• Tidak ada hasil yang ditemukan

Directory UMM :Data Elmu:jurnal:A:Aquaculture:Vol186.Issue1-2.Jun2000:

N/A
N/A
Protected

Academic year: 2017

Membagikan "Directory UMM :Data Elmu:jurnal:A:Aquaculture:Vol186.Issue1-2.Jun2000:"

Copied!
12
0
0

Teks penuh

(1)

Ž .

Aquaculture 186 2000 1–12

www.elsevier.nlrlocateraqua-online

Single and joint gene segregation in intraspecific

ž

/

hybrids of brown trout Salmo trutta L. lineages

Chantal Poteaux

a,)

, Rene Guyomard

b

, Patrick Berrebi

a

´

a

Laboratoire Genome et Populations, CNRS-UPR 9060, Uni´ Õersite Montpellier II, Cc63, Place Eugene´ `

Bataillon, 34 095 Montpellier Cedex 05, France b

INRA, Laboratoire de Genetique des Poissons, CRJ, 78352 Jouy-en-Josas Cedex, France´ ´

Accepted 20 November 1999

Abstract

Ž .

Brown trout Salmo trutta L. stocking practices in French Mediterranean rivers often result in artificial secondary contact and introgression between substantially differentiated genomes. Single and joint segregation at five protein and four microsatellite loci were analysed in two back-crosses

Ž .

between hybrid females resulting from domestic=Mediterranean genitors and hatchery males in order to test whether there is genetic incompatibility and selective phenomena between the genomes. Three crosses between hatchery genitors were performed and followed in the same time

Ž . Ž .

to measure and compare survival among back-cross 2 and hatchery 3 families. Only one of 23

Ž .

single segregation tests LDH-5 for family 2 was significant with an excess of allele of the

domestic origin in the F hybrid. Out of 70 joint segregation tests, only six were significant. One1

Ž .

segregation corresponded to ‘‘weak’’ associations involving one microsatellite locus Strutta-24

Ž . Ž .

and one enzyme FBP-1 . One case Strutta-24 and Strutta-12 was clearly caused by differential maternal transmission of alleles. Even if the question of a breakdown of fitness is only addressed in the hatchery environment, these results showed the existence of events during meiosis, which have affected the allelic transmission for hybrids of the two genomes.q2000 Elsevier Science B.V. All rights reserved.

Keywords: Brown trout; Back-crosses; Microsatellite; Allozymes; Segregation; Salmo trutta

)Corresponding author. L.E.E.C, Universite Paris-Nord, 93 430 Villetaneuse. Tel.:´ q33-01-49-40-39-54; fax:q33-01-49-40-38-93.

Ž .

E-mail address: [email protected] C. Poteaux .

0044-8486r00r$ - see front matterq2000 Elsevier Science B.V. All rights reserved. Ž .

(2)

1. Introduction

Ž . Ž

The brown trout Salmo trutta L. occurs in two geographical forms in France Krieg

.

and Guyomard, 1985 , the Mediterranean form and the Atlantic form, which are

Ž

assumed to have diverged in allopatry almost 50,000 years ago estimated from mtDNA

.

data in Bernatchez et al., 1992 and Giuffra et al., 1996 . Their Nei’s genetic distance

Ž .

based on allozymic data is high, averaging 0.10 Guyomard, 1989 . Their coexistence in rivers of the Mediterranean basin is generally artificial and caused by secondary contact through human stocking with domesticated strains of Atlantic origin.

Ž

Several protein-coding loci discriminate between the two forms Guyomard, 1989;

.

Poteaux et al., 1998 . It is, therefore, possible to estimate the genetic impact of

Ž

domesticated introductions. Studies of stocked populations of brown trout Krieg and Guyomard, 1985; Barbat-Leterrier et al., 1989; Largiader et al., 1996; Poteaux and

.

Berrebi, 1997 have shown that hybrids, recombined for two or more generations, are frequent in rivers. Although F1 hybrids display good survival and fecundity under

Ž .

controlled conditions Guyomard, 1997; Mezerra, unpublished data , introgression is a limited process, in natura, and is often associated with deviation from Hardy–Weinberg

Ž

expectations and linkage disequilibria Barbat-Leterrier et al., 1989; Poteaux and

.

Berrebi, 1997 .

One of the hypotheses put forward to account for the low levels of introgression and the numerous disequilibria observed in natural populations involves selective pressures

Ž .

acting against F1 or recombined individuals F2 or back-crosses . These selective

Ž .

processes may be caused by two types of genetic mechanism: i additive selection, acting against several independent loci; in this case, some genes of domesticated strains

Ž .

may be unsuited to local conditions and tend to be eliminated in rivers; or ii selection acting on epistatic interactions among genes or on complexes of co-adapted genes set up during the divergence time of the taxa. Such selection would tend to prevent the disruption of these co-adapted complexes which may occur during hybridisation.

Ž . Ž .

According to Hunt and Selander 1973 and Mayr 1974 , the existence of such groups of co-adapted complexes may have acted as an effective brake on introgression, even in the absence of a behavioural barrier.

The high mutation rate of microsatellites, and their expected selective neutrality are

Ž .

favourable characters for pedigree and linkage studies Hearne et al., 1992 . The number of available loci is also high: in brown trout, rough estimates of the number of the motifs

ŽGT.n and CTŽ .n give a total of about 150,000 Estoup et al., 1993 . As a consequenceŽ .

of their high heterozygosity level and large genetic differences between individuals, the number of informative parents is larger than with protein-coding loci, which display a much lower polymorphism level.

(3)

( )

C. Poteaux et al.rAquaculture 186 2000 1–12 3

significant deviation from expected proportions is discussed with respect to linkage or selection.

2. Material and methods

2.1. Experimental protocol

F individuals were obtained by crossing females of an experimental domesticated1

Ž .

stock INRA with wild Mediterranean males from the Reverotte River, a tributary of

`

the Doubs River. The INRA strain was funded six generations ago from fish farm strains

Ž .

of different origin and immediately closed no introduction latter . The strain is propagated over generations, with a large effective size, 60 males and 60 females, per

Ž

generation. The initial level of variation is high Krieg and Guyomard, 1985; Estoup et

.

al., unpublished and according to the effective population size, very little increase of inbreeding and relatedness is expected. Populations from the Doubs basin are

Mediter-Ž . Ž .

ranean trout, as shown by Presa et al. 1994 and Largiader et al. 1996 . Moreover, genotyping of 50 F with several loci confirmed that all males used for the crosses1

Ž .

belong to the Mediterranean form Guyomard, 1997 . No relatedness exists between domestic and Mediterranean trout.

Two types of crosses were performed using unrelated mates, the offspring of each

Ž .

mate constituting a numbered set given below .

Ž .

- Two crosses involving a hybrid F female fH1 and fH2 and a domestic male1 ŽmD1and mD2 . Hereafter, these crosses will be named BC1 and BC2 despite the fact.

Ž

that they are not true back-crosses the F female is not back-crossed with its male1 .

parent .

Ž .

- Three intra-strain crosses hatchery female=hatchery male : Control 1, Control 2

Ž .

and Control 3 domestic males 1 and 2 are the same as for BC1 and BC2 . These families were used as controls to interpret the survival rates in back-crosses.

Hatching took place from 29 to 30 January 1994. Approximately 300 eyed eggs were

Ž .

analysed by Guyomard 1997 in another experiment and 300 eyed eggs were sent at

Ž .

3308C=days eyed stage in Table 1 to the Mas de Merou fish farm. These 300 fry per

´

family were maintained in separate incubation tanks. The fry mortality was recorded

Table 1

Ž .

Survival rate Ts of backcrosses and control intra-strain families

Family name Breeding scheme T at 13 days T at eyed stage T at 30 days T at 2 months T at 6 monthss s s s s

BC indicates the set of backcrosses analysed. F1 hybrid female are identified as fH; domesticated females

Ž . Ž

and males as fD and mD respectively. Survival rates Ts for progeny are indicated in percentage the raw data

.

indicated in brackets , at different stages.

b Ž .

(4)

from hatching until 6 months after hatching. Dead fish were counted daily and

Ž

differences in survival rate between controls and back-cross were tested by ANOVA 1

.

factor, STATGRAPHICSqfor Windows software .

2.2. Methods to describe protein and microsatelliteÕariation

Allozymes: individuals were genotyped for the following allozymic loci: AAT-4,

LDH-5, FBP-1, IDH-3 and MPI. Electrophoresis was performed on horizontal 12%

Ž .

starch gel; staining buffers were similar to Beaudou 1993 .

Microsatellite loci: we analysed four microsatellite loci: Strutta-12, Strutta-58 and

Ž .

Strutta-24 were obtained from a genomic library at our laboratory Poteaux, 1995 . The

sequences of the primers used are:

for Strutta-24sR: GACAGGGTCATTGATGTCATC and F:

CACGGGAATACA-CACACGTG;

for Strutta-12sR: AATCTCAAATCGATCAGAAG and F:

AGCTATTTCAGA-CATCACC;

and for Strutta-58sR: AACAATGACTTTCTCTGAC and F:

AAGGACTTGAAG-GACGAC.

We also used MST-15 from the INRA laboratory: Rs

TGCAGGCAGACGGATC-Ž .

AGGC and FsAATCCTCTACGTAAGGGATTTGC Estoup et al., 1993 .

Total genomic DNA was isolated from a piece of muscle using the standard

Ž .

phenol-chloroform methodology Sambrook et al., 1989 . DNA from parents and back-cross individuals was amplified using the g-33P radioactive PCR reaction

accord-Ž .

ing to the protocol in Garcia de Leon et al. 1995 . PCR products were electrophoresed through a 6% denaturing polyacrylamide sequencing gel.

Only nine of the 11 wild parents used to produce hybrids were genotyped in this study. We assumed that the alleles observed both in the wild individuals and the hybrids are the same and originate from the wild individuals.

2.3. Statistical analysis of segregation data

Single-locus segregation and joint segregation between all loci were tested with chi-square tests for heterogeneity between loci or individuals using the general

proce-Ž .

dure described by Mather Mather, 1951; May et al., 1979 . The alleles of the two loci

Ž X X

.

involved in a comparison of segregation are referred to by letters A, A , B and B . The symbols and statistics used are detailed below. For the mating AABB=AAXBBX:

a1sobserved AABB progeny; a2sobserved AABBX progeny; a3sobserved AAXBB progeny; a4sobserved AAXBBX progeny

Ž .

(5)

( )

C. Poteaux et al.rAquaculture 186 2000 1–12 5

The chi-square tests for departure from 1:1 segregation at both loci were tested as:

2 Ž .2 2 Ž .2 Ž .

xAs a1qa2ya3ya4 rN and xBs a1ya2qa3ya4 rN dfs1 .

To test the departure from independent segregation of the two loci involved, we used:

2 Ž .2 Ž .

xABs a1ya2ya3qa4 rN dfs1 . Here, r is the fraction of non-parental

geno-w Ž . Ž .

types assuming the largest class, either a1qa4 or a2qa3 represents the parental

. Ž . Ž . x

genotypes , and rs a1qa4rN or a2qa3rN .

Goodness-of-fit x2 also was employed to test the transmission of wild versus

domesticated alleles by each hybrid female.

3. Results and discussion

3.1. SurÕiÕal rates

Ž .

The survival rates T of progeny at different stages are reported in Table 1. There iss

no statistical difference of survival rates between back-cross progenies, between control

Ž .

intra-strain family and between back-cross and controls by ANOVA at the four early development stages. For the survival rate at 6 months, the control intra-strain family 3 exhibited a significantly higher survival rate than the control 1 and 2. If we exclude the results of control intra-strain family 3, survival rates between back-cross progenies and controls became significant.

The non-significant differences of survival rates at key stages led us to expect that the presumed incompatibility acting on the recombination of the genomes was weak, as

Ž .

proposed by Guyomard 1997 . This author reported that fertility appeared to be normal for both male and female F hybrids. Back-crosses are as viable as control individuals in1

Ž .

hatchery conditions Guyomard, 1997; our data and progeny were sacrificed to 6

Ž .

months of age when the survival rates were still high Table 1 .

3.2. Single locus segregation

We analysed 174 fry in BC1 and 160 in BC2. All microsatellite loci displayed Mendelian segregation in conformity with the expected proportions of 1:1 or 1:2:1

ŽTable 2: 12 and 10 tests in BC1 and BC2, respectively . Although the test of all the.

Ž .

data was not significant Bonferroni test, Rice, 1989 , significant non-Mendelian

segre-Table 2

Genotypes of genitors for allozyme and microsatellite loci

Mendelian segregation was tested in conformity with the expected proportions of 1:1 for underlined loci and expected proportions of 1:2:1 for double underlined loci.

Allozyme loci Microsatellite loci

AAT-4 FBP-1 IDH-3 LDH-5 MPI Strutta-12 Strutta-58 Strutta-24 MST-15

fH1 100100 100150 100100 100105 100105 1–2 1–3 1–4 1–2

a

mD1 65100 100100 100100 100105 100105 3–5 4–6 5–n 2–4

fH2 100100 100150 100130 100105 100100 1–2 1–5 3–n 2–4

mD2 100100 100150 100100 100100 100100 4–6 1–2 2–n 3–4

a

(6)

Ž .

gation was observed at LDH-5 for the BC2 hybrid female Table 3 . This was due to an

Ž .

excess of LDH-5)90 domestic allele over LDH-5)100 ‘‘wild’’ allele. Taggart and

Ž .

Ferguson 1984 found only Mendelian segregation at this locus. Their results are not incompatible with ours, since they analysed crosses between more closely related brown trout forms, namely ancestral and modern Atlantic populations. Their allele 100 at the

LDH-5) locus originated from a wild landlocked ancestral population in the Atlantic

Ž

basin and not from the Mediterranean basin as in our crosses Ds0.1 between Atlantic

.

and Mediterranean forms . The second family BC2 did not show any similar deviation at this locus. However, the number of informative individuals in BC1 is much lower since both parents are heterozygous for the same alleles at LDH-5. Hence, the aberrance of segregation at this locus should be confirmed in other hybrid parents.

LDH-5 is a diagnostic locus between Mediterranean trout and domesticated strains. It

is not impossible that the allele of domesticated origin or the chromosomal region surrounding this allele conferred an advantage in the hatchery conditions of the

Ž

experiment, whereas it may have conferred a disadvantage in natural conditions Poteaux

.

et al., 1998 . Indeed, selective influences at protein-coding loci have been suggested to

Ž

explain the spatial pattern of gene frequencies of several species of fish Verspoor and

.

Jordan, 1989; Powers et al., 1991 . Experimentally, it has been shown with poıkilo-

¨

therms that the functional differences among allozymes of numerous loci could result in

Ž

different selective values Philipp et al., 1985; Powers et al., 1991; Kirpichnikov, 1992;

.

Jordan et al., 1997 . In the case of brown trout, differences in enzyme affinity for the substrate were found only between the alleles of the locus LDH-5 by Henry and

Ž .

Ferguson 1985 . It has been suggested that these differences may explain the almost total colonisation of the open basins of the North Atlantic watershed by the modern

Ž .

Atlantic form Hamilton et al., 1989 .

Analysis of Strutta-24 allele segregation in offspring led to the inference that the two

Ž .

domesticated males mD1 and mD2 in BC1 and BC2, respectively; Table 2 and the hybrid female fH2 in BC2 were all heterozygous for a null allele. We also inferred that the null allele in the hybrid female fH2 came from her domesticated parent, since two of three parents from the fish farm possessed a null allele at this locus. In BC2, each individual bred for the back-cross possessed a null allele and the allelic segregation resulting from this mating was tested. Segregation was in conformity with Mendelian proportions and the overall test of heterogeneity on the entire set of data is not significant. The latter test showed that the null allele is transmitted as well as the other allele.

Goodness-of-fit tests were performed for each female to compare alleles of wild and domesticated origin for allozymes, for microsatellite loci, and for both together. None of the 13 tests was significant, and we did not observe any tendency of the hybrid female to transmit one allele rather than another.

Finally, no new mutation was detected among the meioses analysed, that is to say, 1360 constitutions of monolocus genotype analysed for BC1 and 1174 for BC2.

3.3. Joint segregation

Ž .

(7)

()

Joint segregation data of loci combinations found to exhibit statistically significant linkage

A, AX, B and BX represented possible gametes for the informative parents. AB, ABX, AXB, and AXBX represented each type of gametic associations for the parent

X X Ž .

analysed. AB and A B represented parental gametic associations in each case hybrid female and domestic male . In hybrid females, alleles of Mediterranean origin were underlined; all the other alleles are of domestic origin.

X X X X 2a 2b 2c d e

AAs100r105 BBs1r2 AAs100r105 BBs2r4

U

fH1 St24 St12 St24 St12 38 47 47 29 0.5 0.5 4.52 0.52 161

X X

AAs1r4 BBs1r2 AAs5rn BBs3r5

U

fH1 St24 FBP St24 FBP 27 41 44 33 0.56 0.06 4.31 0.59 145

X X X

AAs1r4 BBs100r150 AAs5rn BBs100r150

UU

fH2 IDH St24 IDH St24 48 21 21 28 3.39 3.39 9.79 0.36 118

X X

AAs130r100 BBsnr3 AAs100r100 BBs2rn

U

fH2 FBP LDH5 FBP LDH5 18 14 29 12 1.11 6.04 2.31 0.59 73

X X

AAs100r150 BBs90r100 AAs100r150 BBs90r90

U

mD1 St24 MST-15 St24 MST-15 47 28 38 47 0.62 0.62 4.9 0.42 160

X X

AAs1r4 BBs1r2 AAs5rn BBs2r4

U

mD2 FBP St24 FBP St24 21 8 15 21 0.75 0.75 5.55 0.36 65

X X

AAs100r150 BBsnr3 AAs100r150 BBs2rn a

Test of random segregation at locus A. b

Test of random segregation at locus B.

c Ž .

Test of joint segregation at locus A and B dfs1 .

d Ž .

(8)

allele at each locus without any selective genetic constraints. We could thus detect

Ž .

linkage for the loci analysed in its offspring. ii The female parent is an F hybrid made1

up half of genes of domesticated origin and half of genes of wild origin. Segregation was tested to verify whether there is normal recombination during meiosis between the genomes of different origins; or alternatively, whether the females pass on associations

Ž .

of alleles parental or recombined gametes advantaged rather than random combination for these two loci. As recombination rates are much higher in females than in males in

Ž .

salmonids Johnson et al., 1987 , distortions of joint segregation in females alone would suggest a selective phenomenon when both loci are not linked in males.

A total of 70 joint segregation tests were performed. In some cases, analysis was restricted to a single family. Significant joint-segregation tests are presented in Table 3 and the entire set of tests carried out in Table 4. Non-random segregation was detected for six locus combinations — four in the hybrid females, and two in the hatchery males

ŽTables 3 and 4 . According to our results, four of the six tests performed showed that.

these microsatellite loci were neither linked, nor linked to the allozymic loci AAT-4 and

LDH-5.

For the significant tests MST-15rMPI in fH1 and Strutta-24rIDH-3 in fH2, we

were unable to conclude that these loci are independent: the tests were performed on only one set of progeny and only one of the two tests carried out was significant. Some cases of non-random associations detected in this study may result from chance alone. Similarly, the test result between Strutta-24 and MST-15 was significant for the BC1 domestic male, but not for the three other parents. Because the allelic segregation was normal for this male at each locus, we can infer that the significance resulted from chance.

Significant values for Strutta-24rFBP-1 linkage were obtained in two out of three

cases, for fH1 and mD2. The non-significant value for fH2 may be reflected by a higher recombination rate in female than in male: the lower frequency of male recombination

Table 4

Summary of all pairwise examinations for joint segregation of allozymic and microsatellite loci from BC1 and BC2

Ž

Numbers in brackets indicate the number of tests realised for each pair of loci male below and female above

.

(9)

( )

C. Poteaux et al.rAquaculture 186 2000 1–12 9

than female recombination is in agreement with the general observation that when there is a difference in recombination rates between the sexes, the heterogametic sex displays

Ž .

lower frequencies Swanson et al., 1981 . This significant test may indicate a weak linkage between both loci, which is not detected in every case.

The significant test for Strutta-12 and Strutta-24 in BC1 may not be due to a physical linkage between these loci, since they were statistically independent for the other individuals. One significant result in four tests may have resulted from chance since the loci are not linked, or from selection because the hybrid female transmitted preferentially one type of her gametes, the recombined type in this case. The joint segregation at these loci has to be confirmed with the analysis of other sets of back-crosses.

In general, if there is no difference in joint segregation between the two types of

Ž .

cross back-cross and control cross in this type of experiment, then we conclude there are no selective forces acting particularly on the hybrid individuals. In contrast, significantly higher or lower levels of linkage disequilibrium may occur in the hybrids, which may have different causes such as lower recombination rates andror selection pressures acting against genotypes. First, when the recombination rates are significantly higher for the hybrid individuals of a given sex, differential selection according to genotype is likely. Here, three out five tests are significant except for the female individuals, especially the Strutta-12rStrutta-24 pair for fH1.

Secondly, if the recombination rates are significantly lower for the hybrid individuals, two hypotheses can be put forward: reduced recombination at the meiosis stage in the hybrids or differential selection acting on genotypes. This may be the case for the most highly significant test result obtained in this study, between IDH and Strutta-24 for the

Ž .

female fH2 rs0.36, Table 3 . Considering the origin of the alleles for these loci, we observe that the parental forms of gametes were transmitted more than the recombined type, which would correspond to a particular selection in hatchery-reared conditions. However, other crosses with heterozygous females for these loci should be analysed to test the hypothesis of a strong linkage between these two loci. In addition, differential post-zygotic selection acting on recombined genotypes would result in lower survival rates in hybrids than in controls. Such a tendency is not seen here, but our data set is rather limited and variations in survival rates cannot easily be interpreted. A better approach would be to compare these lower recombination rates with those observed in

Ž .

the same family at an earlier stage i.e., the eyed stage when the survival rate is still close to 100% and the selection hypothesis can be discarded.

Intensive restocking with hatchery-reared trout are common practices everywhere now and breeding with native stocks could lead to the loss of the genetic integrity of aboriginal populations, by introgression and breaking up coadapted gene complexes

Žseveral articles in STOCS, 1981 . This question is of great interest for fisheries.

(10)

4. Conclusion

Each type of cross was performed in few replicates, which is few for drawing final conclusions from the single and joint segregations observed in both back-crosses. In addition, the indirect deduction of the linkage phases limited our interpretation and some of these segregation distortions deserve to be confirmed in additional back-crosses. Our results show that such imbalance would be slight and detection requires large family sizes. Here, in hatchery life conditions, outbreeding depression was not observed. If segregation distortion apparently resulting from disruption of coadapted gene combina-tion is observed in experimental hybrid back-crosses or F , it would be worth to test if2

deviation involving the same set of loci occur in the wild. However, the presence or absence of outbreeding depression in wild cannot be directly deduced from results obtained in experimental conditions since the genes under selection and selective forces are not necessarily the same in the two environments.

The microsatellite loci used in this study were sufficiently polymorphic to present distinct alleles for each parent, making them very useful for this kind of experiment. Microsatellite loci seem to be useful tools for the aquaculture of brown trout and fishes in general and could play an important role in monitoring crosses between strains or selective breeding programmes at fish farms.

Acknowledgements

We wish to thank J.F. Renno and three anonymous referees for useful comments on the manuscript. The authors wish to express their thanks to the Federation de Peche de

´ ´

ˆ

l’Herault and the technical staff of Gournay and the Mas-du-Merou fish farm for their

´

´

cooperation. This work was supported by the 93-179 grant from the Conseil Superieur

´

de la Peche and EC contract EV5VCT920097.

ˆ

References

Barbat-Leterrier, A., Guyomard, R., Krieg, F., 1989. Introgression between introduced domesticated strains

Ž .

and Mediterranean native populations of brown trout Salmo trutta L. . Aquatic Living Resources 2, 215–223.

Beaudou, D., 1993. Impact des deversements de truites domestiques dans les populations naturelles de truites´

communes, Salmo trutta fario. Etude dynamique et genetique. Cas du bassin de l’Orb, Herault. Thesis,´ ´ ´

University of Montpellier, 308 pp.

Bernatchez, L., Guyomard, R., Bonhomme, F., 1992. DNA sequence variation of the mitochondrial control region among geographically and morphologically remote European brown trout Salmo trutta populations. Molecular Ecology 1, 161–173.

Ž . Ž .

Estoup, A., Presa, P., Krieg, F., Vaiman, D., Guyomard, R., 1993. CTn and GTn microsatellites: a new

Ž .

class of genetic markers for Salmo trutta L. brown trout . Heredity 71, 488–496.

Garcia de Leon, F., Dallas, J., Chatain, B., Canonne, M., Versini, J.J., Bonhomme, F., 1995. Development and

Ž .w x

(11)

( )

C. Poteaux et al.rAquaculture 186 2000 1–12 11 Giuffra, E., Guyomard, R., Forneris, G., 1996. Phylogenetic relationships and introgression patterns between

Ž .

incipient parapatric species of Italian brown trout Salmo trutta L. complex . Molecular Ecology 5, 207–220.

Guyomard, R., 1989. Diversite genetique de la truite commune. Bulletin Franc´ ´ ´ ¸ais de Peche et Piscicicultureˆ

314, 118–135.

Guyomard, R., 1997. Consequences genetiques des introductions d’especes de poissons en l’absence d’isole-´ ´ ´ `

ment reproducteur: interet et limites d’une approche en milieu experimental. Bulletin Franc´ ˆ ´ ¸ais de Peche etˆ

Pisciciculture 344–345, 308.

Hamilton, K.E., Ferguson, A., Taggart, J.B., Tomasson, T., Walker, A., Fahy, E., 1989. Post-glacial colonisation of brown trout, Salmo trutta L.: LDH-5 as a phylogeographic marker locus. Journal of Fish Biology 35, 651–664.

Ž .

Hearne, C.M., Ghosh, S., Todd, J.A., 1992. Microsatellites for linkage analysis of genetic traits. Science 8 8 , 288–294.

Ž .

Henry, T., Ferguson, A., 1985. Kinetic studies on the lactate dehydrogenase LDH-5 isozymes of brown trout,

Ž . Salmo trutta L. Comp. Biochem. Physiol. 82B 1 , 95–98.

Hunt, W., Selander, R., 1973. Biochemical genetics of hybridization in European house mice. Heredity 31, 11–33.

Johnson, K.R., Wright, J.E., May, B., 1987. Linkage relationships reflecting ancestral tetraploidy in salmonid fish. Genetics 116, 579–591.

Jordan, W.C., Verspoor, E., Youngson, A., 1997. The effect of natural selection on estimates of genetic divergence among populations of the Atlantic salmon. Journal of Fish Biology, 546–557.

Kirpichnikov, V.S., 1992. Adaptive nature of intrapopulational biochemical polymorphism in fish. Journal of Fish Biology 40, 1–16.

Ž .

Krieg, F., Guyomard, R., 1985. Population genetic of French brown trout Salmo trutta L. : large geographical differentiation of wild populations and high similarity of domesticated stocks. Genetic Selection and

Ž .

Evolution 17 2 , 225–242.

Largiader, C.R., Scholl, A., Guyomard, R., 1996. The role of natural and artificial propagation on the genetic

Ž . Ž .

diversity of brown trout Salmo trutta L. of the upper Rhone drainage. In: Kirchhofer, A., Hefti, D. Eds. ,ˆ

Conservation of Endangered Freshwater Fish in Europe. Birkhauser Verlag, Basel, Switzerland, pp. 181–197.

Mather, K., 1951. The Measurement of Linkage in Heredity. Methuen, London.

May, B., Wright, J.E., Stoneking, M., 1979. Joint segregation of biochemical loci in Salmonidae: results from experiments with SalÕelinus and review of the litterature on other species. Journal Fisheries Resources

Board of Canada 36, 1114–1128.

Mayr, E., 1974. Populations, Especes et Evolution. Hermann, Paris.`

Philipp, D.P., Childers, W.F., Whitt, G.S., 1985. Correlations of allele frequencies with physical and

Ž .

environmental variables for populations of largemouth bass, Micropterus salmoides Lacepede . Journal of Fish Biology 27, 347–365.

Poteaux, C., 1995. Interactions genetiques entre formes sauvages et domestiques chez la truite commune´ ´ ŽSalmo trutta L. . Thesis, University of Montpellier II, 110 pp..

Poteaux, C., Berrebi, P., 1997. Integrite genomique et repeuplements chez la truite commune du versant´ ´ ´

mediterraneen. Bulletin Franc´ ´ ¸ais de Peche et Pisciciculture 344r345, 309–322.ˆ

Poteaux, C., Bonhomme, F., Berrebi, P., 1998. Differences between nuclear and mitochondrial introgressions of brown trout populations from a restocked main river and its unrestocked tributary. Biological Journal of the Linnean Society 63, 379–392.

Powers, D.A., Lauerman, T., Crawford, D., Smith, M., Gonzalez-Villasenor, I., Dimichele, L., 1991. The evolutionary significance of genetic variation at enzyme synthesizing loci in the teleost Fundulus heteroclitus. Journal of Fish Biology 39, 169–184.

Presa, P., Krieg, F., Estoup, A., Guyomard, R., 1994. Diversite et gestion genetique de la truite commune:´ ´ ´

apport de l’etude du polymorphisme des locus proteiques et microsatellites. Genetic Selection and´ ´

Ž .

Evolution 26 Suppl. 1 , 183–202.

Rice, W.R., 1989. Analyzing tables of statistical tests. Evolution 43, 223–225.

(12)

STOCS, 1981. Stock concept international symposium. Canadian Journal of Fisheries and Aquatic Sciences 38, 1457–1921.

Swanson, C.P., Merz, T., Young, W.J., 1981. Cytogenetics: The Chromosome in Division, Inheritance and Evolution. 2nd edn Prentice-Hall, Englewood Cliffs, NJ.

Ž .

Taggart, J.B., Ferguson, A., 1984. Allozyme variation in the brown trout Salmo trutta L. : single locus and joint segregation inheritance studies. Heredity 53, 339–359.

Gambar

Table 1Survival rate Ts of backcrosses and control intra-strain families
Table 2Genotypes of genitors for allozyme and microsatellite loci
Table 3Joint segregation data of loci combinations found to exhibit statistically significant linkage
Table 4Summary of all pairwise examinations for joint segregation of allozymic and microsatellite loci from BC1 and

Referensi

Dokumen terkait

In the present study, we use an algal implantation experiment on Drum Sands, Firth of Forth, Scotland, to test whether the macrofaunal effects of algal mats on moderately

Fish grazing significantly P - 0.05 reduced diatom diversity, mean diatom biovolume, the variability in standing periphyton biomass and the proportion of ash. Grazed periphyton

the assessment of finfish quality. Differences in the external morphology between two samples were analysed before their introduction into floating cages and after 15 months of

The impact of escaped farmed salmon on wild populations may have potentially negative genetic and ecological effects. There is widespread evidence that farmed salmon interact with

triploids’ PTs , which when compared with diploid scallops from within the same treatment Ž treated diploids , had a significantly larger muscle weight than the differences

PAGE, 2 quantification of proteinase activity, and 3 in vitro evaluation of digestibility of dietary protein sources by shrimp proteinases. A compilation of previously reported

the stomach to the foregut, hindgut and rectum, the increase in apparent nitrogen digestibility was accompanied by higher ammonia contents, suggesting substantial involvement of

A field experiment was established on a secondary forest site in Northern Guam to simulate land clearing, cultivation and fertilization with two separate applications of N, P and