Dan Joseph C. Logronio1, Rick Julius D. Cruz2,
Genevieve Mae B. Aquino-Ang3, Renato S.A. Vega2, Ma. Carmina C. Manuel1, Celia B. de la Viña1, Elpidio B. Basilio Jr.4, Yu Ten Ju5,and Rita P. Laude1*
1Institute of Biological Sciences, College of Arts and Sciences, University of the Philippines Los Baños, Los Baños, Laguna 4031 Philippines
2Institute of Animal Science, College of Agriculture and Food Science, University of the Philippines Los Baños, Los Baños, Laguna 4031 Philippines
3Philippine Genome Center–Agriculture,
Office of the Vice-Chancellor for Research and Extension,
University of the Philippines Los Baños, Los Baños, Laguna 4031 Philippines
4College of Agriculture and Home Science, Ifugao State University, Lamut, Ifugao 3605 Philippines
5Department of Animal Science and Technology, National Taiwan University, Taipei City 10617 Taiwan
Nine microsatellite markers recommended by the Food and Agriculture Organization were used to measure the genetic diversity of Quezon and Marinduque native pig populations – with a total of 37 and 40 individuals, respectively. All markers were discovered to be polymorphic, with a mean number of alleles per locus of 10. Marinduque native pigs were found to have a mean effective number of alleles (EA), mean observed heterozygosity (HO), mean expected heterozygosity (HE), and mean polymorphic information content (PIC) of 5.005 ± 0.547, 0.673
± 0.040, 0.780 ± 0.024, and 0.76 ± 0.03, respectively. By contrast, Quezon native pigs had mean EA, mean HO, mean HE, and mean PIC values of 5.280 ± 0.787, 0.634 ± 0.044, 0.773 ± 0.035, and 0.75 ± 0.04, respectively. Between the two populations, the heterozygosity (HE > HO) and positive values of FIS (0.1714) and FIT (0.1868) indicated a low number of heterozygotes, suggesting the possibility of inbreeding. The test of Hardy-Weinberg equilibrium (HWE) showed that three loci each in the Quezon and Marinduque native pig populations deviated from HWE.
Although morphological analysis revealed significant differences in snout shape, head profile, ear type, and all morphometric traits, a low level of genetic differentiation between the two populations was observed (FST = 0.0186; Nei genetic distance = 0.130; Nei unbiased genetic distance = 0.082). Overall, these findings imply that further studies on the genetic improvement and conservation of Philippine native pigs are required for the development of signature pig breeds across the country.
Keywords: genetic diversity, microsatellite markers, morphology, Philippine native pig
*Corresponding author: ritalaude50@gmail.com
ISSN 0031 - 7683
Date Received: 01 Dec 2021
INTRODUCTION
There are six developed genetic groups of Philippine native pigs – namely Q-Black (Quezon), Markaduke (Marinduque), Sinirangan (Eastern Samar), ISUbela (Isabela), Benguet (Benguet), and Yookah (Kalinga). All animals under these groups have a straight hair type, a plain black coat, and smooth skin. However, Yookah has the unique characteristic of having a black coat with white socks. Q-Black and Markaduke pigs are generally the heaviest, which range between 30–40 kg, and are usually weaned at 42–45 d (DOST-PCAARRD 2022). Other varieties, such as Ilocos and Jalajala, were also reported (Oklahoma State University 2000). Several exotic pig breeds are also available and can be raised within the country – including Landrace, Large White, Pietrain, Duroc, and Hampshire (Taculao 2020). Native pigs provide an important source of livelihood to small-scale farmers due to their low investment requirements. Although economic benefits are derived from raising native pigs, there are several challenges involved, such as the scarcity of genetic information and the presence of potential threats to genetic resources (FAO 2003). Genetic studies on Philippine native pigs are generally reported based on morphological characteristics, karyotypes (Navarra et al. 1997), blood serum protein polymorphisms (Francisco 1992; Navarra et al. 1997), amplified fragment length polymorphism (Sookmanee 1998), mitochondrial DNA (Bondoc et al.
2013), and microsatellite markers (Cho et al. 2014).
Aside from generating additional genetic resources for Philippine native animals, this study was conducted to determine the status of genetic diversity within and between populations of Quezon and Marinduque native pigs using morphological characterization and microsatellite loci analysis. Nine microsatellite markers recommended by the International Society of Animal Genetics–Food and Agriculture Organization of the United Nations (ISAG- FAO) for the measurement of domestic animal diversity (MoDAD) (FAO 2004) were used to investigate the genetic relationships between Quezon native pigs, Marinduque native pigs, and Taiwan native pig breeds – namely, Lanyu and Lee-Sung – based on genetic distance, genetic identity, and dendrogram structure analysis. The obtained morphological and genetic data may contribute to future research on the genetic improvement and conservation of Philippine native pigs.
MATERIALS AND METHODS
Morphological Characterization
A total of 37 and 40 native pigs from the different municipalities of Quezon and Marinduque provinces,
respectively, were included in this study (Figure 1). The information obtained were classified into morphometric and qualitative data. For morphometric traits, a textile measuring tape was used for the linear measurements of body length, head length, tail length, ear length, chest girth, and height at withers, following the checklist for the phenotyping of pigs (FAO 2012). Backfat thickness was measured using Renco LEAN-MEATER® (Renco Corporation, Golden Valley, MN, USA). The data on qualitative traits – including snout shape, coat color pattern, coat color type, head profile, ear type, and backline – were also gathered and properly recorded.
Furthermore, native pigs with head lengths ≥ 30 cm were considered to have long snouts. Images of the animals used in this study were taken using a digital photo camera.
Sample Collection and Genomic DNA Isolation Tissue samples were collected from the outer ear of the pig, specifically in the helix or prominent rim of the auricle, using a wedge V-cut ear notching pliers. The obtained ear tissue was transferred to a 1.5-mL microcentrifuge tube containing absolute ethanol, which was replaced before the tissue samples were stored in a –20 °C freezer. The exposed wounds on the pigs were treated using a 10% povidone- iodine antiseptic solution (Betadine®, Mundipharma Distribution GmbH, Taguig, Philippines). All experimental protocols involving the care and use of vertebrate animals were approved by the Institutional Animal Care and Use Committee of the College of Veterinary Medicine, University of the Philippines Los Baños under Protocol No.
2014-62, Category 1 (Procedures of Moderate Severity).
Genomic DNA was extracted using SolgTM Genomic DNA Prep Kit, Solution Type (SolGent, Daejeon, South Korea), following the manufacturer’s protocol. The extracted DNA was reconstituted with a 50-µL DNA hydration solution and stored at a –80 °C freezer for subsequent analysis. The integrity, purity, and quantity of the genomic DNA were determined using 1% agarose gel electrophoresis and UV-visible spectrophotometry.
PCR Amplification and Genotyping of Microsatellite Loci
The primers used for genomic DNA amplification were end-labeled with FAM, TAMRA, or HEX fluorescent dye (Table 1). The microsatellite repeats in the genome were amplified using 15-μL reactions containing 100-ng genomic DNA, 1.5-μL 10× PCR buffer, 1.5-μL 8 mM dNTP, 0.3-µM sense and antisense primers, and 0.15-units Blend Taq polymerase (TaKaRa, Tokyo, Japan). The PCR assay was performed using Veriti® Thermal Cycler (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA), with the following thermal cycling conditions:
initial denaturation at 94 °C for 5 min; 39 cycles at 94 °C
Figure 1. A map showing the sample collection sites of the Philippine native pigs from Quezon and Marinduque provinces.
for 30 s, 53 to 59 °C for 30 s (depending on the locus), and 72 °C for 45 s; and final extension at 72 °C for 10 min.
The fluorescent end-labeled PCR products were detected via capillary electrophoresis (Wang et al. 2009) using MegaBACE 1000 DNA sequencer (Amersham Biosciences, Piscataway, NJ, USA). The fluorescent- labeled marker GeneScan 500 (Applied Biosystems) was used as an internal size standard for length calibration. Allele sizes were determined using Genetic-
Profiler version 2.2 software (Amersham Biosciences).
To guarantee the exemption of any bias from the electrophoresis of each analyzed plate, control samples were selected from all runs.
Morphological and Molecular Characterization The significant differences in the morphometric and qualitative traits between the two Philippine native pig populations were determined via t-test and Mann-Whitney
U test, respectively, using SPSS Statistics 22.0 (IBM SPSS, Armonk, NY, USA). All hypothesis testing was performed at α = 0.05.
To analyze the genetic variation within population, microsatellite data were first checked for the presence of null alleles, scoring errors, and large allele dropout using MICRO-CHECKER (van Oosterhout et al. 2004).
The frequencies of the null alleles per microsatellite loci were computed following the methods of Chakraborty et al. (1992), Brookfield (1996), and van Oosterhout et al. (2004). Loci with null allele frequencies < 0.2 were retained because these levels have been demonstrated to have minimal impact on population delineation and fixation index (FST) estimates (Dakin and Avise 2004; Carlsson 2008). The allele frequencies, genotype frequencies, observed number of alleles, effective number of alleles, observed heterozygosity (HO), expected heterozygosity (HE), genetic identity, genetic distance, and analysis of molecular variance (AMOVA) were computed using GenAlEx (Peakall and Smouse 2006, 2012). Furthermore, the polymorphic information content (PIC) values were determined using CERVUS Version
3.0.7 software (Marshall et al. 1998; Kalinowski et al.
2007). The microsatellite loci that deviated from Hardy- Weinberg equilibrium (HWE) were also identified using Genepop Version 4.4.3 software (Rousset 2008), following the Markov chain method (Guo and Thompson 1992).
The genetic diversity and relationships between populations were assessed by computing the F statistics (Weir and Cockerham 1984) using Genepop Version 4.4.3 software (Rousset 2008). POPULATIONS (Langella 2002) was used to measure the genetic distances among individual pigs and to construct a phylogenetic tree based on the unweighted pair group method with arithmetic mean (UPGMA). The tree was viewed and edited using FigTree Version 1.4.4 software (Rambaut 2018). Additional editing and labeling of the phylogenetic tree were performed using Microsoft® Paint (Microsoft Corporation, Redmond, WA, USA). For phylogenetic analysis involving populations, POPTREE2 software (Takezaki et al. 2010) was used to compute the DA (Nei et al. 1983) genetic distances based on the neighbor-joining (NJ) method and UPGMA.
Bootstrap analysis was performed using 1,000 replicates to generate the final consensus tree. All phylogenetic
Table 1. Characteristics of the nine microsatellite markers, as recommended by ISAG-FAO (FAO 2004) for the Measurement of Domestic Animal Diversity (MoDAD), used for the analysis of Philippine native pigs (Sus scrofa L.) from Quezon and Marinduque provinces.
Name Sequence of primers (5'–3')a Size (bp)
Repeat motif Referenceb
Min Max
SW911 F: CTCAGTTCTTTGGGACTGAACC
153 177 (GT:CA)n 1
R: CATCTGTGGAAAAAAAAAGCC IGF1 F: GCTTGGATGGACCATGTTG
197 209 (CA)n 2
R: CATATTTTTCTGCATAACTTGAACCT S0355 F: TCTGGCTCCTACACTCCTTCTTGATG
243 277 (AC)19 3
R: TTGGGTGGGTGCTGAAAAATAGGA S0225 F: GCTAATGCCAGAGAAATGCAGA
170 196 (AC)15 3
R: CAGGTGGAAAGAATGGAATGAA S0218 F: GTGTAGGCTGGCGGTTGT
164 184 (CA)21 3
R: CCCTGAAACCTAAAGCAAAG S0226 F: GCACTTTTAACTTTCATGATACTCC
181 205 (CA)4TA(CA)4TG(CA)19 3 R: GGTTAAACTTTTNCCCCAATACA
SW951 F: TTTCACAACTCTGGCACCAG
125 133 (GT:CA)n 1
R: GATCGTGCCCAAATGGAC S0005
F: TCCTTCCCTCCTGGTAACTA
205 248 (AC)29 4
R: GCACTTCCTGATTCTGGGTA SW857 F: AGAAATTAGTGCCTCAAATTGG
144 160 (GT:CA)n 1; 5
R: AAACCATTAAGTCCCTAGCAAA
a[F] forward primer; [R] reverse primer
b[1] Rohrer and Alexander (1994); [2] Estany et al. (2007); [3] Robic and Dalens (1994); [4] Fredholm and Wintero (1993); [5] FAO (2004).
analyses were performed using six microsatellite loci – namely, SW911, IGF1, S0225, SW951, SW857, and S0218. The microsatellite genotypes of the Taiwan native pig breeds Lanyu and Lee-Sung were obtained from the study of Li et al. (2014).
RESULTS
Morphological Characterization
The predominant coat color of Quezon and Marinduque native pigs was black, which accounted for 94.4 and 68.4%
of the population, respectively (Table 2). The majority of the Quezon and Marinduque native pigs had short
and cylindrical (55.6%) plus short and pointed (76.3%) snouts, respectively. Other variants of snout shape were also observed among Quezon native pigs, such as long and thin (33.3%) and short and pointed (11.1%). Straight (55.6%) and concave (44.4%) head profiles were mainly observed in the native pig population from Quezon.
However, almost all Marinduque native pigs surveyed in this study had a straight head profile (97.4%). More than half of native pigs in Quezon and Marinduque had lop (77.8%) and erect (63.2%) ear types, respectively. All native pigs from Quezon and Marinduque had a straight backline. Figure 2 shows the representative photographs of Quezon and Marinduque native pigs emphasizing the morphological features observed in this study.
The Mann-Whitney U test results revealed that the two
Table 2. Frequency of various qualitative traits in Quezon and Marinduque native pigs.
Qualitative traits
Quezon Marinduque
Frequency
(n = 36) % Frequency
(n = 38) %
Coat color
Black 34 94.4 26 68.4
Brown 0 0 1 2.6
Brown with black spots 1 2.8 0 0
Black with brown patches 1 2.8 0 0
Black with white marks
on foreheads and/or legs 0 0 11 28.9
Coat color pattern
Plain 34 94.4 36 94.7
Patchy 1 2.8 2 5.3
Spotted 1 2.8 0 0
Snout shape
Short and pointed 4 11.1 29 76.3
Short and cylindrical 20 55.6 9 23.7
Long and thin 12 33.3 0 0
Head profile
Concave 16 44.4 1 2.6
Straight 20 55.6 37 97.4
Convex 0 0 0 0
Ear type
Erect 1 2.8 24 63.2
Semi-lop 6 16.7 7 18.4
Lop 28 77.8 4 10.5
Droopy 1 2.8 3 7.9
Backline
Straight 36 100.00 38 100.00
Swaybacked 0 0.00 0 0.00
native pig populations possessed significantly different snout shapes, head profiles, and ear types (P < 0.05).
However, no significant difference was observed in the coat color type and pattern (Table 2). The morphometric traits – including body length, head length, tail length, ear length, chest girth, height at withers, and backfat thickness – were also significantly different between the two populations (P < 0.05) (Table 3).
Intrapopulation Genetic Diversity
The nine microsatellite markers used in this study were all polymorphic, as evidenced by the number of alleles detected, and showed considerable variation in both Quezon and Marinduque native pig populations (Table 4). A total of 106 different alleles in the nine loci were detected in 77 native pigs from Quezon and Marinduque. Representative pictures of the electropherogram showing allele peaks for selected loci based on capillary electrophoresis data were
presented in Figure 3. In particular, Quezon native pigs had 95 different alleles, with an average of 10.556 ± 1.094 alleles. Notably – except for locus SW951 with five alleles – eight loci exhibited a high number of alleles, ranging from eight alleles per locus to 16 alleles per locus. A total of 85 different alleles were detected in Marinduque native pigs, with an average of 9.444 ± 0.801 alleles. Excluding loci SW951 with only seven alleles, the remaining eight loci were observed to have a high number of alleles, ranging from eight alleles per locus to 15 alleles per locus. The mean effective number of alleles in all populations was 5.142 ± 0.466, with a range of 2.419–9.856. In addition, the effective number of alleles in Quezon native pigs ranged from 2.419–9.856, with an average of 5.280 ± 0.787, whereas those in Marinduque native pigs varied from 2.885–7.682, with an average of 5.005 ± 0.547.
In all populations, the mean HO was 0.654 ± 0.029, with a range of 0.351–0.846. In Quezon native pigs, the mean
Figure 2. Plain and black coat as the predominant coat color and pattern among Philippine native pigs in [A] Quezon and [B] Marinduque. Variants of snout shape and ear type among native pigs in Quezon: [C] a boar with short and cylindrical snout and lop ear and [D] a sow with long and cylindrical snout and lop ear. [E and F] Marinduque native pigs with their characteristic short and pointed snouts and erect ears.
Table 3. Descriptive statistics of each quantitative trait in Quezon and Marinduque native pigs.
Quantitative traits
Quezon Marinduque
Mean*
(SD) CV
(%) Mean*
(SD) CV
(%)
Body length (cm) 91.67a
26.93 61.71b
17.23
(24.688) (10.631)
Body height (cm) 54.56a
26.34 38.34b
22.72
(14.371) (8.709)
Head length (cm) 27.08a
21.56 21.24b
14.83
(5.838) (3.149)
Heart girth (cm) 84.94a
31.49 60.11b
16.84
(26.746) (10.123)
Hock circumference (cm) 14.47a
18.94 11.32b
15.25
(2.741) (1.726)
Tail length (cm) 25.75a
28.21 18.50b
23.16
(7.264) (4.285)
Ear length (cm) 15.11a
27.57 11.20b
19.18
(4.166) (2.148)
Pelvic length (cm) 18.66a
24.36 14.97b
19.05
(4.546) (2.852)
Backfat thickness (mm) 9.41a
52.09 6.15b
49.11
(4.902) (3.02)
*In row, means with different letter superscripts (a, b) are different (P < 0.05).
Table 4. Measures of genetic diversity between the Quezon and Marinduque native pig populations based on nine microsatellite markers.
Locus
Quezon Marinduque
Na NAb ENAc HOd HEe PICf HWEg
test N NA ENA HO HE PIC HWE
test
SW911 37 10 5.599 0.676 0.821 0.800 NS 40 10 4.762 0.725 0.790 0.764 *
IGF1 35 9 3.311 0.629 0.698 0.677 NS 40 8 2.885 0.650 0.653 0.625 NS
S0355 36 12 5.423 0.583 0.816 0.797 * 40 8 4.188 0.650 0.761 0.729 NS
S0225 35 8 2.941 0.629 0.660 0.632 NS 39 9 4.946 0.615 0.798 0.773 NS
S0218 37 9 4.271 0.568 0.766 0.743 * 40 8 5.536 0.575 0.819 0.798 *
S0226 35 13 6.712 0.800 0.851 0.835 NS 39 11 7.682 0.846 0.870 0.857 NS
SW951 37 5 2.419 0.351 0.587 0.526 *** 40 7 4.438 0.475 0.775 0.740 ***
S0005 36 16 9.856 0.778 0.899 0.890 NS 39 15 7.348 0.846 0.864 0.851 NS
SW857 36 13 6.987 0.694 0.857 0.841 NS 40 9 3.259 0.675 0.693 0.668 NS
Mean 36 10.556 5.280 0.634 0.773 0.75 39.667 9.444 5.005 0.673 0.780 0.76 SE 0.289 1.094 0.787 0.044 0.035 0.04 0.167 0.801 0.547 0.040 0.024 0.03
aNumber of samples bObserved number of alleles cEffective number of alleles dObserved heterozygosity eExpected heterozygosity fPolymorphic information content
gHardy-Weinberg equilibrium (HWE); *P < 0.05; **P < 0.01;***P < 0.001; [NS] not significant
Figure 3. Electropherogram showing the representative allele peaks for microsatellite loci SW951, S0218, S0226, and S0355 of Marinduque native pigs.
HO was 0.634 ± 0.044, with a range of 0.351–0.800, whereas in Marinduque native pigs, the mean HO was 0.673 ± 0.040, with a range of 0.475–0.846. In addition, all populations had a mean HE of 0.777 ± 0.020, which ranged from 0.587–0.899. Specifically, the mean HE in Quezon native pigs was 0.773 ± 0.035, with a range of 0.587–0.899, whereas the mean HE in Marinduque native pigs was 0.780 ± 0.024, with a range of 0.653–0.870.
The mean PIC in all populations was 0.77 ± 0.03, which ranged from 0.656 (IGF1) to 0.877 (S0005). Specifically, Quezon native pigs had a mean PIC of 0.75 ± 0.04, varying from 0.526–0.890, whereas Marinduque native pigs had a mean PIC of 0.76 ± 0.03, ranging from 0.625–0.857.
Among Quezon native pigs, six loci (SW911, S0355, S0218, S0226, S0005, SW857) were considered highly informative markers, with PIC values ranging from 0.743–
0.890. By contrast, seven loci (SW911, S0355, S0218, S0226, S0005, SW951, S0225) in the Marinduque native pigs were considered highly informative markers, with PIC values varying from 0.729–0.857. In both populations, seven loci were found to be highly informative – namely, SW911, S0355, S0218, S0226, S0005, SW857, and S0225 – with PIC values ranging from 0.722–0.877.
The HWE test revealed that among the Quezon native pigs,
three out of nine loci deviated from HWE (Table 4). Three loci – specifically, SW951 (P < 0.001), S0355 (P < 0.005), and S0218 (P < 0.005) – showed highly significant deviation from HWE. Likewise, among the Marinduque native pigs, three loci deviated from HWE, including SW951 (P < 0.001), SW911 (P < 0.005), and S0218 (P < 0.005). Specifically, locus SW951 showed a highly significant deviation from HWE (P < 0.001), whereas loci SW911 and S0218 showed a significant deviation at the 0.05 level.
Interpopulation Genetic Diversity
In all populations, the inbreeding coefficient (FIS) and overall inbreeding coefficient of an individual relative to the total population (FIT) were 0.1714 and 0.1868, respectively. The FIT value indicates that the entire population had 18.68% fewer heterozygotes. As another measure of population substructure, FST was detected to be 0.0186, suggesting that approximately 1.86% of the total genetic variation may be attributed to the differences between populations, whereas 98.14% was caused by the differences among individuals within a population. This value also represents the small genetic differentiation between populations. The AMOVA results for Quezon, Marinduque, and Taiwan native pigs (Lanyu and Lee- Sung) indicated that the majority of genetic variation occurred within individuals (62%), whereas 4 and 17%
Table 5. Analysis of molecular variance (AMOVA) among Quezon, Marinduque, and Taiwan (Lanyu and Lee-Sung) native pigs based on six microsatellite markers – namely, SW911, IGF1, S0225, SW951, SW857, and S0218.
Source of variation df SS MS Estimated variance %
Among regions 2 84.44 42.22 0.11 4
Among populations 1 23.64 23.64 0.44 17
Among individuals 123 296.36 2.41 0.42 16
Within individuals 127 199.50 1.57 1.57 62
Total 253 603.94 – 2.54 100
may be attributed among regions and populations, respectively (Table 5).
Nei’s genetic identity and genetic distance values between Quezon and Marinduque native pigs were 0.879 and 0.129, respectively. By contrast, Nei’s unbiased genetic identity and genetic distance values between the two subpopulations were 0.922 and 0.081, respectively.
Notably, the dendrogram constructed using the UPGMA and NJ method based on DA (Nei et al. 1983) genetic distance showed that the two native pig populations clustered together in the same clade, with a very high bootstrap support value of 100% (Figure 4). In addition,
the unrooted phylogenetic tree constructed using UPGMA method based on the Nei et al. (1983) genetic distances of 127 native pigs from the Philippines and Taiwan revealed three major clusters (Figure 5).
DISCUSSION
The native pig populations from Quezon and Marinduque provinces can be distinguished from one another using snout shape and ear type. Quezon native pigs had short and cylindrical snouts and lop ears, whereas Marinduque
Figure 4. Neighbor-joining (A) and UPGMA (B) trees generated based on the DA genetic distance values (Nei et al. 1983) between the Quezon, Marinduque, and Taiwan native pig breeds, as computed using six microsatellite markers. The number in each branch represents the percentage of bootstrap values from 1,000 replications of resampled loci. Legend: [QZ] Quezon; [MQ] Marinduque; [LY] Lanyu; [LS]
Lee-Sung.
Figure 5. Unrooted phylogenetic tree of 127 native pigs from Quezon (n = 37), Marinduque (n = 40), and Taiwan (n = 50) based on the Nei et al. (1983) genetic distance and UPGMA method using six microsatellite loci. Legend: [QZ] Quezon; [MQ] Marinduque;
[LY] Lanyu; [LS] Lee-Sung.
native pigs had short and pointed snouts and erect ears.
Plain black was the predominant coat color and pattern in all the sampled native pigs. This characteristic is unique to the Philippine native pig populations across the country (Maddul 1991; Francisco 1992; Geronimo 2002).
However, the native pigs from Quezon and Marinduque had straight backlines, which is different from the native pigs in Cordillera with low-set or swaybacked backlines (Maddul 1991).
All morphometric traits significantly differed between the two populations (P < 0.05), which may have been caused by the variations in the age of the animals and rearing methods applied. The native pigs sampled from Marinduque had an estimated age of 3–7 mo, whereas the native pigs from Quezon were aged 5 mo–14 yr. In addition, the feeds used by the farmers in rearing native pigs were very different. In Quezon, coconut meat, which is one of the major ingredients for the feeds, is often mixed with rice bran and boiled corms of San Fernando taro (Yautia sp., Family Araceae), locally known as sakwa.
By contrast, in Marinduque, native pigs were fed with 50% commercial feed and 50% grasses. Farmers often
use commercially available feeds due to the scarcity of locally available feedstuffs (Monleon 2005).
Based on 10 porcine microsatellite markers, Cho and colleagues (2014) previously reported that the mean number of alleles, HO, HE, and PIC values of Philippine native pigs were 3.30 ± 1.34, 0.403 ± 0.0331, 0.290 ± 0.0667, and 0.247, respectively. These values are lower than those obtained in this study. This may be attributed to the small number of Philippine native pigs (n = 23) investigated in their study. The microsatellite loci that deviated from HWE were also observed between Quezon and Marinduque native pigs, suggesting the possibility of inbreeding among Philippine native pig populations.
This deviation from HWE may have been caused by non- random mating (FAO 2011). In the Philippines, the sharing of native boars is a common practice for breeding dams (Monleon 2005). The low Ne values (< 65) and total rate of inbreeding (0.77%) were also previously reported for Marinduque native pigs (Monleon et al. 2010).
The low FST, genetic identity, and genetic distance
values represent the low level of genetic differentiation, suggesting that the two native pig populations are closely related to each other. Furthermore, the unrooted phylogenetic tree constructed using 127 individuals showed that neither Marinduque nor Quezon native pigs formed separate clades, indicating the presence of shared alleles or genotypes. Clade I was composed of Philippine native pigs, whereas Clades II and III consisted of Taiwanese native pig breeds. The majority of the native pigs in Clade II was Lanyu, whereas Lee-Sung dominated Clade III. Interestingly, one native pig from Quezon (QZ31) shared a closer genetic relationship with Taiwan native pigs in Clade III (Figure 5). This result suggests that QZ31 originated from an ancestor that had a genetic history with Taiwanese native pigs. Piper et al. (2009) discovered domestic pig bones in northern Luzon, Philippines that were dated 4500–4200 cal BP and associated with cultural materials from Taiwan, strongly implying the possibility of human and pig migration from Taiwan to the Philippines.
Based on the PIC values, microsatellite markers SW911, S0355, S0225, S0218, S0226, S0005, and SW857 were the most informative and highly recommended for future studies on the genetic diversity of Philippine native pig populations.
CONCLUSION
In summary, Quezon and Marinduque native pigs possessed a considerable amount of genetic variation. Morphologically, each population had unique characteristics. However, the level of genetic differentiation between the two populations based on nine microsatellite loci was low, implying the possibility of inbreeding. Therefore, further studies are needed for the genetic improvement and conservation of Philippine native pigs across the country.
ACKNOWLEDGMENTS
This study was supported by the DOST-PCAARRD (Department of Science and Technology–Philippine Council for Agriculture, Aquatic, and Natural Resources Research and Development) in cooperation with the MECO-TECO (Manila Economic and Cultural Office–
Taipei Economic and Cultural Office) Joint Research Initiative. The authors would like to thank the DOST- ASTHRDP-NSC (Accelerated Science and Technology Human Resource Development Program–National Science Consortium) for the scholarship and thesis support. The authors would also like to thank Cecille Ann
L. Osio for assisting with the revisions, responses to the reviewers’ comments, and preparing the requirements for submission to the journal.
STATEMENT ON CONFLICT OF INTEREST
The authors declare no conflicts of interest.
REFERENCES
BONDOC OL, DOMINGUEZ JMD, PEÑALBA FF.
2013. DNA Barcoding of Domestic Swine breeds and crossbreeds (Sus scrofa) in the Philippines. PJVAS 39(1): 31–42.
BROOKFIELD JFY. 1996. A simple new method for estimating null allele frequency from heterozygote deficiency. Mol Ecol 5: 453–455.
CARLSSON J. 2008. Effects of microsatellite null alleles on assignment testing. J Hered 99: 616–623.
CHAKRABORTY R, DE ANDRADE M, DAIGER SP, BUDOWLE B. 1992. Apparent heterozygote deficiencies observed in DNA typing data and their implications in forensic applications. Ann Hum Genet 56: 45–57.
CHO BW, OH JD, CACHO RCG, CHOI J, SEO J, SONG K, VEGA RSA, SANTIAGO RC, OCTURA JER, KIM SW, KIM C, KIM S, KONG HS, LEE H. 2014. Genetic analysis of Philippine native pigs (Sus scrofa L.) using microsatellite loci. Philipp J Sci 143(1): 87–94.
DAKIN EE, AVISE JC. 2004. Microsatellite null alleles in parentage analysis. Heredity 93: 504–509.
[DOST-PCAARRD] Department of Science and Technol- ogy–Philippine Council for Agriculture, Aquatic, and Natural Resources Research and Development. 2022.
Philippine native pigs. Retrieved on 09 Apr 2022 from https://pab-is.pcaarrd.dost.gov.ph/nativepigs/
ESTANY J, TOR M, VILLALBA D, BOSCH L, GAL- LARDO D, JIMÉNEZ N, ALTET L, NOGUERA JL, REIXACH J, AMILLS M, SÁNCHEZ A. 2007.
Association of CA repeat polymorphism at intron 1 of insulin-like growth factor (IGF-I) gene with cir- culating IGF-I concentration, growth, and fatness in swine. Physiol Genom 31(2): 236–243.
[FAO] Food and Agriculture Organization. 2003. Status of the Philippines’ animal genetic resources (a country report). Retrieved on 20 Oct 2015 from ftp://ftp.fao.org
[FAO] Food and Agriculture Organization. 2004. Sec- ondary Guidelines for Development of National Farm Animal Genetic Resources Management Plans. Mea- surement of Domestic Animal Diversity (MoDAD):
Recommended Microsatellite Markers. Retrieved on 12 Nov 2015 from http://dad.fao.org
[FAO] Food and Agriculture Organization. 2011. Molecu- lar genetic characterization of animal genetic resources.
In: FAO Animal Production and Health Guidelines No.
11. Rome. p. 14.
[FAO] Food and Agriculture Organization. 2012. Pheno- typic characterization of animal genetic resources. In:
FAO Animal Production and Health Guidelines No.
11. Rome. p. 115–121.
FRANCISCO CC. 1992. Farmers’ management practices and the morphological and genetic characteristics of native pigs in six Southern Luzon provinces [MS the- sis]. University of the Philippines Los Baños, Laguna, Philippines. p. 91–112 (available at the UPLB Library).
FREDHOLM M, WINTERO AK. 1993. Characteriza- tion of 24 porcine (dAdC)n-(dT-dG)n microsatellites:
genotyping of unrelated animals from four breeds and linkage studies. Mamm Genome 4: 187–192.
GERONIMO F. 2002. Survey and evaluation of indige- nous pig production and management practices in the Zamboanga Peninsula. Retrieved on 08 Jun 2020 from http://scinet.dost.gov.ph
GUO SW, THOMPSON EA. 1992. Performing the exact test of Hardy-Weinberg proportion for multiple alleles.
Biometrics 48(2): 361–372.
KALINOWSKI ST, TAPER ML, MARSHALL TC.
2007. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol Ecology 16: 1099–1106.
LANGELLA O. 2002. Populations (version 1.2.28) Pop- ulations, Genetique and Evolution, CNRS UPR 9034.
Retrieved on 08 Jun 2020 from http://www.pge.cnrs- gif.fr/bioinfo/populations
LI YH, CHU HP, JIANG YN, LIN CY, LI SH, LI KT, WENG GJ, CHENG CC, LU DJ, JU YT. 2014. Em- pirical selection of informative microsatellite mark- ers within co-ancestry pig populations is required for improving the individual assignment efficiency.
Asian-australas 27(5): 616.
MARSHALL TC, SLATE J, KRUUK LEB, PEMBER- TON JM. 1998. Statistical confidence for likeli- hood-based paternity inference in natural populations.
Mol Ecology 7: 639.
MADDUL SB. 1991. Production, management, and char- acteristics of native pigs in the Cordillera [Ph.D.thesis].
University of the Philippines Los Baños, Laguna, Philippines. p. 80–81 (available at the UPLB Library).
MONLEON AM. 2005. In situ conservation efforts for the Philippine native pig (Sus domesticus) in Marinduque. In:
Padilla MA, Canaria TL, Lapitan RM eds. Proceedings at the 42nd Scientific Seminar and Convention of The Philippine Society of Animal Science; 20–21 Oct 2005;
The Heritage Hotel Manila, Pasay City, Philippines.
MONLEON AM, LARRACAS PR, OPEÑA JL, AR- RIENDA II FQ, SUPANGCO EP. 2010. Population structure of native pig (Sus domesticus) in Marinduque.
Philipp J Vet Anim Sci 36(1): 13–18.
NAVARRA CF, PEÑALBA FF, LAMBIO AL, LAUDE RP, BARRION AA. 1997. Karyotype and blood protein polymorphism of the Philippine native pig (Sus scro- fa). Proceedings at the PSAS 34th Annual Convention of The Philippine Society of Animal Science; Metro Manila, Philippines. p. 346–358.
NEI M, TAJIMA F, TATENO Y. 1983. Accuracy of esti- mated phylogenetic trees from molecular data. J Mol Evol 19: 153–170.
OKLAHOMA STATE UNIVERSITY. 2000. Breeds of Livestock – Philippine Native Swine. Retrieved on 09 Apr 2022 from http://afs.okstate.edu/breeds/swine/
philippinenative/index.html
PEAKALL ROD, SMOUSE PE. 2006. GENALEX 6: ge- netic analysis in Excel. Population genetic software for teaching and research. Mol Ecol Notes 6(1): 288–295.
PEAKALL R, SMOUSE PE. 2012. GenAlEx 6.5: genet- ic analysis in Excel. Population genetic software for teaching and research—an update. Bioinformatics.
doi:10.1093/bioinformatics/bts460
PIPER PJ, HUNG HC, CAMPOS FZ, BELLWOOD P, SANTIAGO R. 2009. A 4000 year-old introduction of domestic pigs into the Philippine Archipelago: impli- cations for understanding routes of human migration through Island Southeast Asia and Wallacea. Antiquity 83(321): 687–695.
RAMBAUT A. 2018. FigTree v1.4.4. A graphical viewer of phylogenetic trees. Retrieved on 08 Jun 2020 from https://github.com/rambaut/figtree/releases
ROBIC A, DALENS M. 1994. Isolation of 28 new por- cine microsatellites revealing polymorphism. Mamm.
Genome 5: 580–583.
ROHRER GA, ALEXANDER LJ. 1994. A microsatellite linkage map of the porcine genome. Genetics 136:
231–245.
ROUSSET F. 2008. Genepop, a complete reimplementa- tion of the Genepop software for Windows and Linux.
Mol Ecol Resour 8: 103–106.
SOOKMANEE N. 1998. Molecular markers in swine [Ph.D. thesis]. University of the Philippines Los Baños, Laguna, Philippines. 40p (available at the UPLB Library).
TACULAO PB. 2020. Agriculture specials: basic swine production and management; Part 1: finding the right breed. Retrieved on 09 Apr 2022 from https://mb.com.
ph/2020/10/16/basic-swine-production-and-manage- ment-part-1-finding-the-right-breed/
TAKEZAKI N, NEI M, TAMURA K. 2010. POPTREE2:
software for constructing population trees from allele frequency data and computing other population sta- tistics with Windows interface. Mol Biol Ecol 27(4):
747–752.
VAN OOSTERHOUT C, HUTCHINSON WF, WILLS DP, SHIPLEY P. 2004. MICRO‐CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 4(3): 535–538.
WANG X, RINEHART TA, WADL PA, SPIERS J M, HADZIABDIC D, WINDHAM MT, TRIGIANO RN.
2009. A new electrophoresis technique to separate microsatellite alleles. AJB 8(11): 2432–2436.
WEIR BS, COCKERHAM CC. 1984. Estimating F-statis- tics for the analysis of population structure. Evolution 38(6): 1358–1370.
