Research Communication
A Putative Association of Interleukin-10
Promoter Polymorphisms with Cardiovascular Disease
Shams Tabrez
1* Murtaza Ali
2Nasimudeen R. Jabir
1Chelapram K. Firoz
1Ghulam Md. Ashraf
1Salwa Hindawi
3Ghazi A. Damanhouri
1Mohammed Nabil Alama
41King Fahd Medical Research Center, King Abdulaziz University, Jeddah, Saudi Arabia
2Department of Biosciences, Jamia Millia Islamia, New Delhi, India
3Department of Hematology, Faculty of Medicine, King Abdulaziz University Hospital, Jeddah, Saudi Arabia
4Department of Cardiology, Faculty of Medicine, King Abdulaziz University Hospital, Jeddah, Saudi Arabia
Abstract
Interleukin-10 (IL-10) is an anti inflammatory cytokine involved in the ongoing coronary inflammation and related patho-physiological pro- cesses. The piece of work presented herein is aimed at investigating possible association of polymorphisms in IL-10 promoter with Saudi cardiovascular disease (CVD) patients. The study included 80 con- firmed CVD patients with diabetes and 75 healthy control individuals both men and women. Concentration of IL-10 in the serum samples were measured by ELISA method. For single nucleotide polymor- phism (SNP) analysis, Sanger method of DNA sequencing was fol- lowed. The IL-10 level was found to be significantly elevated in CVD patients (P<0.001) and its associated complications viz. ST-elevation myocardial infarction [STEMI] (P<0.01), non ST-elevation myocardial infarction [NSTEMI] (P<0.05), and unstable angina [UA] (P<0.001).
We also observed a significant association between polymorphisms in IL-10 promoter at21082 and2819 locus with Saudi CVD patients.
Moreover, at21082 A/G locus, AA haplotype was found to be less frequent in the CVD patients compared with control individuals. On the other hand, highly significant rise in heterozygous (A/G genotype) condition was observed in patient samples compared with control ones (P<0.001). Similarly, the genotypic frequencies at 2819 C/T locus were also found to be significantly associated (P<0.001) with CVD patients compared with control individuals. Our study provides the status of polymorphism in IL-10 promoter and its association with CVD risk in Saudi population. As per our information, ours is the first article that shows the genetic diversity in IL-10 promoters and its level in the Saudi CVD patients.VC 2017 IUBMB Life, 69(7):522–527, 2017
Keywords: cardiovascular disease; ELISA; IL-10; inflammation;
polymorphism
Introduction
Cardiovascular disease (CVD) has been growing like a perilous epidemic and is accounted as the leading cause of mortality and morbidity all across the globe (1,2). It is generally mani- fested as atherosclerosis and underlying vascular aberrations along with formation of coronary plaques. Scientific literature supports the potential role of inflammatory cascade in the var- ious forms of cardiovascular events. Extensive inflammatory infiltrates and high levels of cytokine expression have been suggested as the root cause of these reactions (1–3).
Interleukin-10 (IL-10) is produced by Th2 cells and macro- phages which are considered as the potential contributors of human atherogenesis (4). IL-10 has been involved in several inflammatory events such as endothelial function, leukocyte recruitment, antigen presentation from macrophages and Abbreviations:CVD, Cardiovascular disease; HbA1c, Glycosylated hemo-
globin; HDL, High density lipoprotein; IL-10, Interleukin-10; LDL, Low den- sity lipoprotein; MI, Myocardial infarction; NSTEMI, Non ST segment ele- vation myocardial infarction; SNP, Single nucleotide polymorphism; STEMI, ST segment elevation myocardial infarction; UA, Unstable angina
VC 2017 International Union of Biochemistry and Molecular Biology Volume 69, Number 7, July 2017, Pages 522–527
*Address correspondence to: Dr. Shams Tabrez, King Fahd Medical Research Centre, King Abdulaziz University, P.O. Box 80216, Jeddah 21589, Kingdom of Saudi Arabia. Fax:1966-126952076.
E-mail: [email protected]
Conflict of interests: The author(s) declare that there is no conflict of interests regarding the publication of this article.
Received 31 March 2017; Accepted 17 April 2017 DOI 10.1002/iub.1637
Published online 5 May 2017 in Wiley Online Library (wileyonlinelibrary.com)
dendritic cells (5,6). On the other hand, circulating IL-10 has also been suggested as the useful marker of ongoing coronary inflammation and related patho-physiological processes (6). It could inhibit various pro-inflammatory cytokines viz. IL-18, IL- 12, IL-6, IL-1, and TNF-a (7). The high expression of IL-10 mRNA has also been noted in advanced atherosclerotic pla- ques (4). Approximately, 50–75% of IL-10 expression is esti- mated to be genetically controlled (8). Different polymorphic sites (–1082,2819, and2592) in the promoter region of IL-10 gene and their association with CVD have been reported in the scientific literature (9–11). However, there are also conflicting reports which didn’t find any association of IL-10 promoter polymorphism with CVD among different racial and ethnic ori- gins (12–14). The present study was intended to investigate the role of polymorphisms in IL-10 gene at its SNPs hotspot viz.
21082,2819, and2592 whether they are enhancing CVD risk in the Saudi CVD patients. We also measured IL-10 levels in these samples. To the extent of our insight from the available literature, we are for the first time reporting SNPs in IL-10 promoter and its serum levels in Saudi CVD patients in a single article.
Materials and Methods
Our study included 80 angiographically confirmed CVD patients recruited from King Abdulaziz University Hospital (KAUH), Jeddah, Saudi Arabia. Seventy-five healthy volunteer blood donors serve as control group. All the control individuals were physically examined and on the basis of absence of CVD clinical symptoms and normal resting and exercise-related electrocardiogram were classified as control. The patient’s selection criteria were followed as previously described by us (1). The protocol of this study was approved by the ethical
committee at KAUH. The written informed consent was acquired from each individual involved before the commence- ment of the study.
Sample Collection
The venous blood samples (6 mL) were collected between 8.00 and 9.00 AM in EDTA coated and/or free tubes from selected CVD patients and healthy control individuals. Serum separa- tion was done by centrifugation at 2,000gfor 5 min and stored at2808C until further analysis.
Estimation of IL-10 Levels
The concentration of IL-10 levels were estimated by commercially available ELISA kit (Abcam, Cambridge, UK).
The protocol provided by the manufacturer was strictly adhered.
DNA Isolation
DNA isolation was carried out from the blood samples as described earlier by us (15).
Polymerase Chain Reaction
Extracted DNA samples were amplified by conventional poly- merase chain reaction (PCR) method by using manually designed forward (50ATCTGAAGAAGTCCTGATGTCACTGC 30) and reverse (50ATCTCGGAGATCTCGAAGCATGTTAG 30) pri- mers specific for IL-10 promoter. PCR amplification was car- ried out as per the method described by Jabir et al. (2016) with an annealing temperature of 56 8C. Subsequently, the PCR products were stored at 48C until next procedure.
PCR Product Purification, Thermal Cycling, and DNA Sequencing
The purification of PCR products were carried out by using PCR purification kit (Thermo Scientific, USA). Thermal cycling and Sanger sequencing were performed as described earlier
Parameter Control individuals (n575) CVD patients (n580) P-value
Age (years) 45.666.4 57.767.7 P<0.05
Male (n) 54 63 NS
Smokers 17 21 NS
Fasting glucose (mmol/L) 5.2460.62 7.5562.71 P<0.001
HbA1c (%) 5.1360.52 7.6161.68 P<0.001
Total cholesterol (mmol/L) 4.0960.88 4.2761.19 NS
Triglycerides (mmol/L) 1.8260.79 1.8961.09 NS
LDL cholesterol (mmol/L) 2.4660.62 2.7660.95 P<0.05
HDL cholesterol (mmol/L) 1.0160.16 1.0960.22 P<0.05
HbA1c: glycosylated hemoglobin; HDL: high density lipoprotein; LDL: low density lipoprotein; NS: non-significant.
by us (16). Because of the long nucleotide stretch, one internal primer (50 TGGAGATGGTGTACA 30) was also used to read the whole coding region in the control and CVD samples.
Sequence Analysis
The sequence file (*.AB1) obtained from Sanger sequencing was then subjected to the seqTrace ver 0.9.0. The generated fasta and quality files were further treated with the in-house perl scripts for quality trimming. The high-quality sequences were aligned using BioEdit software and further crosschecked by ClustalW2. Alignments were then converted to the pir for- mat using the BioEdit software. The genotype of each sample is called using perl scripts developed in-house.
Statistical Analysis
The data was analyzed by GraphPad Prism 7 (GraphPad Soft- ware Inc., San Diego. CA). The serum concentration of IL-10 is shown as mean6SD of duplicate value. Correlation of varia- bles amongst CVD patients and control individuals were car- ried out by two tailedt-test. Comparison of the association of genotypes at21082 A/G and2819 C/T locus in IL-10 assembly were measured by Fisher’s exact test (Two-tailed). A probabil- ity (P<0.05) was considered as a significant criterion.
Results
The basic demographic and clinical characteristic of the stud- ied population is summarized in Table 1. A significant rise in fasting glucose and HbA1c levels were observed in CVD patients compared with control individuals (Table 1). The serum IL-10 level also showed a significant rise by 18%
(P<0.001) in CVD patients compared with control individuals.
On the other hand, the different myocardial events such as STEMI, NSTEMI, and UA also showed significant elevation in IL-10 levels compared with control individuals. The concentra- tion of IL-10 in STEMI, NSTEMI, and UA group were found to be increased by 16.7%, 12.6%, and 39.2%, respectively (Table 2).
A total 1,251 bp upstream of IL-10 gene promoter was targeted for variant analysis. We were interested to find out the diversity at loci 21082 A/G (rs1800896), 2819 C/T (rs1800871), and 2592 A/C (rs1800872) in IL-10 promoter.
From Table 3, it is quite clear that A/A genotype was found to be less frequent in the CVD patients compared with control individuals at 21082 A/G locus and was significantly associ- ated with these two sets of population. On the other hand, highly significant heterozygous (A/G genotype) condition was observed in patient samples compared with control individu- als (P<0.001). Moreover, G/G genotype did not show any dif- ferences between control and CVD samples (Table 3). Simi- larly, the genotypic frequency at 2819 C/T locus were also found to be significantly (P<0.001) associated with CVD patients compared with control individuals. At this locus, C/C genotype was found to be present in 74.7% of CVD patients compared with only 14% in control individuals. Moreover, the percentage of C/T genotype was found to be more pronounced in control compared with CVD patients (Table 4). The locus at 2592 A/C didn’t show significant difference between control and test sets (Table 5). The present study also compared the frequency of haplotypes in IL-10 promoter at 2819 C/T and 21082 A/G between control and CVD patients. Four haplo- types of IL-10 promoter consisting of two alleles of each poly- morphism are shown in Table 6. The frequency of TA haplo- type was found to be significantly lower in CVD patients compared with control individuals. However, the frequency of CG haplotype was found to be significantly higher in CVD patients.
Comparison of serum IL-10 level (pg/mL) between control and different CVD conditions
Group n IL-10 level (pg/mL) P-value
Control 75 510.376121.20
CVD patients 80 604.456169.61 P<0.001 STEMI patients 35 596.026167.34 P<0.01 NSTEMI patients 33 574.846180.26 P<0.05
UA patients 12 710.52683 P<0.001
STEMI: ST segment elevation myocardial infarction; NSTEMI: non ST segment elevation myocardial infarction; UA: unstable angina; NS:
non-significant.
Genotype frequency distribution of IL10-1082 A/G (rs1800896) polymorphism among control and CVD samples
Genotypes
Control (n550) (%)
CVD samples
(n575) (%) P-value
A/A 40 (80) 1 (1.3) P<0.001
A/G 1 (2) 66 (88) P<0.001
G/G 9 (18) 8 (10.7) N.S
Genotype frequency distribution of IL10-819 C/T polymorphism among control and CVD samples
Genotypes
Control (n550) (%)
CVD samples
(n575) (%) P-value
C/C 7 (14) 56 (74.7) P<0.001
C/T 38 (76) 8 (10.7) P<0.001
T/T 1 (2) 11 (14.7) P<0.01
TABLE 2 TABLE 3
TABLE 4
IUBMB LIFE
Discussion
CVD pathogenesis has been implicated with multiple genetic and inflammatory pathways that modulate various inflamma- tory cytokines during different stages of atherosclerosis (3).
The present study supports the conventional linkage between chronically elevated blood glucose, HbA1c levels, and CVD (Table 1). Esposito et al. (17) reported the postprandial incre- mental glucose peak is related with carotid intima-media thickness. Long-term complications of hyperglycemia include endothelial dysfunction, changes in the arterial distensibility, plaque formation, and atherosclerosis (18,19). Glycemic fluctu- ations could trigger inflammatory responses and accelerate vascular injury and CVD risk (20,21). To protect the possible injury in response to inflammation, the rise in the secretion of IL-10 takes place.
In our earlier studies, we have reported a significant ele- vation in different inflammatory mediators such as IL-6, IL-18, and IL-1b in Saudi CVD patients (15,16,22). In this study too, we observed a significant elevation in IL-10 level in CVD patients and other cardiac events (Table 2). The noted rise in IL-10 level could be due to the increased activation of pro- inflammatory interleukins that promotes the secretion of anti- inflammatory IL-10 (23). The present study is in line with pre- vious reports which showed an increase in IL-10 level in STEMI patients (24). In one study, Karpinski et al. (2008) reported the significant rise in IL-10 level in the acute phase of myocardial infarction (25). On the other hand, the other car- diovascular complications viz. UA and NSTEMI has showed conflicting results related with the modulation in IL-10 level (26–28). Moreover, an increase in IL-10 expression and CD41
cant increase in IL-10 level in all categorized CVD patients (Table 2).
Heeschen et al. (31) reported that CVD patients with ele- vated serum IL-10 levels have favorable clinical outcomes dur- ing 6-month follow-up. In fact, higher baseline IL-10 levels in acute MI patients are strong and independent predictor of adverse cardiovascular outcomes (32,33). Taken together all above mentioned facts, increased IL-10 levels in CVD patients could be a compensatory response against the elevation of pro-inflammatory mediators and vascular injury. We also observed a significant rise in these mediators in our previous studies (15,34).
In our earlier studies, we reported non-significant associa- tions of SNPs in promoter region of IL-6, IL-18, and IL-1b genes with Saudi CVD patients (15,16,22). However, the pre- sent study reports a significant association between polymor- phism in IL-10 promoters at21082 and2819 sites with Saudi CVD patients. We observed a high frequency of homozygous A/
A genotype at 21082 loci in control samples whereas hetero- zygous A/G genotype was more pronounced in CVD samples (Table 3). Scientific studies also reported similar findings where polymorphism in IL-10 promoter at 21082 G/A was suggested to be associated with CVD risk (10,11,35). Some studies also reported contradictory results related with the association of21082 A/G polymorphism with CVD risk in spe- cific populations (12,13). The associations of polymorphism at 2819 C/T site with CVD are mixed in literature, perhaps because of its diverse expression in different populations.
Recently, Afzal et al. (2017) reported the significant association of 2819 C/T polymorphism with CVD in Pakistani population (14). The polymorphism at 2819 C/T locus has also been sug- gested to alter the IL-10gene activity resulting in a significant rise in plasma IL-10 level (36). In addition, the study based on the ethnicity has also highlighted the significant association between IL-102819 C/T polymorphism with CVD risk in Asian population, but not in other ethnic groups (36). Our data pro- vide additional evidence to support the ethnic dependent asso- ciation of2819 C/T polymorphism with CVD. Previous studies also reported conflicting data related with polymorphism at 2819 position and its association with CVD (13,37,38). On the Genotypes
Control (n550) (%)
CVD samples
(n575) (%) P-value
A/A 32 (64) 46 (61.3) 0.764
A/C 1 (2) 1 (1.3) 0.772
C/C
Frequency (%) of haplotypes of IL-10 gene polymorphisms in control individuals and CVD patients
Haplotypes-819 CT Haplotypes-1082 AG Control (n550) CVD samples (n575) Frequency (%) P-value
T G 2 8 0.08662 NS
T A 30 0 0.18228 P<0.001
C G 0 49 0.33354 P<0.001
C A 5 1 0.39755 P<0.01
TABLE 6
other hand, we did not observe any significant association between IL-10 polymorphisms at 2592 C/A genotype with Saudi CVD patients. Some studies reported increase in CVD risk as a result of IL-10 promoter polymorphisms at2592 C/A in different ethnic populations (14,36,39). The polymorphisms in IL-10 promoter could also lead to the modulation in IL-10 secretion (39).
Overall, the polymorphisms in IL-10 promoter seem to play a divergent role in CVD pathogenicity. Discrepancies between various studies may be due to different patterns of linkage disequilibrium between polymorphic sites and other functional mutations in the IL-10 gene that can differ among different ethnic groups. The selection of patients, sample size, and other neighboring SNP hotspot could also affect these results (40–42). In addition, environmental factors have also been suggested to influence the gene expression pattern and strongly depend on the ethnicity and regional location (43).
Multi-factorial nature of CVD pathogenicity also causes incon- sistency between specific gene variants and haplotypes with disease states.
Conclusion
The present study reports the significant rise in IL-10 serum level in CVD patients and other MI complications. We also observed a significant association of SNPs hotspots at 21082 A/G (rs1800896) and2819 C/T (rs1800871) in IL-10 promoter with CVD. These two positions (i.e., 21082 and 2819) could also be used as the marker selection for therapeutic elucida- tion. Further studies on larger sample size are advocated to establish the exact role of IL-10 in the pathogenesis of CVD and its risk at genetic level.
Acknowledgements
This project was funded by the Deanship of Scientific Research (DSR) at King Abdulaziz University, Jeddah under grant num- ber G-528-141-36. The authors, therefore, acknowledge with thanks DSR for technical and financial support.
References
[1] Firoz, C. K., Jabir, N. R., Kamal, M. A., Alama, M. N., Damanhouri, G. A., et al. (2015) Neopterin: an immune biomarker of coronary artery disease and its association with other CAD markers. IUBMB Life 67, 453–459.
[2] Jabir, N. R. and Tabrez, S. (2016) Cardiovascular disease management through restrained inflammatory responses. Curr. Pharm. Des. 22, 940–946.
[3] Zakynthinos, E. and Pappa, N. (2009) Inflammatory biomarkers in coronary artery disease. J. Cardiol. 53, 317–333.
[4] Mallat, Z., Heymes, C., Ohan, J., Faggin, E., Lese`che, G., et al. (1999) Expres- sion of interleukin-10 in advanced human atherosclerotic plaques: relation to inducible nitric oxide synthase expression and cell death. Thromb. Vasc.
Biol. 19, 611–616.
[5] Sabat, R., Gr€utz, G., Warszawska, K., Kirsch, S., Witte, E., et al. (2010) Biology of interleukin-10. Cytokine Growth Factor Rev. 21, 331–344.
[6] Welsh, P., Murray, H. M., Ford, I., Trompet, S., de Craen, A. J. M., et al.
(2011) Circulating interleukin-10 and risk of cardiovascular events: a
prospective study in the elderly at risk. Arterioscler. Thromb. Vasc. Biol. 31, 2338–2344.
[7] Dennis, V. A., Jefferson, A., Singh, S. R., Ganapamo, F., and Philipp, M. T.
(2006) Interleukin-10 anti-inflammatory response to borrelia burgdorferi, the agent of lyme disease: a possible role for suppressors of cytokine signaling 1 and 3. Infect. Immun. 74, 5780–5789.
[8] Gong, M. N., Thompson, B. T., Williams, P. L., Zhou, W., Wang, M. Z., et al.
(2006) Interleukin-10 polymorphism in position21082 and acute respiratory distress syndrome. Eur. Respir. J. 27, 674–681.
[9] Wang, Y., Zheng, J., Liu, P., Yu, X., Zhou, D., et al. (2012) Association between the Interleukin 10-1082G>A polymorphism and coronary heart dis- ease risk in a Caucasian population: a meta-analysis. Int. J. Immunogenet.
39, 144–150.
[10] Elsaid, A., Abdel-Aziz, A. F., Elmougy, R., and Elwaseef, A. M. (2014) Associ- ation of polymorphisms G(-174)C in IL-6 gene and G(-1082)A in IL-10 gene with traditional cardiovascular risk factors in patients with coronary artery disease. Indian J. Biochem. Biophys. 51, 282–292.
[11] Wu, L., Zhao, M. H., Geng, G. Y., Mao, L., and Liu, H. J. (2016) Statistical analysis of the relationship between IL-10 gene promoter polymorphisms and the development of coronary artery disease. Genet. Mol. Res. 15, gmr15047823.
[12] Guo, J., He, Y.-H., Chen, F., Jiang, M.-H., Gao, S.-P., et al. (2012) The A to G polymorphism at21082 of the interleukin-10 gene is rare in the Han Chi- nese population. Mol. Med. Rep. 6, 894–896.
[13] Koch, W., Kastrati, A., B€ottiger, C., Mehilli, J., von Beckerath, N., et al.
(2001) Interleukin-10 and tumor necrosis factor gene polymorphisms and risk of coronary artery disease and myocardial infarction. Atherosclerosis 159, 137–144.
[14] Afzal, M. S., Anjum, S., Farooqi, Z-u-R., Noreen, M., Safi, S. Z., et al. (2017) Influence of IL-10 polymorphism on the development of coronary artery dis- ease in Pakistan. Asian Biomed. 6, 159–165.
[15] Jabir, N. R., Firoz, C. K., Kamal, M. A., Damanhouri, G. A., Alama, M. N., et al. Assessment of genetic diversity in IL-6 and RANTES promoters and their level in Saudi coronary artery disease patients. J. Clin. Lab. Anal. in press. doi:10.1002/jcla.22092.
[16] Jabir, N. R., Firoz, C. K., Kamal, M. A., Damanhouri, G. A., Alama, M. N., et al.
Assessment of IL-18 serum level and its promoter polymorphisms in the saudi coro- nary artery disease (CAD) patients. J. Cell Biochem. in press. doi: 10.1002/jcb.25870.
[17] Esposito, K., Ciotola, M., Carleo, D., Schisano, B., Sardelli, L., et al. (2008) Post-meal glucose peaks at home associate with carotid intima-media thick- ness in type 2 diabetes. J. Clin. Endocrinol. Metab. 93, 1345–1350.
[18] Sheetz, M. J. and King, G. L. (2002) Molecular understanding of hyperglyce- mia’s adverse effects for diabetic complications. JAMA 288, 2579–2588.
[19] Zhao, W., Katzmarzyk, P. T., Horswell, R., Wang, Y., Johnson, J., et al.
(2014) HbA1c and coronary heart disease risk among diabetic patients. Dia- betes Care 37, 428–435.
[20] Mannucci, E., Dicembrini, I., Lauria, A., and Pozzilli, P. (2013) Is glucose con- trol important for prevention of cardiovascular disease in diabetes? Diabe- tes Care 36, S259–S263.
[21] Bornfeldt, K. E. and Tabas, I. (2011) Insulin resistance, hyperglycemia, and atherosclerosis. Cell Metab. 14, 575–585.
[22] Tabrez, S., Jabir, N. R., Firoz, C. K., Hindawi, S., Shakil, S., et al. Estimation of interleukin-1bpromoter (-31 C/T &2511 T/C) polymorphisms and its level in cor- onary artery disease patients. J. Cell. Biochem. in press. doi:10.1002/jcb.25958.
[23] Mostafa Mtairag, E., Chollet-Martin, S., Oudghiri, M., Laquay, N., Jacob, M.
P., et al. (2001) Effects of interleukin-10 on monocyte/endothelial cell adhe- sion and MMP-9/TIMP-1 secretion. Cardiovasc. Res. 49, 882–890.
[24] Sardella, G., De Luca, L., Francavilla, V., Accapezzato, D., Di Roma, A., et al.
(2007) Effect of coronary percutaneous revascularization on interferon- gamma and interleukin-10 producing CD41T cells during acute myocardial infarction. Int. J. Immunopathol. Pharmacol. 20, 791–799.
[25] Karpinski, L., Płaksej, R., Kosmala, W., and Witkowska, M. (2008) Serum lev- els of interleukin-6, interleukin-10 and C-reactive protein in relation to left ventricular function in patients with myocardial infarction treated with pri- mary angioplasty. Kardiologia Polska 66, 1279–1285.
IUBMB LIFE
coronary artery disease. Scand. J. Immunol. 64, 336–344.
[27] Yamashita, H., Shimada, K., Seki, E., Mokuno, H., and Daida, H. (2003) Con- centrations of interleukins, interferon, and C-reactive protein in stable and unstable angina pectoris. Am. J. Cardiol. 91, 133–136.
[28] Smith, D. A., Irving, S. D., Sheldon, J., Cole, D., and Kaski, J. C. (2001) Serum levels of the antiinflammatory cytokine interleukin-10 are decreased in patients with unstable angina. Circulation 104, 746–749.
[29] Lakoski, S. G., Liu, Y., Brosnihan, K. B., and Herrington, D. M. (2008) Inter- leukin-10 concentration and coronary heart disease (CHD) event risk in the estrogen replacement and atherosclerosis (ERA) study. Atherosclerosis 197, 443–447.
[30] Nishihira, K., Imamura, T., Yamashita, A., Hatakeyama, K., Shibata, Y., et al.
(2006) Increased expression of interleukin-10 in unstable plaque obtained by directional coronary atherectomy. Eur. Heart J. 27, 1685–1689.
[31] Heeschen, C., Dimmeler, S., Hamm, C. W., Fichtlscherer, S., Boersma, E., et al. (2003) Serum level of the antiinflammatory cytokine interleukin-10 is an important prognostic determinant in patients with acute coronary syn- dromes. Circulation 107, 2109–2114.
[32] M€alarstig, A., Eriksson, P., Hamsten, A., Lindahl, B., Wallentin, L., et al. (2008) Raised interleukin-10 is an indicator of poor outcome and enhanced systemic inflammation in patients with acute coronary syndrome. Heart 94, 724–729.
[33] Cavusoglu, E., Marmur, J. D., Hojjati, M. R., Chopra, V., Butala, M., et al.
(2011) Plasma interleukin-10 levels and adverse outcomes in acute coronary syndrome. Am. J. Med. 124, 724–730.
[34] Jabir, N., Firoz, C. K., Ahmed, F., Kamal, M., Hindawi, S., et al. Reduction in CD16/CD56 and CD16/CD3/CD56 natural killer cells in coronary artery dis- ease. Immunol. Invest. in Press. doi:10.1080/08820139.2017.1306866.
[36] Wang, B.-J., Liu, J., Geng, J., Zhang, Q., Hu, T.-T., et al. (2015) Association between three interleukin-10 gene polymorphisms and coronary artery dis- ease risk: a meta-analysis. Int. J. Clin. Exp. Med. 8, 17842–17855.
[37] Donger, C., Georges, J. L., Nicaud, V., Morrison, C., Evans, A., et al. (2001) New polymorphisms in the interleukin-10 gene–relationships to myocardial infarction. Eur. J. Clin. Invest. 31, 9–14.
[38] Lio, D., Candore, G., Crivello, A., Scola, L., Colonna-Romano, G., et al.
(2004) Opposite effects of interleukin 10 common gene polymorphisms in cardiovascular diseases and in successful ageing: genetic background of male centenarians is protective against coronary heart disease. J. Med.
Genet. 41, 790–794.
[39] Ben-Hadj-Khalifa, S., Ghazouani, L., Abboud, N., Ben-Khalfallah, A., Annabi, F., et al. (2010) Functional interleukin-10 promoter variants in coronary artery disease patients in Tunisia. Eur. Cytokine Netw. 21, 136–141.
[40] Bown, M. J., Lloyd, G. M., Sandford, R. M., Thompson, J. R., London, N. J.
M., et al. (2007) The interleukin-10-1082 ’A’ allele and abdominal aortic aneurysms. J. Vasc. Surg. 46, 687–693.
[41] Manginas, A., Tsiavou, A., Chaidaroglou, A., Giamouzis, G., Degiannis, D., et al. (2008) Inflammatory cytokine gene variants in coronary artery disease patients in Greece. Coron. Artery Dis. 19, 575–582.
[42] Heiskanen, M., K€ahonen, M., Hurme, M., Lehtim€ aki, T., Mononen, N., et al.€ (2010) Polymorphism in the IL10 promoter region and early markers of ath- erosclerosis: the Cardiovascular Risk in Young Finns Study. Atherosclerosis 208, 190–196.
[43] Tabassum, R., Nath, A., Preininger, M., and Gibson, G. (2013) Geographical, environmental and pathophysiological influences on the human blood tran- scriptome. Curr. Genet. Med. Rep. 1, 203–211.