• Specific Aim 1: Establish mitochondrial DNA content and characterize mitochondrial and glycolytic respiration in NKCC1-DFX human fibroblasts, epithelial cells, and NKCC1 +/DFX and NKCC1 DFX/DFX mice. Hypothesis: NKCC1-DFX leads to elevated mitochondrial respiration and lower glycolysis in human fibroblasts expressing NKCC1-DFX, epithelial cells, and mouse fibroblasts expressing NKCC1-DFX
• Specific Aim 2: Establish ER and oxidative stress in NKCC1-DFX mice. Hypothesis:
Fibroblasts isolated from NKCC1 + /DFX NKCC1 DFX /DFX elicit mitochondrial oxidative stress, in addition to ER stress.
CHAPTER II
PERIPHERAL NERVE DEFICITS AND SEIZURES ASSOCIATED WITH DEFECTIVE PROTEIN KINASE D 1
Introduction Peripheral neuropathy
As previously mentioned in Chapter I, genes affecting the CCCs result in damage to nerves in the PNS and CNS (Howard et al., 2002; Delpire 2007b; Kahle et al., 2016). Damage to nerves can be in the form of damage to myelin or axon of nerves leading to neuropathies (Pisciotta &
Shy 2018; Barrell & Smith 2019). Damage affecting peripheral nerves leads to a disease termed peripheral neuropathy. There are different pathological forms of peripheral neuropathy, such as demyelinative neuropathy, hypertrophic “onion bulb” neuropathy, and axonal neuropathy (Katona & Weis 2018). Any type of peripheral neuropathy consequently affects signal conduction, which affects the function of many organs and lead to several disease states in humans (Uncini
& Kuwabara 2015; Oh et al., 2015). Damage of myelin for instance highlights the importance of intact nerves on nerve function and physiology. Once a signal is received by the cell body of a neuron, myelin plays a critical role in its propagation throughout the axon via the nodes of Ranvier, through a process known as saltatory conduction (Akaishi, 2018; Waxman &Ritchie 1993; Rosenbluth, 2009; Ulzheimer et al., 2004). At the nodes of Ranvier, the part of the axon that is unmyelinated, ions are exchanged across the axon membrane, regenerating the axon potential between the regions of the axon that are myelinated. Therefore, the signal is propagated along the axon at high speeds, without compromising or degrading the signal.
Because the exchange of ions plays a vital role in saltatory conduction, it is expected that a LOF in KCC3, which is expressed in neurons, results in abnormal myelin pathologies, thus peripheral neuropathies and ACCPN in humans (Kahle et al., 2016). Since peripheral neuropathy can affect peripheral nerve function, nerve conduction studies on KCC3 KO and KCC3-T991A (LOF) mice displayed slower nerve conduction velocities, with poor performance on locomotor tasks (Byun
& Delpire 2007b; Kahle et al., 2016).
Epilepsy
Abnormal neuronal function as a result of myelin damage, axonal atrophy, metabolic alterations, infections, pharmacology, traumatic brain injury, stroke, or brain tumor can result in permanent or transient alterations of the brain electrical activity ( Chen et al., 2016; Imad et al., 2015; Zoons et al., 2008; Ferguson et al., 2010; You et al., 2011). For instance, a seizure is defined as a transient increase in electrical activity in the brain. The occurrence of multiple spontaneous seizures in individuals, is considered epilepsy (Stafstrom & Carmant, 2015). Epilepsy is thought to arise as a result of an imbalance between neuronal excitability and inhibition, leading to a hyperexcitable state, where seizures occur. Characterized by recurrent and unprovoked seizures, and depending on the type of seizure, epilepsy causes abnormal motor behavior, and/or loss of consciousness. According to the World Health Organization, epilepsy is the most common serious brain disorder worldwide, affecting ~50 million people worldwide (World Health Organization 2019). In the year 2015, epilepsy affected about 1.2 percent of the population – 3.4 million individuals in the United States (Zack & Kobau, 2017). Epilepsy is currently treated by antiepileptic drugs (AEDs), aiming to restore the imbalance of neuronal excitation and inhibition,
by altering neuronal inhibition or repressing excitation (Kaeberle, 2018). Although extensive medical research has contributed to developing novel AEDs for decades, about a third to 50 percent of patients continue to have seizures following the use of medication, also known as medication refractory epilepsy (Golyala & Kwan, 2017; Shorvon & Luciano, 2007; Kwan & Brodie, 2000). The absence of a truly affective AED highlights the gap in knowledge, of understanding mechanisms by which epileptogenesis occurs. Several studies have identified the CCCs as contributors to the hyperexcitability or inhibition of neurons via GABA (Dzhala et al., 2005; Deeb et al., 2011). NKCC1 is responsible for maintaining high ECl in immature neurons and sensory afferents, leading to the depolarizing affect in GABA. Whereas KCC2 is important for maintaining low ECl in mature neurons in the brain and spinal cord, contributing to the hyperpolarizing GABAergic currents. Further, genetic variants resulting in LOF mutations in KCC2 have been identified in epileptic individuals (Kahle et al., 2014; Puskarjov et al., 2014; Huberfeld et al., 2007).
Preclinical studies in rodents that were genetically engineered to have KCC2 or KCC3 LOF mutation, also displayed reduced Cl- efflux, decreased neuronal excitability, and epileptic seizures (Hübner et al., 2001a; Boettger et al., 2003; Tanis et al., 2009). Interestingly, in both cases of epilepsy associated with KCC2 and KCC3, K-Cl cotransport is diminished/reduced.
There are many neurological disorders that have some overlap between peripheral nerve disease and brain hyperexcitability. For instance, Charcot-Marie-Tooth disease (CMT) and Multiple Sclerosis (MS) are prime examples of chronic neurological diseases that are primarily caused by damage to the myelin sheath of a neuron and/or nerve axon, abnormal myelination in the central nervous system (CNS) and peripheral nervous system (PNS). CMT is classified as a rare
hereditary peripheral neuropathy, affecting ~1 in 2500 people in the United States. Peripheral neuropathies are categorized into acquired neuropathies, hereditary neuropathies, and idiopathic neuropathies. Damage to myelin, demyelinative neuropathy, hypertrophic “onion- bulb” neuropathy, axonal neuropathy, and hypermyelination are all forms of peripheral neuropathy. Peripheral neuropathy can be heterogenous depending on the gene mutation. For example, there are many forms of CMT depending on the type of gene that is affected. CMT1 is caused by abnormalities in the myelin sheath, and has several types. CMT1A for instance, is a result of a duplication event within chromosome 17 that contains the peripheral myelin protein- 22 (PMP22) gene (Thomas et al., 1997). PMP22 is an essential component of peripheral nerve myelin. The outcome of the duplication is an overexpression of the PMP22 gene resulting in hypermyelination and abnormal peripheral nerve function. Patients with this disease variant experience muscle weakness and sensory loss. Whereas patients with hereditary neuropathy with predisposition to pressure palsy (HNPP) (van Paassen et al., 2014), have a deleted copy of the PMP22 gene resulting in markedly lower levels of PMP22. Abnormal lower levels of PMP22 leads to demyelinating neuropathy in HNPP patients, where they experience muscle atrophy, foot drop, and carpel tunnel syndrome.
Similarly, MS is a heterogenous demyelinating disease in CNS neurons, and is the most common form of demyelinating disease (Love, 2006). Caused by both genetic and environmental factors, MS occurs due to the attack of the immune system (macrophages and T-cells) on CNS myelin (van der Valk and De Groot, 2000). MS affects 309.2 per 100,000 adults in the United States (Wallin et al., 2019), and clinical manifestations of the disease can vary from experiencing
no symptoms, to muscle weakness, ataxia, autonomic motor dysfunction, and sensory loss. Since damage to the myelin sheath results in abnormal neuronal activity, it is not surprising that a recent study identified MS patients are three – six times more likely to develop epileptic seizures compared to non-MS individuals (Lapato et al., 2017). It was demonstrated that MS mouse models have higher EEG activity, hippocampal demyelination, and loss of parvalbumin (PV+) interneurons, which are responsible for preventing neuronal hyperexcitability. Although both MS and CMT are treatable diseases, they are uncurable to date.
Here, I describe a patient with myoclonic gait dyspraxia, jerky tremors, EEG generalized discharges, and peripheral neuropathy that affects primarily sensory neurons with normal brain structure. We show that the patient carries a de novo mutation in protein kinase D1 (PKD1). PKD1 is a member of a family of serine/threonine kinases consisting of: PKD1, PKD2, and PKD3 (Rozengurt et al., 2005). Phosphorylation of PKD1-3 plays an important role in intracellular transduction pathways leading to several cell functions but also leads to the mediation of neurogenic inflammation and pain transmission through protease-activated receptor 2 (PAR2) (Amadesi et al., 2009). Studies have shown that PKD1 is involved in inflammation and oxidative stress (Chiu et al., 2007; Storz et al., 2004), tumor pathogenesis (Guha et al., 2010; LaValle et al., 2010), and cardiomyopathies (Fielitz et al., 2008; Harrison et al., 2006). Although, PKD1 has been shown to regulate protein trafficking and mediate dendritic branch stabilization in neurons (Bencsik et al., 2015; Bisbal et al., 2008), its role in the nervous system has been primarily studied in vitro and its role in in vivo models of neurodegenerative disease is understudied.
In a functional kinomics screen, we previously identified PKD1 as an interacting partner of the potassium chloride cotransporter, KCC3 (Zhang et al., 2016). KCC3 is an electroneutral cotransporter of K+ and Cl-, expressed in both the central and peripheral nervous system (Pearson et al., 2001; Shekarabi et al., 2011). The cotransporter is activated by dephosphorylation, and inactivated by phosphorylation at two specific residues: Thr991, and Thr1048 (Rinehart et al., 2009). Inactivating mutations in human KCC3 are the cause of peripheral neuropathy associated with agenesis of the corpus callosum (ACCPN or Anderman syndrome) (Boettger et al., 2003;
Howard et al., 2002). We and others have also previously shown that KCC3 loss-of-function and gain-of-function mutations yield peripheral and central nervous system neurodegeneration, locomotor deficits, and decreased seizure threshold in vivo (Boettger et al., 2003; Ding and Delpire, 2014; Howard et al., 2002; Kahle et al., 2016; Shekarabi et al., 2012). In this study, we generated a mouse model expressing the human mutation in PKD1 and confirmed that PKD1 affects KCC3 activity in vitro. In addition, we demonstrate that mice expressing the mutant kinase exhibit similar nerve pathology to the patient, and are more susceptible to seizures.
Material and Methods Kinship analysis
Relationship between proband, siblings, and parents in the Family NG1917 was estimated using the pairwise identity-by-descent (IBD) calculation in PLINK (Purcell et al., 2007).
The IBD sharing between the proband, siblings and parents is between 45% and 55%.
Principal component analysis
To determine the ethnicity of each sample, the EIGENSTRAT (Price et al., 2006) software was used to analyze tag SNPs in cases, controls, and HapMap subjects as described before (Jin et al., 2017).
Mapping and variant calling
Whole exome sequencing was performed at the Yale Center for Genome Analysis.
Genomic DNA was captured using the Nimblegen SeqxCap EZ MedExome Target Enrichment Kit (Roche) followed by Illumina DNA sequencing as previously described (Jin et al., 2017). At each site sequence reads were independently mapped to the reference genome (GRCh37) with BWA-MEM and further processed using GATK Best Practice workflows, which include duplication marking, indel realignment, and base quality recalibration, as previously described(Li and Durbin, 2010; McKenna et al., 2010; Van der Auwera et al., 2013). Single nucleotide variants and small indels were called with GATK HaplotypeCaller and annotated using ANNOVAR (Wang et al., 2010) and Genome Aggregation Database (gnomAD) (Lek et al., 2016). The MetaSVM algorithm was used to predict deleteriousness of missense variants (“D-Mis”, defined as MetaSVM-deleterious or CADD ≥ 20)(Dong et al., 2015; Kircher et al., 2014). Inferred LoF variants consist of stop-gain, stop-loss, frameshift insertions/deletions, canonical splice site, and start-loss. LoF + D-Mis mutations were considered “damaging”. Variant calls were reconciled between Yale and PCH prior to downstream statistical analyses. Variants were considered by mode of inheritance, including DNMs, RGs, and X-linked variants.
CRISPR/Cas9 generation of PKD1-E77X mice
A mouse carrying the patient p.Glu79X mutation was generated using CRISPR/cas9 technology. A 20-bp sequence (CGATGGAACAAGCCATCTCC), located in exon 1 of the mouse PRKD1 gene, and followed by CGG as protospacer adjacent motif was selected for guide RNA targeting sequence. This sequence flanked by BbsI sites was inserted in pX330, a vector expressing the guide RNA under U6 promoter, and cas9 under a hybrid chicken b-actin promoter.
The vector was injected alongside a 196-bp repair oligonucleotide into 429 0.5 day B6D2 mouse embryos. The repair oligo contained 90-bp homology arms, a codon introducing a stop codon, a unique Nhe I restriction site, and a few additional third base mutations that prevent re-targeting of cas9 to the repaired DNA. Of 429 embryos injected, 301 survived and were transferred to 14 pseudo-pregnant females, thereby generating 27 pups. At weaning, genotyping was done by amplifying a 384-bp fragment followed by sequencing. Two animals out of 24 (as 3 died, 8.7%) were identified as having a mutant allele. One male mouse (#19) was shown to have the stop codon at amino acid 77, but lacked the designed NheI restriction site (Figure 2-3). The other mouse had a frame shift that introduced a stop codon, 6 residues downstream of the cut site.
We carried line 19 and crossed it to C57BL/6J female mice to demonstrate germline transmission.
The lines were then further bred to the C57BL/6J mouse strain to dilute any possible off-target effects.
Transmission electron microscopy
Sural nerves were dissected from adult mice, then fixed with 2.5% glutaraldehyde in 0.1 M sodium cacodylate for 1 hour at room temperature (RT) and then at 4°C overnight. The
Vanderbilt Electron Microscopy core further processed the sural nerve samples by washing and fixing them in 1% osmium tetroxide solution for 1 hour at RT and then with 0.5% OsO4 for 24 hours. Then, the tissue samples underwent a series of ethanol dehydration steps (50% for 5 min, 75% for 15 min, 95% twice for 15 min each, and 100% thrice, 20 min each) before they were embedded in Spurr resin at 60°C for 24 to 48 hours. Semi-thin sections (500 nm) were stained with toluidine blue and examined for positioning. Ultrathin sections (80 nm) were then cut and stained with uranyl acetate and lead citrate and placed on copper grids. Images were observed using a Philips/FEI T-12 transmission electron microscope.
PRKD1+/E77X brain water content
Fresh brains isolated from WT and PRKD1+/E77X mice were immediately weighed following extraction. Brains were placed in desiccating vacuum oven (VWR 1400E) at 110 °C for 48 hours.
Desiccated brains weights were obtained to measure water content (wet brain – dry brain)/ (dry brain).
Accelerated rotarod assay
A neuromotor coordination task was performed using an accelerating rotating cylinder (model 47600; Ugo Basile, S.R. Biological Research Apparatus). Both controls (wild-types) PRKD1+/+ and heterozygous PRKD1+/E77X mice were tested. The cylinder was 3 cm in diameter and was covered with scored plastic. Mice were confined to a 4-cm-long section of the cylinder by gray Plexiglass dividers. Two to five mice were placed on the cylinder at once. The rotation rate of the cylinder increased over a 4-min period from 4 to 40 rpm. The latency of each mouse to fall
off the rotating cylinder was automatically recorded by the device. Mice that remained on the rotarod after the 300-s trial period were removed and given a score of 300 s. The test was performed as three trials daily for three consecutive days with an inter-trial interval of at least 30 min.
Balance beam assay
To assess fine motor coordination and balance, we used a 1m-long steel balance beams of either 12 mm or 6 mm thickness. The beams were placed about 50 cm from the ground and positioned between two pillars. At the start of the test, mice began on an open, square platform and ended in an enclosed black box with bedding as motivation for the mice to cross. Mice were trained for 2 days (three trials per day for each beam) beginning with the thicker beam (12 mm) and progressing to the thinner beam (6 mm). The mice were tested consecutively on each beam with 10-min relief periods between each trial. The third day was used as the test day with three trials for each beam. The mice had about 60 s to traverse the beam and were scored on the neurological scoring system for beam walking adapted from Feeney and colleagues (Feeney et al., 1982). This scoring system is based on the ability of the mouse to cross the beam and accounts for the number of paw slips. The mice received a score ranging from 1 to 7, based on their ability to complete the task, to place affected limbs on beam, and on the number of paw slips. This neurological scoring system considers a high score of 7 to be indicative of a wild-type mouse phenotype with no coordination deficits, and a low score of 1 indicative of severe motor defects.
Foot-print (Gait) assay
Gait was measured by coating the hind paws of each mouse with non-toxic black ink (Carters Brand Neat-Flo Inker for Felt/Foam Stamp Pads; Hill et al., 2004). Each mouse received a single trial in which it was placed at the beginning of a 40 × 10 cm runway paper and permitted to run freely to the end. The middle toe print was used for gait measurement, recorded as the mean distance (in cm) of three consecutive right hind paw prints.
Open-field
Exploratory locomotor activity was measured in specially designed chambers measuring 27 x 27 cm (Med Associates), housed in sound-attenuating cases over a 30 minute period.
Infrared beams and detectors automatically record movement in the open field. Locomotor activity was measured over a period of 30 min.
Porsolt forced swim test
For this test, mice were placed in a large beaker, filled with 25-27°C water, such that they cannot escape from the beaker and cannot touch the bottom. On each of two consecutive days each mouse is individually placed in the beaker for 5-15 min. Latency to float, and amount of time spent struggling are measured. The mouse is monitored during the task, either by direct observation, or with a live video feed. If a mouse is struggling to keep its mouth above water or seem in danger of drowning, it is removed from the beaker immediately and excluded from the study. At the completion of the test, the animal is removed from the beaker, towel dried, and recovered for 10-20 min in a warm cage (~35-37°C) sitting on a heating pad.
Hot plate assay
Hotplate assay was performed by placing the mice individually on a platform maintained at 52-55°C (Hotplate Analgesia Meter, Columbus Instruments, Columbus, OH). A plastic cylinder 15-cm in diameter and 20-cm high confined the mouse to the surface of the hotplate. The time necessary for the mouse to respond to the thermal stimulus (hindpaw fluttering, licking, or withdrawal) was measured with a stopwatch. After the initial response or the maximum cut-off time of 15 sec, the mice were removed from the hotplate and returned to the home cage. A minimum recovery period of 1 h was implemented between hotplate assay sessions.
Von-Frey filaments
Somatosensory responsiveness was assessed using Von Frey filaments. Filaments of various diameters were pressed against the plantar surface of the mouse’s foot. The filaments bend, producing a constant force of application from 0.01 to 10 mN. The filaments were used in ascending order until a foot withdrawal response was observed. The force exerted by the filament that elicits a withdrawal response was taken as the threshold.
Kainic acid administration and behavioral scoring of seizures
Behavioral observations began immediately following intraperitoneal administration of 20 mg/Kg kainic acid per mouse and continued for up to 1 hour, after which, mice were returned to their home cage or sacrificed. Cages were not returned to the vivarium until at least 3 hours after drug administration when it was confirmed that no further seizures were observed. Mice