Macroscopic, Microscopic and DNA Fingerprinting to Fight Adulteration of Banafsaj (Viola Odorata L) Sold at the Lebanese Herbal Shops

(1)

http://www.europeanjournalofscientificresearch.com

Macroscopic, Microscopic and DNA Fingerprinting to Fight Adulteration of Banafsaj ( Viola Odorata L) Sold at the

Lebanese Herbal Shops

Marc El Beyrouthy

Corresponding Author, Faculty of Agricultural and Food Sciences University of the Holy Spirit of Kaslik, Lebanon, B.P. 446 Jounieh, Lebanon

E-mail: [email protected] Tel: +961 9 600878; Fax: +961 9 600871

Maya Kafrouny

Faculty of Agricultural and Food Sciences University of the Holy Spirit of Kaslik, Lebanon

Nelly Arnold Apostolides

Faculty of Agricultural and Food Sciences University of the Holy Spirit of Kaslik, Lebanon

Ahmed El-Hejin

Special Infectious Agents Unit, King Fahd Medical Research Center King Abdulaziz University, Jeddah, KSA

Loai Siddig

Ahmed Hassan

Esam Azhar

Medical Laboratory Technology Department, Faculty of Applied Medical Sciences King Fahd Medical Research Center, King Abdulaziz University, Jeddah, KSA

Afif M Abdel Nour

Abstract

Viola odorata L. (sweet violet) is a very important medicinal plant in the Middle East. It is in great demand, and has been cultivated for cosmetics and medicinal uses since ancient times.

(2)

In Lebanon and in the Middle East, there is a gap between the demand and supply of Viola odorata, mainly because of difficulties in harvesting which may lead to adulteration and substitution of genuine material.

Thus the goal of the present study was to inspect several samples claimed to be of sweet violet from different herbalist shops in Lebanon. For these reasons macroscopic, microscopic and DNA analysis of 10 samples of claimed V. odorata sold in different Lebanese regions were undertaken. By comparing the studied samples with those of genuine V. odorata L. collected from nature, the adulteration was proven. This study showed that the majority of the Lebanese sweet violet was adulterated using Cercis siliquastrum L.

Keywords: Viola odorata L., Violaceae, macroscopy, morpho-anatomy, DNA, adulteration

1. Introduction

Traditional herbal medicine refers to the long historical use of medicinal plants. Their utilization is well established and widely acknowledged to be safe and effective, and may be accepted by national authorities. Interest in medicinal plants has increased enormously over the last few decades.

The Violaceae is a medium sized family of perennial or rarely annual herbs or shrubs, including the Violets or pansies. The family is cosmopolitan, but more typical of the temperate regions. It contains about 900 species belonging to 22 genera. The Viola L. is the largest genus of the family and has about 400 species in the world among them 8 are found in Lebanon[1].

Viola odorata L. is a species of the genus Viola native to Europe and Asia. It is commonly known as Sweet Violet, English Violet, Common Violet, or Garden Violet. It is known as Banafsaj in Lebanon, and the flowers are commonly used as remedy to cure influenza, coughing and as having diuretic, expectorant and sedative properties[2, 3].

In Lebanon there is a gap between the demand and supply of V. odorata, mainly because of difficulties in harvesting which may lead to adulteration and substitution of genuine material. Thus the goal of the present study was to inspect several samples claimed to be of sweet violet from different herbalist shops in Lebanon.

2. Previous Research

2.1. Description of Viola Odorata

V. odorata is an evergreen perennial ornamental plant, up to 20 cm high, stem central with radiating stolons forming a carpet of growth. Leaves ovate, with rounded apex, widely cordate at the base, pubescent. Flowers solitary, fragrant, on long peduncles, lower petals saccate at the base, purple to violet[4].

2.2. Distribution

Found wild in many regions of the world, e.g. South and eastern Africa, South

America, France, Italy, Australia and New Zealand. Cultivated all over the world as an ornamental plant[4].

2.3. Part Used

Whole plant, leaves, roots and flowers[4].

(3)

2.4. Traditional & Medicinal uses

Leaves are emetic, purgative, expectorant, emollient, diaphoretic; used as dressing for burns. Roots are emetic and used as expectorant; the alkaloid odoratine from roots is hypotonic. Flowers are emetic, diaphoretic, febrifuge used in bilious problems, lung troubles, cough, kidney and liver diseases and also used to flavor breath fresheners. An essential oil from the flowers and leaves is used in perfumery[2, 3 , 4].

The leaves are edible and can also be cooked, and are a nice addition to soups or stews where they will help to thicken them in much the same way as okra can be used. It also contains salicylic acid, which is used to make aspirin, and is therefore effective in the treatment of headaches, migraine and insomnia[2, 3 , 4].

2.5. Characteristics of Viola Odorata L.

Viola odorata is quite similar to other species of violet, but can be distinguished by the following characteristics:

• the flowers have a sweet scent,

• the flowers are normally either dark violet or white,

• the leaves and flowers are all in basal rosette,

• the style is hooked(and does not end with a rounded appendage),

• The leaf-stalks have hairs which point downwards

• the plant spreads with stolons (above-ground shoots) [4].

3. Materials and Methods

3.1. Sample Collection

200g of claimed V. odorata flowers were bought from 7 herbalist shops in 2011 and 2012: Tripoli (4), Jounieh (1), Aley (1), Jbeil (1), Maten (1), Saida (1) and Sour (1)(Tab. 2).

In order to determine whether samples of Viola odorata from herbalists are authentic, we collected specimens in nature. Only the aerial parts (leaves, flowers and stems) were harvested in the early morning so the plant material is as fresh as possible, the samples were dried and stored.

Macroscopic, microscopic and DNA analysis were performed to compare samples collected to those purchased on the market.

We also tried to investigate the market of violet in Lebanon and their uses.

3.2. Macroscopic Study

V. odorata is typically sold in Lebanon as dried whole flowers. For this reason we used the New Flora of Lebanon and Syria [1] in order to inspect the taxonomical features of the samples and to compare them with those of the dried drugs registered in the European Pharmacopeia. The plants were identified by Dr. Marc El Beyrouthy and voucher specimens were deposited at the Herbarium of the Faculty of Agricultural and Food Sciences at USEK University.

V. odorata is an evergreen perennial plant, up to 15 cm high, stem central with radiating stolons forming a carpet of growth. Leaves ovate, with rounded apex, widely cordate at the base, pubescent.

Flowers 2cm solitary, fragrant, on long peduncles, lower petals saccate at the base, purple to violet.

Petals with striated cuticle and 5 free stamens.

Thus, first, we proceeded to clean the samples purchased and have removed any foreign material, and then we took 20 random flowers of the lots, and we observed the shape of flowers, then we counted the number of stamens per flower. This study reveals the macroscopic characteristics of taxonomic samples purchased.

(4)

3.3. Microscopic Description

For the anatomical investigations, samples were investigated under light microscope and photos were taken with a Spot In-SIGHT Color Digital camera and an Olympus type microscope.

The corollas and calyces were observed in cross-sections placed on a slide with a little distilled water and cover with a coverslip. We also obtained lower and upper cross-sections from fresh and dried (using Chloral hydrate) materials and the trichomes were observed in different spots in every studied organ.

3.4. DNA Extraction and Real Time PCR (qPCR) Analysis

DNA extraction was conducted using the Qiagen DNA plant extraction kit according to the manufacturer handbook (Qiagen, Paris, France). DNA quality was assessed by a spectrophotometer and only high quality DNA was conserved at -20^oC for further experiment.

qPCR is widely used in research and molecular diagnostics. We applied this technique to diagnose plants adulteration and miss usage of medicinal ones. In 2009, Bustin et al. (MIQE, in clinchem) [5] published a guideline for reliable qPCR results. Although this guideline is for gene expression analysis, we applied it on detection of the Viola specific DNA for 10 samples. Primers were designed and validated by PrimerDesign Ltd (Southampton, UK). Primers sequences are shown in table 1, those were set to detect the tRNA-Leu(trnL) gene and trnL-trnFintergenic spacer, for chloroplast product accession number (AF303444). PCR efficiency was conducted on a serial dilution of gDNA of Viola. The efficiency range of three different standard curves was between 95-107%.

Dilutions spanned six orders of magnitude 0.2 ng to 20 fg.

Table 1: Oligonucleotide primers used in this assay

Name Purpose Sequence 5' to 3'

Cerc-F Forward Primer GTCGCGACATTTGTATCCAAAA

Cerc-R Reverse Primer CGATGCGAGAGCCGAGAT

Viola-F Forward Primer ATACTTGGTGTGAATTGCAGAATCC

Viola-R Reverse Primer GGCTTCGGGCGCAACT

We used the SYBR Green (SG) method. SG binds to double stranded DNA. Once inserted, it emits fluorescence, which is measured at the end of the elongation phase of amplification of each cycle. The reaction mixture for amplification with a final volume of 20µl consisting of: Precision Master Mix SG 1X (PrimerDesign, Southampton, UK), 0,3µM of each primer and 25 ngof DNA. All amplification reactions were performed in the ABI PRISM7300 Sequence Detection System (Applied Biosystems, France). The amplification program includes 10 min at 95°C, then 40 successive cycles at 95°C for 15 s and 60°C for 1 min.A dissociation protocol is included at the end of the amplification program. It consists of measuring the fluorescence emitted for 20 minutes upon gradual heating from 60°C to 95°C. Thus, the sharp decrease of fluorescence observed when the DNA fragments reach sufficient temperature to be denatured to verify that Tm corresponds to the expected amplicon. The dissociation protocol is a specificity control reaction to assure the presence of one amplicon. Results are shown as positive or negative (Table 4).

4. Results and Discussion

4.1. Results of Macroscopic Study The inspection of the flowers showed:

(5)

• Impurities (pebbles, twigs and spaghetti) and many other plants (Cashew nuts, Crataegus sp., Helichrysum sp., Aloysia triphylla, Myrtus communis, Rosa damascena) were also present (fig.3); this can be attributed to the bad conservation practices.

• Twigs, leaves of Smilax aspera and of Quercus, were also present (fig.3). Those findings confirm that the samples were collected somewhere in the forest from a tree and not from Viola odorata.

• The inspection of the flowers showed short racemes of 3-6 flowers with a slightly toothed calyx and bilabiated unguiculated petals and 10 free stamens (fig.3). Those botanical features characters remind of those of Fabaceae and more precisely flowers of Cercis siliquastrum L. In many samples we also found pods (fig.3), which are the fruit of the Fabaceae.

In order to remove our doubts, we harvested from the nature Cercis siliquastrum. Figure 4 shows the morphological similarity with samples purchased.

4.2. Resultsof Microscopic Study

In our study, and in order to confirm the macroscopic identifications, we have inspected the corollas and calyces of all the 10 samples and compared them with those of fresh genuine flowers of Viola odorata and Cercis siliquastrum obtained from cross sections. The micromorphology of the trichomes and especially of those of the calyces of the samples showed large numbers of non-glandular uni or pluricellular filamentous trichome, non-glandular trichome with verrucose surface, ramified non glandular hairs (fig.7).

All these trichomes are not found in Viola odorata having only different shapes of non glandular unicellular trichome according to our sections and to different published work (fig. 5,6) and are found especially on the calyces of Cercis siliquatrum(tab. 3).

In addition, microscopic examination of the plants show differences in cell shape between samples and Viola odorata collected from nature. The anatomy of the epidermal cells of flowers of several samples of Viola odorata was observed by microscopy.

In samples purchased from herbalists, epidermal cells are polygonal or irregularly shaped (Fig.

8); the walls are straight and curved or wavy. While the study of Viola odorata shows ovoid cells (fig.8).

4.3. Results of DNA Analysis

We used in this following study, a primer of Cercis and a primer of Viola. The table 4 reveals that DNA from natural Viola showed a positive result with primer of Viola, but negative result with the primer of Cercis, that is, hybridization between the primer of Viola and the natural one took place, followed by the amplification of the detected DNA; and this table reveals also that DNA from natural Cercis showed a positive result with primer of Cercis and negative result with primer of Viola.

The first sample which is water shows a negative result with the 2 primers, this proves that the primers used are good.

The analysis of the other DNA samples purchased from different Lebanese herbalists, revealed positive results with the 2 primers of Viola and Cercis. This suggests that the samples from herbalists contain Viola and Cercis. Except for sample 8 that shows a negative result with the primer Viola and a positive result with the primer Cercis, this shows that this sample contain only Cercis.

(6)

Figure 1:Viola odorata (A, B & D) – Cercis siliquatrum (C, E, F & G)

Figure 2: Many types of plants in herbalist shops in Lebanon (H,I), Viola odorata in herbalist shops (J).

Table 2: Sample collection of Viola odorata.

location weight (g)

Price (L.L.)

Part used

Mainly

Adulterated by Other found plants or impurities Tripoli 1 200 3000 Flowers Cercis siliquastrum

(Flowers)

Rosa damascena (Flowers), Cercis siliquastrum (Leaves), twigs

Tripoli 2 200 3000 Flowers Cercis siliquastrum (Flowers)

Smilax aspera (Leaves), spaghetti, pebbels, cashew nuts, twigs.

Poaceae, Salvia fruticosa (Leaves), crataegus sp.

(Leaves), pebbels, Cercis siliquastrum (Leaves),twigs

Helichrysum sp. (Flowers), Cercis siliquastrum (Leaves & pods),twigs

Jbeil 200 3000 Flowers Cercis siliquastrum (Flowers)

Quercus sp. (Leaves), Asteraceae (Flowers), Cercis siliquastrum (Leaves & pods), twigs

Jounieh 200 4000 Flowers Cercis siliquastrum (Flowers)

Aloysia triphylla (Leaves), Smilax aspera (Leaves),Myrtus communis (Leaves), Rosa damascena (Flowers), Cercis siliquastrum (leaves

& pods), twigs, pebbels Rabieh 200 10000 Flowers Cercis siliquastrum

(Flowers) Cercis siliquastrum (Leaves), twigs Aley 200 20000 Flowers Cercis siliquastrum

(Flowers) Cercis siliquastrum (Leaves), twigs Saida 200 4000 Flowers Cercis siliquastrum

(Flowers) Cercis siliquastrum (Leaves), twigs Sour 200 4000 Flowers Cercis siliquastrum

(Flowers) Cercis siliquastrum (Leaves), twigs

(7)

Figure 3: Many impurities (K,L,M,N), Asteraceae (O), Salvia fruticosa (P), Aloysia triphylla (Q), Rosa damascena (R), Smilax aspera (S), Quercus (T), leaves, flowers, twigs, pods of Cercis siliquastum in samples(U).

Figure 4: The tree of Cercis siliquastrum with leaves, flowers and pods

Figure 5: Non glandular unicellular trichome.

(8)

Figure 6: Non glandular unicellular trichome found in various articles [6,7].

Figure 7: Non-glandular uni or pluricellular filamentous trichome (V),-non-glandular trichome with verrucose surface (W), -ramified non glandular hairs (X).

(9)

Figure 8: Cells of Viola odorata (left), cell samples(right), our results compared with those previously published[6,7,8].

Table 3: The different types of trichomes

Types of plants Location Types of trichomes

Samples purchased

Tripoli 1

• non-glandular uni or pluricellular filamentous trichome, Tripoli 2

Tripoli 3

• non-glandular trichome with verrucose surface, Tripoli 4

Jbeil

• ramified non glandular hairs.

Jounieh Aley Rabieh Saida Sour

Viola odorata Nature • non glandular unicellular trichome.

Cercis siliquastrum Nature • non-glandular uni or pluricellular filamentous trichome,

• non-glandular trichome with verrucose surface,

• ramified non glandular hairs.

Table 4: Results of electrophoresis of primers with the analyzed samples

Viola primers Cercis primers

DNA natural Viola + -

DNA natural Cercis - +

DNA natural Viola + -

DNA natural Cercis - +

Sample1 (water) - -

Sample2 (Tripoli) + +

Sample3 (Tripoli) + +

Sample4 (Jbeil) + +

Sample5 (Jounieh) + +

Sample6 (Aley ) + +

Sample7(Rabieh) + +

Sample8 (Saida) - +

Sample9 (Sour) + +

(10)

5. Conclusion

Two major impediments inhibit the efficacy of traditional medicines nowadays: on the one hand, the absence of quality controls adulteration, substitution and improper storage. On the other hand, a lot of controversy exists with regards to the identity of many drugs.

Having come across details about common adulterants and the methods employed for adulteration, an ultimate need for standardization arises, advocated by the provisioning of quality raw material to practitioners, and to the herbal or pharmaceutical manufacturers.

The drug Banafsaj is witnessing great demand. Although leaves and flowers of Viola odorata are reputed to be medicinal, the same parts coming from other Viola species are frequently mixed with drugs and sold in the market as originals. This results in the degrading of the quality and efficacy of the end drug.

Banafsaj was originally imported from Iran and most probably, its original form was the genuine drug Viola odorata. Since the efficacy of the current drug is being questioned, it is becoming vital to discover the actual genuine drug, which had been utilized in the past by herbalists. We hope by doing this to achieve the beneficial proprieties of Banafsaj.

Having considering all the problems and possibilities, it can be concluded that the genuine Banafsaj is Viola odorata that is unfortunately unavailable in our national herbal drug markets.

Macroscopic and microscopic description of samples of claimed Viola odorata L. from several herbalist shops haves shown without any doubt that these samples refer to Cercis siliquastrum L. These two studies, which are very simple, and accessible to everyone at no cost, should be used by the consultants of the Ministries to detect the adulteration.

The study of the DNA has shown traces of the two plants; this is because in macroscopic and microscopic description, we analyzed 20 flowers that referred to Cercis.

We can conclude that the samples sold as "Banafsaj" contain a large amount of Cercis siliquastrum and a small amount of Viola odorata.

References

[1] Mouterde, P., 1970. Nouvelle flore du Liban et de la Syrie; El Machreq, éditeurs Beyrouth, distribution Librairie Orientale Beyrouth, Liban. Tome II, 732 p.

[2] El Beyrouthy, M., 2008. Contribution à l’ethnopharmacologie libanaise et aux Lamiaceae du Liban. Thèse de doctorat. Université Droit et Santé – Lille2. France. 707 p.

[3] El Beyrouthy, M., 2008. Contribution à l'ethnopharmacologie libanaise et aux Lamiaceae du Liban. Acta Botanica Gallica 156 (3), 515-521.

[4] Bown, D., 1995. Encyclopedia of Herbs & Their Uses. Dorling Kindersley Limited, London.

ISBN 0-7513-020-31.

[5] Bustin SA et al. (2009). The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin Chem 55, 611–622.

[6] Akarsu, F., 1989. Morphological and anatomical investigations of naturally occurring subgenus Viola L. synonym Nomimium Ging. in west Anatolia Turkey I. Viola odorata L. Turkish Journal of Botany. 13, 522-529.

[7] Viola odorata L.

http://www.haad.ae/HAAD/LinkClick.aspx?fileticket=bLdWIYRJFZw%3D&tabid=791

[8] Wilkinson, HP. 1979. The plant surface (mainly leaf). In: Metcalfe CR, Chalk L, eds. Anatomy of the dicotyledons, 2^ndedn. Oxford: Clarendon Press, 97–114, 143–161.