To Professor Mahmoud Soliman and Dr. Muthusamy Ramesh of the Molecular Biocomputing and Drug Design Laboratory at the University of KwaZulu-Natal for assistance with computational research. dr. Ravesh Singh for help with the bioinformatic analysis of the gyrA sequencing results.
INTRODUCTION
Background and research rationale
Aims
Objectives
LITERATURE REVIEW
A brief history of antibiotic discovery
This approach has been improved and resulted in the development of the iChip, a device that allows the high-speed cultivation of several bacterial species simultaneously14,31,32. Pharmacophore modeling and quantitative structure-activity modeling (QSAR) are two of the most popular ligand-based ones.
A brief history of antimicrobial resistance
Infections due to antimicrobial resistant pathogens have a significant clinical and economic impact that is of increasing concern worldwide13,74. The collective costs that antimicrobial resistance will impose on the global economy are estimated at $100 trillion per year13,19,29,77.
Background to the problem of Mycobacterium tuberculosis
Another serious consideration is the re-examination of natural compounds that were previously discovered but were not considered high-quality leads at the time and therefore never reached the market.
A brief history of antimycobacterial discovery
By comparing the genome of the wild type and the mutant, the mechanism of resistance (MOR) can be elucidated. A common approach to elucidate the MOA is to "knock out". the implicated gene in a wild-type organism and then compare its in vitro susceptibility to the test compound with that of the wild-type organism.
Nybomycin
In 1961, Rinehardt et al described the chemical structure of nybomycin as well as one of its degradation products, deoxynibomycin149. Dokkie simulation studies by Hiramatsu et al showed that the loss of the serine residue in position 84 of GyrA from S.
METHODS
Drug susceptibility testing
- Isolate selection
- Retrieval of isolates from storage
- Preparation of working cultures
- Screening with the MTT assay
- Screening with the multipoint inoculator method
- Further drug susceptibility testing with the MTT assay
Each antibiotic stock solution was therefore prepared by adding 0.8 ml of solvent (Table 3.2) to the weighed antibiotic powder. Four milliliters of stock solution was added to the first container and twofold serial dilutions were made by removing 2 ml from the first container and adding it to the second container. It was then thoroughly mixed by pipetting up-and-down five times, and then 2 ml was transferred to the third container.
In the same way, the media was added to the five containers containing 2 ml of PBS without any antibiotics. Two hundred microliters of this antibiotic working solution was added to the first well, and twofold serial dilutions were performed by transferring 100 µl from the first well to a second well filled with 100 µl of Middlebrook 7H9 broth. The resulting 200 μl was mixed by pipetting up and down three times and then 100 μl was aspirated and transferred to the third well.
One hundred microliters was then removed from the second well and transferred to the third well.
DNA isolation
- Bacterial cultures
- DNA isolation with the cetyltrimethylammoniumbromide method
- Estimation of DNA purity, concentration and quality
It was then carefully mixed by inverting the tubes several times so that the precipitated DNA could be seen as a thin thread. A casting tray and 20-well plastic comb were cleaned with 70% alcohol, followed by proper positioning of the plastic comb within the casting tray. The open ends of the tray were then secured with masking tape to prevent the gel from leaking out of the tray.
The final 1% agarose solution was prepared by adding 1.4 grams of agarose (Seakem LE Agarose, Whitehead Scientific, SA) to 140 ml of the 1X TBE buffer. Then, the DNA was mixed inside its tube by lightly tapping it with a finger a few times, and then 1 µl of the DNA was transferred directly to the drop of gel loading dye. The gel was then covered with a lid so that the negative (black) cathode was placed closest to the DNA samples in their wells and the positive (red) anode was placed furthest from the DNA samples.
The size and brightness of the bands were compared with a molecular weight marker as a rough estimate of DNA quality and quantity.
Genotyping using IS 6110 restriction fragment length polymorphism
- Restriction
- Gel electrophoresis
- Southern blotting
- Hybridization
- Washing of membrane
- Detection of banding patterns
- Reading and interpretation of results
The gel was then discarded and the membrane was carefully lifted and removed from the vacuum cleaner and placed on paper towels to air dry for five minutes. The membrane was then briefly irradiated under ultraviolet light in the UVP-CL1000 cross-linker (Ultra-Violet Products, Cambridge, UK) in order to strengthen the cross-links between the DNA fragments and the nylon membrane. The pre-hybridization buffer was decanted into a sterile glass vial and the full volume of the hybridization probe solution was then added.
The resulting hybridization buffer was added to the hybridization cylinder and the membrane was allowed to hybridize overnight in the rotary hybridization oven at 6 rpm and 42 oC. The hybridization buffer that was used overnight was discarded and the nylon membrane was rinsed with 30 ml primary wash buffer, which was also immediately discarded. The primary wash buffer was discarded and the nylon membrane was rinsed twice with secondary wash buffer (2XSSC) for 5 to 10 min at room temperature on a Stuart Orbital SSL1 shaker (Cole-Parmer, Illinois, USA).
Next, the membrane was placed in a cassette with Amersham Hyperfilm ECL (Amersham-GE Healthcare Life Sciences, UK) and the film was exposed to the membrane for two minutes.
- Polymerase chain reaction
- Gel electrophoresis of PCR product
- Gene sequencing, reading and interpretation of results
The software package BioNumerics version 6.0 (Applied Maths, Sint-Maartens-Latem, Belgium) was used to visually analyze IS 6110 RFLP band patterns. This software was also used to construct a dendrogram that approximates the degree of similarity between band patterns197,198. IS 6110 RFLP genotype patterns were compared to stored profiles at the University of KwaZulu-Natal and the University of Stellenbosch for IS 6110 RFLP family designations199,200.
Isolates in an IS 6110 RFLP family usually share at least two-thirds of their band patterns and therefore a similarity index of at least 70% was used to designate an IS 6110 RFLP family199,201. The different components of the master mixture were first aliquoted into PCR tubes (on ice) together with the primers, followed by the addition of extracted DNA. After preparation of the master mixture and addition of DNA, the final reaction mixture was loaded into the GeneAmp PCR System 9700 thermal cycler (Applied Biosystems, San Diego, USA) and the DNA was amplified according to the cycling conditions described in Table 3.11.
Gel electrophoresis and the Nanodrop instrument were used to estimate the purity, concentration and quality of each amplicon, as described in section 3.2.3.
Computational investigations
- Molecular docking investigations
- Molecular dynamics simulations
- Selection of M. tuberculosis mutants with increased nybomycin MICs
- Whole genome sequencing of M. tuberculosis mutants with increased
- Bioinformatics analysis of whole genome sequencing results
The LibDock module of the Discovery Studio software package was used for simulating molecular docking208,209. The entire 200 µl volume of each of the 20 cultures was plated and spread on a separate antibiotic-containing plate. Similarly, the entire 200 µl volume of each of the five positive control cultures was plated and spread on separate antibiotic-free plates.
DNA extraction was performed using the CTAB method and the quality of the extracted DNA was confirmed using gel electrophoresis and the Nanodrop instrument, as described in sections 3.2.2 and 3.2.3. It further includes adapter regions that are either the same (i5) or complementary (i7) to the oligonucleotides fixed to the surface of the flow cell slide used downstream during cluster formation. The pooled single-stranded DNA library was loaded into a flow cell of the built-in cluster module in the MiSeq instrument.
Single nucleotide polymorphism (SNP) calling was performed for each of the samples using Samtools software239,240.
RESULTS
Introduction
In vitro inhibitory effect of quinolones on various bacterial species 87
- Neisseria gonorrhoeae, Escherichia coli, Klebsiella pneumoniae,
The results of drug susceptibility testing obtained with Middlebrook 7H10 agar dilution and multi-spot inoculation were used to categorize M. Therefore, the MTT assay was used a second time to verify the results obtained with. The final nybomycin and DNM-2 MIC results are shown in Table 4.3 and the raw data for the MIC assays appear in Appendix B.
From these results, there appears to be no direct or inverse relationship between MIC (µg/ml) values obtained for ofloxacin, nybomycin and DNM-2 with any of the. MIC values with nybomycin ranged between 0.25 and 8.0 µg/ml and showed no direct or inverse relationship with MIC values of the quinolones. The mostly high MIC values obtained with quinine, chloroquine, mefloquine and primaquine provided insufficient incentive for further investigation of these drugs against N.
All Gram-positive and Gram-negative isolates showed chloroquine and primaquine MIC values of > 128 µg/ml.
In silico effect of nybomycin and DNM-2 on M. tuberculosis gyrase
- gyrA QRDR sequencing
- Molecular docking investigations
- Molecular dynamics simulations
However, both XDR isolates from the LCC F150 RFLP family had no mutations in the QRDR of gyrA. Nybomycin, DNM-2 and ciprofloxacin ligands were subsequently designed using the ChemBioDraw software tool (CambridgeSoft, Massachusetts, USA) and oriented between DNA residues, corresponding to moxifloxacin210. LibDock scores for nybomycin, DNM-2, and ciprofloxacin were compared to the results obtained with the validated moxifloxacin complex, and all three ligands exhibited scores higher than those obtained with moxifloxacin.
The binding free energies (kcal/mol) of nibomycin and DNM-2 were evaluated by comparison with ciprofloxacin. Both nibomycin and DNM-2 showed strong binding affinities to both wild-type and mutant gyrase, with values between -39.21 and -45.46 kcal/mol for nibomycin and between -28.50 and -44.87 kcal/mol. mol for DNM-2. In addition, Gly1237 and Asp1238 were key residues for nibomycin and DNM-2, but not for ciprofloxacin.
Residues considered to be key in only one of the ligands were DA1482 with nybomycin.
Investigation of M. tuberculosis mutants with increased nybomycin
Gene variants unique to each of the ten mutant isolates were also filtered out unless they occurred in the same gene. The final list of 22 genes with one or more gene variants potentially associated with phenotypic resistance to nibomycin is presented in Table 4.10, on pages 105 to 108. APVP L inframe conservative insertion A ATCGGGACCGGTGCGCCAGGGG - TPGAPVP.
DISCUSSION AND CONCLUSION
In vitro inhibitory effect of quinolines on various bacterial species 109
- Neisseria gonorrhoeae
With molecular dynamics studies, investigation of binding affinity between ligands and wild-type M. In this study, a missense mutation together with a conservative inframe deletion was detected in this gene for two of ten M. In the present study, a frameshift variant was detected in this gene for three out of ten M.
This study identified several conservative and disruptive inframe insertions in this gene for a number of the ten M. In two of the ten M, a frameshift variant, stop-lost and splice region variant were identified in this gene. The in vitro studies did not identify a 'reverse antibiotic effect' in any of the cases.
Evaluation of the GenoType MTBDRsl version 2.0 test for the detection of second-line drug resistance of Mycobacterium tuberculosis isolates in South Africa. Protein kinase A (PknA) of Mycobacterium tuberculosis is activated independently and is critical for in vitro growth and survival of the pathogen in the host. The role of the kinases Pkna and Pknb in Mycobacterium tuberculosis (PhD thesis). Wayne State University, Detroit, Michigan, 2014).
