JOURNAL OF 108 - CLINICAL MEDICINE AND PHARMACY Vol 10 - Apr/2015
Multiplex PCR assays to detect pathogen-associated genes encoding for Quinolone resistance gene from surgical site infected specimens
Ngo Tat Trung*, Dao Thanh Quyen*, Phan Quoc Hoan*, Thirumalaisamy P Velavan***", Bui Thanh Thuyet', Dao Thi Minh Lan*, Le Huu Song*
' 108 Military Central Hospital
" Institute of Tropical Medicine, Tubingen, Germany.
*** Fondation Congolaise pour la Recherche Medicals, Brazzaville, Republic of Congo.
Summary
Background: Surgical site infection (SSI) is a common problem in Vietnamese post-operative patients and contributes to increased morbidity, mortality, hospitalization time and health care expenditure.
Quinolones are potent antibacterial agents and defined as a critical option for SSI treatment. However, the widespread use of such agents has contributed to the rise of bacterial antibiotics resistance. Previous studies have shown that quinolone resistance arises by mutations in the quinolone resistance- determining regions of the drug targets or overexpression of efflux pumps and/or more recently identi- fied plasmid-mediated low-level resistance mechanisms, in Vietnam, the information about the preva- lence of antibiotic resistance properties (including quinolone resistance genes) is quite outdated. Aim is t o optimize a simple multiplex PCR assay to track plasmid-mediated low-level quinolone resistance pro- files. Result and conclusion: By targeting to the conserved domains of qnrA, qnrB, qnrS, qVC gene families, the primer number was reduced significantly down to only four pairs in one multiplex PCR reaction and by applying our assay to a collection of SSI samples, the first prevalence of fiuoroquinolone-resistance genes {qnrA. qnrB, qnrS, qVQ in Vietnam was reported.
Keywords: Surgical site infection, multiplex PCR assay.
1 . Background peutic regimen, it is essential not only to establish an Hospital acquired bacterial infection is a com- accurate diagnosis of microbes causing SSI but also to m o n problem in post-operative patients and contrib- profile antibiotic resistance.
utes t o increased morbidity, mortality, hospitalization To date, bacterial culture is considered a gold time and health care expenditure. Once a surgical site standard procedure t o identify pathogens that infection (SSI) is detected, relevant antibacte- cause SSI; u p o n t h e emergence of bacterial colonies rial/antifungal therapy will be implemented. However, " ^ i ^ i ^ ^ ' inhibitory concentration (MIC) assays will because of over-use or/and misusage, many bacteria ^ ^ conducted t o clarify resistance. Nevertheless, have acquired resistance t o first-line antibiotics. To w h e n a broad spectrum of prophylactic antibiotics is enhance the efficacy of indicated antibacterial thera- ^'''^^'^V administered before the operation, the resi- due of antibiotics pressure m i g h t hinder the ap- pearance o f colonies in t h e bacterial culture assay.
Correspondence to: Ngo Tat Trung - Department of therefore i m p e d i n g t h e following MIC assay. Hence, Molecular Biology, 108 Military Central Hospital j ^ ^^ essential t o e m p l o y a quick diagnostic proce- Email: [email protected]
36
JOURNAL OF 108 - CUNICAL MEDICINE AND PHARMACY Vol lO-Apr/2015
dure applicable t o clinical settings w h i c h can c o m - p l e m e n t standard procedures of bacterial culture I' o r / a n d MIC testing. Recent advances on nucleic acid testing have o p e n e d up doors for molecular detec- '' t i o n of microbes. One of t h e latest methodologies
employs multiplexing, thus offering a chance not only t o investigate various microbial pathogens causing SSI, b u t also t o quickly detect antibiotic re- sistance genes.
In bacteria, t h e type II topoisomerases DNA gy- rase and topoisomerase IV change t h e t o p o l o g y of DNA. These enzymes cleave b o t h strands of DNA t o allow one double-stranded DNA molecule t o pass t h r o u g h another and t h e n reseal t h e break. DNA gyrase wraps DNA around itself, and so introduces negative superhelical twists into DNA, whereas t o - poisomerase IV does not, and consequently relaxes DNA. Quinolones inhibit these enzymes by stabiliz- ing t h e complex between DNA and DNA gyrase or topoisomerase IV and thus block progression of po- lymerase and DNA replication. The widespread use o f these agents has contributed t o t h e rise of bacte- rial q u i n o l o n e resistance [1]. Previous studies have s h o w n t h a t q u i n o l o n e resistance arises by mutations in chromosomal genes [2] and plasmid-mediated low-level resistance mechanisms {qnrA, qnrB, qnrS, qVQ [3]. These genes have a w i d e geographic distri- b u t i o n (mainly in Enterobacteriaceae) [4-6]. Because o f t h e difficulties o f phenotypic detection of this t y p e o f resistance, its real prevalence is only partially k n o w n . One important point is that although these mechanisms cause only low-level resistance, they favor and c o m p l e m e n t t h e selection of other resis- tance mechanisms [4].
Vietnam is a sub-tropical country where t h e risk o f infectious diseases remains high. In Vietnam, the incidence o f surgical site infections ranges f r o m 10 t o 33% as detected by bacterial culture [7]. A l t h o u g h f e w sporadic reports are available, no conclusive results on t h e existence of resistance phenotypes have been reported. In addition, systematic statistics o n t h e q u i n o l o n e resistance genotypes that cause epidemics are lacking. In this study, w e aim t o de- v e l o p and optimize a multiplex PCR approach t o track plasmid-mediated low-level quinolone resis- tance mechanisms. By applying our assays t o a col- lection o f SSI samples, t h e first prevalence of fluoro-
q u i n o l o n e resistance genes (qnrA, qnrB, qnrS, qVQ in Vietnam can be described.
2. Subject and m e t h o d
Sampling
For this study, we included patients w h o were hospitalized at Tran Hung Dao Hospital, Hanoi, Vietnam from February 2012 t o December 2012 with at least one of these findings: (1) purulent incisional drainage from deep layers of soft tissue within 30 days after the operation or within 1 year after the operation if a pros- thesis was inserted; {2) local signs and symptoms of pain or tenderness, swelling, and erythema, with the incision opened by the surgeon or confirmed by the attending surgeon or physician. Patients provided their written informed consent prior t o participation and the study was approved by the local ethics committee of the Tran Hung Dao Hospital.
Exudates f r o m deep incisional surgical infection sites (aspirate beneath t h e incision area) were col- lected using sterile syringes and, in parallel, sub- jected t o bacterial culture or stored at minus 80 de- grees Celsius for molecular diagnostics.
Ninety one patient samples (n=91) were en- rolled for this study procedure. 44 SSI samples proved t o be bacterial culture positive.
Primer design
In order t o screen for gene encoding important quinolone resistance plasmid (qnrA, qnrB, qnrS, qVC), t h e gene bank accession numbers of t h e qnrA, qnrB, qnrS, and qVC gene families were acquired f r o m http://blast.ncbi.nlm.nih.Qov/Bla5t.cgi and i m p u t e d into Vector NTI software 11.5 (Invitrogen, California).
From that such conserved regions were selected by Vector NTI software and targeted for PCR primer binding. The multiplex PCR assay SHPT@QNR {qnrA, qnrB, qnrS, qVQ was developed and optimized in a way that neighboring PCR amplicons differ f r o m each other by 60 to lOObp, which helps t o resolve the PCR fragments into visible bands in agarose gel electrophoresis. The primer details can be f o u n d in table 1.
JOURNAL OF 108 - CLINICAL MEDICINE AND PHARMACY VollO-Apr/201S
Table 1 . Primers used for amplifying conserved domains of quinolone resistance gene families {qnrA, qnrB, qnrS, qVQ
Primer name
Tr-QnrB-F Tr-QnrB-R Tr-QnrS-F Tr-QnrS-R Tr-QnrCV-F Tr-QnrCV-R Tr-QnrA-F Tr-QnrA-R
Primer sequencing (5' to 3')
TGA(A/G)TTTAT(C/T)GGaG(T/C)CA(G/A)TT(CmTATGATCG CAGGTGCG(A/C)GT(A/G)GTGATCATATTCAT
AACTGCAAGTTCATTGAACAGGGTGATATC AACACCTCGACTTAAGTCTGACTCTTTCA GGGTG{C/DGAI i 11 I L i IA(T/Q(G/T)C(T/G)GATCTT
CTG(T/C)TGCCACGA(G/A)CA(T/G)ATnTrACACC CAAGAGGATTTaCACGCCAGGATTT
CCCC(aA)TCGAGGTTGACCCG
Amplicon size
216bp
357
447
562
Figure 1 . Piiylogenetic alignment of qnrA gene family: qnrAl (AAL50061), qnrA2 (AAT79355) qnrA3 (AAZ04782), qnrA4 (AAZ04783), qnrAS (AAZ04784), qnrA6 (AAZ78355), qnrA7 (ACV83303) to reveai a 5' conserved regions (upper panel) and 3' conserved regions (iower panel) suitable for qnrA gene family the forv»ard/reverse primers.
JOURNAL OF 108 - CLINICAL MEDICINE AND PHARMACY Vono-Apr/2015
Figure 2. Phylogenetic alignment of qnrB gene family with gene bank accession numbers ADM52186, ADM52188, ADM52193, ADM52194, ADQ43424, AEL00450, AEL00451, AEL00452, AEL00456, AEL00458, AEL00459, AEL00461, ZP_06352683, AEL31271, AEL31272, AEQ94272, JQ349151, AFA52645, AFA52644, AFA52646, AFA52647, AFH88686, AFD54601, AFU25656, AFU25658, AB093588, ADW54092, AFR46587, AFR46588, AFR46589, AFR46590, BAN04743, BAN04737, AFY16910 to reveal a 5' conserved regions (upper panel) and 3' conserved regions (lower panel) suitable for qnrB gene family the forward/reverse primers.
JOURNAL OF 108 - CLINICAL MEDICINE AND PHARIMACY Vono-Apr/201S
.rfiFi^rvn- ia„jB;aa;jaaJie^iiJ
£.aBBi7-.(«m)
1
*c Mt »m HBB ftK itUt m«' tan • IM W o >*M" i ~ ^
: j-rTn:Gn:t#KJUCTT«>*31TCMilc»TmTT»U:re:i±Gncu
iriiHirtirt'l^-iiuai.-iBiBaiai^.iigi^l
Figure 3. Piiyiogenetic alignment of qnrS gene family withi gene bank accession numbers: BAD88776, ABF47470, ABU52984, A a 2 4 5 0 9 , AEG74319, AEG74318 conserved regions (upper panei) and 3' conserved regions (iov<er panei) suitabie for qnrS gene family the forv^ard/reverse primers.
JOURNAL OF 108 - CLINICAL MEDICINE AND PHARMACY Vol lO-Apr/2015
Figure 4. Phylogenetic alignment of qnrVC gene family with gene bank accession numbers: ACC54440, ADI81040, AD155014, AEM62764 conserved regions (upper panel) and 3' conserved regions (lower panel) suitable for qnrS gene family the forward/reverse primers.
DNA extraction and Multiplex PCR
Aliquots of exudates from SSls were allocated for total bacterial culture, t h e remnants were im- mersed into universal lysis solution (200mM NaOH, 1%SDS) and heated for 5 minutes at 95''C. An equal v o l u m e of I M Tris-HCl was also added t o neutralize t h e pH d o w n t o about 7.5. The resulting solution
was subjected t o standard p h e n o l / c h l o r o f o r m / iso- amyl alcohol extraction. Precipitated DNA was re- constituted in ISOpl TE {25mM Tris-base, pH 8.0, I m M EDTA). 5pl of t h e reconstituted DNA was used as template for multiplex PCR in 25ul reactions con- taining l O m M Tris-HCl (pH 8.3), 50mM KCl, I.SmM Mg^+, 250pM of each deoxynucleotide triphosphate and optimized a m o u n t of individual primers. Ther-
41
JOURNAL OF 108 - CLINICAL MEDICINE AND PHARMACY VollO-Apr/201S
mal cycling amplification was carried out as follow- ing: initial denaturation at 95°C for 4 minutes, 35 cycles o f 94''C for 25 seconds, SS^C for 45 seconds, and 72 for one minute.
Confirmatory sequencing of amplicons
To avoid false positive results due to cross- reactivity of the selected primer pairs with human DNA, amplified products were cleaned up and subjected t o bidirectional PCR sequencing. The outcome was com- pared to an annotated gene-bank database (Blast search http://blast.ncbi.nlm.nih.gov/Blast.cqi) t o iden- tify human genomic information.
3. Result
SIHPT@QNR multiplex assay reliably differenti- ates betweer) qnrA, qnrB, qnrS, and qVC positivity
As shown in figure 5, individual amplicons de- rived f r o m multiplexing differ from one t o the other by 60 t o lOObp and do not generate any unspecific bands, allthe PCR fragments were resolved into visi- ble bands in agarose gel electrophoresis.
Figure 5. Multiplex PCR assays {SHPT@QNR) to screen for plasmid-mediated low-level resistance mechanisms
{qnrB, qnrS, qVC).
Screening patient samples for quinolone resis- tance utilizing the SHPT@QNR assay
After optimizing t h e amplifying conditions for t h e SHPT@QNR assay (figure 5), t h e multiplex PCR reaction was used t o screen for either potential qui- nolone resistance gene {qnrA, qnrB, qnrS, qVQ from all 44 bacterial culture positive SSI samples (out of 91 suspected SSI biopsies). As seen in table 2, 3 out of 44 SSI samples harbor genetic material: NKSM 33 {qnrB, qVC), NKSM40 (qnrB), NKSM55 (qnrS) encoding for either qnrB, qnrS, qVC.
T a b l e 2. Prevalence of q u i n o l o n e resistance g e n e f a m i l i e s : qnrA, qnrB, qnrS, gUC w i t h i n recruited 551 samples
Detected quinolone resistance Detected betalactamse genes by
BacterialSSI ID qnrA qnrB qnrS qVC N D M 1 SHV CTX-M TEM
E coli, P-
Kleb
Positive Positive NKSM 55 P aungninosa
J L
Positive Positive Positive Positive Positive Positive Positive Positive
Positive
JOURNAL OF 108 - CLINICAL MEDICINE AND PHARMACY VollO-Apr/2015
Patient samples presenting one or m o r e qui- nolone resistance genes also present beta- lactamase capabilities
Our data also showed that presence of q u i - nolone resistance genetic material coincided w i t h presence o f genes encoding for broad range beta- lactamase activity, for instance SHV, TEM, CTX-M or/and carbapenemase ( N D M - l ) (the detail o f those data will be shown in another report).
4. Discussion
Hospital acquired bacterial infections paired w i t h antibiotic resistance is a major contemporary public health threat, especially in developing c o u n - tries like Vietnam, where t h e medical infrastructure is sub-standard and utilization of antibiotics is barely regulated. So far, local specific epidemiological data o n hospital infection and acquired bacterial antibi- otic resistant property were only sporadically re- p o r t e d [8]. In this situation, relevant diagnostic methodologies for m o n i t o r i n g bacterial infection are needed. Together w i t h bacterial infectivity, nosocomial infections related antibiotic resistance is also o f public concern and raises a quest t o suitable tracking tools. From t h e experience revealed during clinical performance in our institution, we have been suspecting the existence of such microorganisms carrying t h e extended spectrum betalactamese or carbapenemese capability, as well as quinolone re- sistance. However, once t h e patients have received prophylaxis, broad range antibiotic pressure m i g h t inhibit t h e colonial g r o w t h in bacterial culture test- ing. This is w h y culture-based antibiotic resistance assays, like m i n i m u m inhibitory concentration tests, often can't be carried o u t in a clinical setting. This way emerging antibiotic resistance is covered up until it has been deeply entrenched in the bacterial p o p u l a t i o n .
The recent emergence of so-called nucleic acid based detection m e t h o d o l o g y has opened possibili- ties t o n o t only quickly track for t h e presence of dif- ferent microbial pathogens only present in limited numbers, b u t also t h e genes encoding for antibiotic resistance. A challenge establish PCR in the clinic is t h e diversity o f genetics materials coding for antibi- otic resistance; since a single PCR reaction can only
detect one genotype, t h e number o f PCR reactions proportionally increase w i t h t h e diversity level of antibiotic resistance, p u t t i n g a strain o n resources like time, manpower, and money. Multi-primer for- mat is an o p t i o n here, however t h e increase in pri- mer numbers w o u l d force t h e m t o compete each- other and/or create a risk of unspecific signals. In this study, w e designed primers complementary t o conserved regions of relevant antibiotic resistance gene families, therefore reducing the primer n u m - ber and ending up w i t h only four primer pairs that still possess the capacity of detecting 51 different genotypes of quinolone resistance gene families.
By applying our assay, w e see members of qnrB, qnrS, qVC not only exist in given SSI samples b u t also co-occur w i t h other genes that account for broad range betalactamase or carbapenemase, hence ex- plaining t h e existence of multi-drug resistance in bacteria in Vietnam.
5. Conclusion
In summary, we report t h e establishment of a seven primer optimized multiplex PCR assay that is relevant for screening c o m m o n gene families that confer quinolone resistance for bacteria. For t h e first time, the prevalence of quinolone resistance geno- types, qnrB, qnrS, qVC has been reported in Vietnam.
Acknowledgements
We w o u l d like to acknowledge the f u n d i n g f r o m KC.10-43/11 -15 for this study
Conflict of interests
The authors declare no conflict of interests in this study.
Kim, ES and DC Hooper (2014) Clinical importance and epidemiology of quinolone resistance. Infect Chemother 46(4)'226-238.
Hawkey, P.M. and A.M. Jones (2009) The changing epidemiology of resistance. J Antimicrob Chemo- ther 64 SuppI 1:3-10.
JOURNAL OF 108 - CLINICAL MEDICINE AND PHARMACY A p r / |
Nordmann, P. and L. Poirel (2005) Emergence of plas- mid-mediated resistance to quinolones in Enterobacte- riaceae. J Antimicrob Chemother 56{3); 463^^9.
Robicsek A, GA Jacoby, and DC Hooper (2006) The worldwide emergence of plasmid-mediated qui- nolone resistance. Lancet Infect Dis 6(10): 629-640.
Paauw, A, et al (2007) Failure to control an outbreak of qnrAl-positive multidrug-resistant Enterobacter cloacae infection despite adequate Implementation of recommended infection control measures. J Clin Microbiol 45(5): 1420-1425.
Liu J, et al (2015) The diss- <^°^^ of^f resistant genes In Enterc joacae. IndiJ Med Microbiol 33 SuppI: fc'/-92.
Nguyen, D, et al (2001) Incidence and predict^
surgical-site infections in Vietnam. Infect C o ^ Hosp Epidemiol 22(8): 485-492.
Nguyen KV, et al (2013) Antibiotic use and H tance in emerging economies: A situation onu^j for Viet Nam. BMC Public Health 13:1158.
