INDUCTION
2.16 Supplemental Information: E. coli Primer and Strain List
Table 2.4: Promoter sequences and primers used in this work. The listed promoter sequences were randomly mutated to produce libraries for use in Sort-Seq experiments. The primer sequences were used to generate plasmids for Sort-Seq experiments or for use in creating strains with mutated operators or LacI.
Primer Sequence Comments
General sequencing primers
pZSforwseq2 TTCCCAACCTTACCAGAGGGC Forward primer for 3*1x-lacI
251F CCTTTCGTCTTCACCTCGA Forward primer for 25x+11-yfp
YFP1 ACTAGCAACACCAGAACAGCCC Reverse primer for 3*1x-lacI
and 25x+11-yfp Integration primers:
HG6.1 (galK) gtttgcgcgcagtcagcgatatccattttcgcgaatccgg agtgtaagaaACTAGCAACACCAGAACAGCC
Reverse primer for 25x+11-yfp with homology togalKlocus.
HG6.3 (galK) ttcatattgttcagcgacagcttgctgtacggcaggcacc agctcttccgGGCTAATGCACCCAGTAAGG
Forward primer for 25x+11-yfp with homology togalKlocus.
galK-control-upstream1 TTCATATTGTTCAGCGACAGCTTG To check integration.
galK-control-downstream1 CTCCGCCACCGTACGTAAATT To check integration.
HG11.1 (ybcN) acctctgcggaggggaagcgtgaacctctcacaagacggc atcaaattacACTAGCAACACCAGAACAGCC
Reverse primer for 3*1x-lacI with homology toybcNlocus.
HG11.3 (ybcN) ctgtagatgtgtccgttcatgacacgaataagcggtgtag ccattacgccGGCTAATGCACCCAGTAAGG
Forward primer for 3*1x-lacI with homology toybcNlocus.
ybcN-control-upstream1 AGCGTTTGACCTCTGCGGA To check integration.
ybcN-control-downstream1 GCTCAGGTTTACGCTTACGACG To check integration.
Table 2.5: E. colistrains used in this work. Each strain contains a unique operator- yfp construct for measurement of fluorescence andRrefers to the dimer copy number as measured by Ref. [9].
Strain Genotype
O1,R=0 HG105::galKhi25O1+11-yfp O1,R=22 HG104::galKhi25O1+11-yfp
O1,R=60 HG105::galKhi25O1+11-yfp, ybcNhi3*1RBS1147-lacI O1,R=124 HG105::galKhi25O1+11-yfp, ybcNhi3*1RBS1027-lacI O1,R=260 HG105::galKhi25O1+11-yfp, ybcNhi3*1RBS446-lacI O1,R=1220 HG105::galKhi25O1+11-yfp, ybcNhi3*1RBS1-lacI O1,R=1740 HG105::galKhi25O1+11-yfp, ybcNhi3*1-lacI (RBS1L) O2,R=0 HG105::galKhi25O2+11-yfp
O2,R=22 HG104::galKhi25O2+11-yfp
O2,R=60 HG105::galKhi25O2+11-yfp, ybcNhi3*1RBS1147-lacI O2,R=124 HG105::galKhi25O2+11-yfp, ybcNhi3*1RBS1027-lacI O2,R=260 HG105::galKhi25O2+11-yfp, ybcNhi3*1RBS446-lacI O2,R=1220 HG105::galKhi25O2+11-yfp, ybcNhi3*1RBS1-lacI O2,R=1740 HG105::galKhi25O2+11-yfp, ybcNhi3*1-lacI (RBS1L) O3,R=0 HG105::galKhi25O3+11-yfp
O3,R=22 HG104::galKhi25O3+11-yfp
O3,R=60 HG105::galKhi25O3+11-yfp, ybcNhi3*1RBS1147-lacI O3,R=124 HG105::galKhi25O3+11-yfp, ybcNhi3*1RBS1027-lacI O3,R=260 HG105::galKhi25O3+11-yfp, ybcNhi3*1RBS446-lacI O3,R=1220 HG105::galKhi25O3+11-yfp, ybcNhi3*1RBS1-lacI O3,R=1740 HG105::galKhi25O3+11-yfp, ybcNhi3*1-lacI (RBS1L) Oid,R=0 HG105::galKhi25Oid+11-yfp
Oid,R=22 HG104::galKhi25Oid+11-yfp
Oid,R=60 HG105::galKhi25Oid+11-yfp, ybcNhi3*1RBS1147-lacI Oid,R=124 HG105::galKhi25Oid+11-yfp, ybcNhi3*1RBS1027-lacI Oid,R=260 HG105::galKhi25Oid+11-yfp, ybcNhi3*1RBS446-lacI Oid,R=1220 HG105::galKhi25Oid+11-yfp, ybcNhi3*1RBS1-lacI Oid,R=1740 HG105::galKhi25Oid+11-yfp, ybcNhi3*1-lacI (RBS1L)
BIBLIOGRAPHY
[1] Janet E. Lindsley and Jared Rutter. Whence cometh the allosterome? Pro- ceedings of the National Academy of Sciences, 103(28):10533–5, 2006.
[2] James G. Harman. Allosteric regulation of the cAMP receptor protein.
Biochimica et Biophysica Acta (BBA) - Protein Structure and Molecular En- zymology, 1547(1):1–17, 2001.
[3] Maria Fe Lanfranco, Fernanda Gárate, Ashton J. Engdahl, and Rodrigo A.
Maillard. Asymmetric configurations in a reengineered homodimer reveal multiple subunit communication pathways in protein allostery.The Journal of Biological Chemistry, 292(15):6086–6093, 2017.
[4] Yaki Setty, Avraham E. Mayo, Michael G. Surette, and Uri Alon. Detailed map of a cis-regulatory input function. Proceedings of the National Academy of Sciences, 100(13):7702–7707, 2003.
[5] Frank J. Poelwijk, Marjon G. J. deVos, and Sander J. Tans. Tradeoffs and optimality in the evolution of gene regulation. Cell, 146(3):462–470, 2011.
[6] José M. G. Vilar and Leonor Saiz. Reliable prediction of complex phenotypes from a modular design in free energy space: An extensive exploration of the lacoperon. ACS Synthetic Biology, 2(10):576–586, 2013.
[7] Jameson K. Rogers, Christopher D. Guzman, Noah D. Taylor, Srivatsan Ra- man, Kelley Anderson, and George M. Church. Synthetic biosensors for precise gene control and real-time monitoring of metabolites. Nucleic Acids Research, 43(15):7648–7659, 2015.
[8] Julia Rohlhill, Nicholas R. Sandoval, and Eleftherios T Papoutsakis. Sort-seq approach to engineering a formaldehyde-inducible promoter for dynamically regulatedEscherichia coli growth on methanol. ACS Synthetic Biology, page Advance online publication, 2017.
[9] Hernan G. Garcia and Rob Phillips. Quantitative dissection of the simple repression input-output function. Proceedings of the National Academy of Sciences, 108(29):12173–8, 2011a.
[10] Robert C. Brewster, Franz M. Weinert, Hernan G. Garcia, Dan Song, Mattias Rydenfelt, and Rob Phillips. The transcription factor titration effect dictates level of gene expression. Cell, 156(6):1312–1323, 2014.
[11] Franz M. Weinert, Robert C. Brewster, Mattias Rydenfelt, Rob Phillips, and Willem K. Kegel. Scaling of gene expression with transcription-factor fugacity.
Physical Review Letters, 113(25):1–5, 2014.
[12] Jacques Monod, Jeffries Wyman, and Jean-Pierre Changeux. On the nature of allosteric transitions: A plausible model. Journal of Molecular Biology, 12:88–118, 1965.
[13] Hernan G. Garcia, Heun Jin Lee, James Q. Boedicker, and Rob Phillips.
Comparison and calibration of different reporters for quantitative analysis of gene expression. Biophysical Journal, 101(3):535–544, 2011b.
[14] Robert C. Brewster, Daniel L. Jones, and Rob Phillips. Tuning promoter strength through RNA polymerase binding site design in Escherichia coli.
PLoS Computational Biology, 8(12):e1002811, 2012.
[15] James Q. Boedicker, Hernan G. Garcia, and Rob Phillips. Theoretical and experimental dissection of DNA loop-mediated repression. Physical Review Letters, 110(1):018101, 2013.
[16] James Q. Boedicker, Hernan G. Garcia, Stephanie Johnson, and Rob Phillips.
Dna sequence-dependent mechanics and protein-assisted bending in repressor- mediated loop formation. Physical Biology, 10(6):066005, 2013.
[17] Zhimin Huang, Liang Zhu, Yan Cao, Geng Wu, Xinyi Liu, Yingyi Chen, Qi Wang, Ting Shi, Yaxue Zhao, Yuefei Wang, Weihua Li, Yixue Li, Haifeng Chen, Guoqiang Chen, and Jian Zhang. Asd: a comprehensive database of allosteric proteins and modulators. Nucleic Acids Research, 39:D663, 2011.
[18] Gene-Wei Li, David Burkhardt, Carol Gross, and Jonathan S. Weissman. Quan- tifying absolute protein synthesis rates reveals principles underlying allocation of cellular resources. Cell, 157(3):624–635, 2014.
[19] Gary K. Ackers, Alexander D. Johnson, and Madeline A. Shea. Quantitative model for gene regulation by lambda phage repressor. Proceedings of the National Academy of Sciences, 79(4):1129–33, 1982.
[20] Nicolas E. Buchler, Ulrich Gerland, and Terence Hwa. On schemes of combi- natorial transcription logic. PNAS, 100(9):5136–41, 2003.
[21] José M. G. Vilar and Stanislas Leibler. DNA looping and physical constraints on transcription regulation. Journal of Molecular Biology, 331(5):981–989, 2003.
[22] Lacramioara Bintu, Nicolas E. Buchler, Hernan G. Garcia, Ulrich Gerland, Terence Hwa, Jané Kondev, Thomas Kuhlman, and Rob Phillips. Transcrip- tional regulation by the numbers: applications. Current Opinion in Genetics
& Development, 15(2):125–135, 2005.
[23] Rob Phillips. Napoleon is in equilibrium.Annual Review of Condensed Matter Physics, 6(1):85–111, 2015.
[24] Lacramioara Bintu, Nicolas E. Buchler, Hernan G. Garcia, Ulrich Gerland, Terence Hwa, Jané Kondev, and Rob Phillips. Transcriptional regulation by the numbers: models. Current Opinion in Genetics & Development, 15(2):116–
124, 2005.
[25] Thomas Kuhlman, Zhongge Zhang, Milton H. Saier, and Terence Hwa. Com- binatorial transcriptional control of the lactose operon of Escherichia coli.
Proceedings of the National Academy of Sciences, 104(14):6043–8, 2007.
[26] Robert Daber, Matthew A. Sochor, and Mitchell Lewis. Thermodynamic analysis of mutantlacrepressors. Journal of Molecular Biology, 409(1):76–
87, 2011.
[27] Stefan Klumpp and Terence Hwa. Growth-rate-dependent partitioning of RNA polymerases in bacteria. Proceedings of the National Academy of Sciences, 105(51):20245–50, 2008.
[28] Sarah Marzen, Hernan G. Garcia, and Rob Phillips. Statistical mechanics of Monod-Wyman-Changeux (MWC) models. Journal of Molecular Biology, 425(9):1433–1460, 2013.
[29] Ronald B. O’Gorman, John M. Rosenberg, Olga B. Kallai, Richard E. Dicker- son, Keichi Itakura, Arthur D. Riggs, and Kathleen Shive Matthews. Equilib- rium binding of inducer tolac repressor-operator DNA complex. Journal of Biological Chemistry, 255(21):10107–10114, 1980.
[30] Kevin F. Murphy, Gábor Balázsi, and James J. Collins. Combinatorial promoter design for engineering noisy gene expression. Proceedings of the National Academy of Sciences, 104(31):12726–12731, 2007.
[31] Robert Daber, Kim Sharp, and Mitchell Lewis. One is not enough. Journal of Molecular Biology, 392(5):1133–1144, 2009.
[32] Kevin F. Murphy, Rhys M. Adams, Xiao Wang, Gábor Balázsi, and James J.
Collins. Tuning and controlling gene expression noise in synthetic gene net- works. Nucleic Acids Research, 38(8):2712–2726, 2010.
[33] Matthew Almond Sochor. In vitrotranscription accurately predictslacrepres- sor phenotypein vivoinEscherichia coli. PeerJ, 2:e498, 2014.
[34] Mattias Rydenfelt, Robert Sidney Cox, Hernan Garcia, and Rob Phillips. Sta- tistical mechanical model of coupled transcription from multiple promoters due to transcription factor titration. Physical Review E, 89:012702, 2014.
[35] Devinderjit Sivia and John Skilling. Data analysis: a Bayesian tutorial. OUP Oxford, 2006.
[36] Stefan Oehler, Michèle Amouyal, Peter Kolkhof, Brigitte von Wilcken- Bergmann, and Benno Müller-Hill. Quality and position of the three lac operators of E. coli define efficiency of repression. The EMBO Journal, 13(14):3348–3355, 1994.
[37] Matthew Scott, Carl W. Gunderson, Eduard M. Mateescu, Zhongge Zhang, and Terence Hwa. Interdependence of cell growth and gene expression: Origins and consequences. Science, 330(6007):1099–102, 2010.
[38] Jennifer A. N. Brophy and Christopher A. Voigt. Principles of genetic circuit design. Nature Methods, 11(5):508–520, 2014.
[39] David L. Shis, Faiza Hussain, Sarah Meinhardt, Liskin Swint-Kruse, and Matthew R. Bennett. Modular, multi-input transcriptional logic gating with orthogonal LacI/GalR family chimeras.ACS Synthetic Biology, 3(9):645–651, 2014.
[40] Bruno M. C. Martins and Peter S. Swain. Trade-Offs and constraints in allosteric sensing. PLoS Computational Biology, 7(11):1–13, 2011.
[41] Victor Sourjik and Howard C. Berg. Receptor sensitivity in bacterial chemo- taxis.Proceedings of the National Academy of Sciences, 99(1):123–127, 2002.
[42] Juan E. Keymer, Robert G. Endres, Monica Skoge, Yigal Meir, and Ned S.
Wingreen. Chemosensing in Escherichia coli: Two regimes of two-state receptors.Proceedings of the National Academy of Sciences, 103(6):1786–91, 2006.
[43] Lee R. Swem, Danielle L. Swem, Ned S. Wingreen, and Bonnie L. Bassler.
Deducing receptor signaling parameters from in vivo analysis: LuxN/AI-1 quorum sensing inVibrio harveyi. Cell, 134(3):461–473, 2008.
[44] Leonid A. Mirny. Nucleosome-mediated cooperativity between transcription factors. Proceedings of the National Academy of Sciences, 107(52):22534–9, 2010.
[45] Tal Einav, Linas Mazutis, and Rob Phillips. Statistical mechanics of allosteric enzymes. The Journal of Physical Chemistry B, 121, 2016.
[46] Hernan G. Garcia, Alvaro Sanchez, James Q. Boedicker, Melisa Osborne, Jeff Gelles, Jane Kondev, and Rob Phillips. Operator sequence alters gene expression independently of transcription factor occupancy in bacteria. Cell Reports, 2(1):150–161, 2012.
[47] Jacques Monod, Jean-Pierre Changeux, and François Jacob. Allosteric proteins and cellular control systems.Journal of Molecular Biology, 6:306–329, 1963.
[48] Anthony Auerbach. Thinking in cycles: MWC is a good model for acetyl- choline receptor-channels. The Journal of Physiology, 590(1):93–8, 2012.
[49] Algirdas Velyvis, Ying R. Yang, Howard K. Schachman, and Lewis E. Kay. A solution NMR study showing that active site ligands and nucleotides directly perturb the allosteric equilibrium in aspartate transcarbamoylase.Proceedings of the National Academy of Sciences, 104(21):8815–20, 2007.
[50] Meritxell Canals, J. Robert Lane, Adriel Wen, Peter J. Scammells, Patrick M.
Sexton, and Arthur Christopoulos. A Monod-Wyman-Changeux mechanism can explain G protein-coupled receptor (GPCR) allosteric modulation.Journal of Biological Chemistry, 287(1):650–659, 2012.
[51] Ron Milo, Jennifer H. Hou, Michael Springer, Michael P. Brenner, and Marc W.
Kirschner. The relationship between evolutionary and physiological vari- ation in hemoglobin. Proceedings of the National Academy of Sciences, 104(43):16998–17003, 2007.
[52] Matteo Levantino, Alessandro Spilotros, Marco Cammarata, Giorgio Schirò, Chiara Ardiccioni, Beatrice Vallone, Maurizio Brunori, and Antonio Cupane.
The Monod-Wyman-Changeux allosteric model accounts for the quaternary transition dynamics in wild type and a recombinant mutant human hemoglobin.
Proceedings of the National Academy of Sciences, 109(37):14894–9, 2012.
[53] Rolf Lutz and Hermann Bujard. Independent and tight regulation of transcrip- tional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Research, 25(6):1203–10, 1997.
[54] Tae Seok Moon, Chunbo Lou, Alvin Tamsir, Brynne C. Stanton, and Christo- pher A. Voigt. Genetic programs constructed from layered logic gates in single cells. Nature, 491(7423):249–253, 2012.
[55] Leonor Saiz and Jose M. G. Vilar. Ab initio thermodynamic modeling of distal multisite transcription regulation. Nucleic Acids Research, 36(3):726, 2008.
[56] Sudheer Tungtur, Harlyn Skinner, Hongli Zhan, Liskin Swint-Kruse, and Dorothy Beckett. In vivo tests of thermodynamic models of transcription repressor function. Biophysical Chemistry, 159(1):142–151, 2011.
[57] Sture Forsén and Sara Linse. Cooperativity: over the hill. Trends in Biochem- ical Sciences, 20(12):495 – 497, 1995.
[58] Daniel L. Jones, Robert C. Brewster, and Rob Phillips. Promoter architecture dictates cell-to-cell variability in gene expression. Science, 346(6216):1533–
1536, 2014.
[59] Avigdor Eldar and Michael Elowitz. Functional roles for noise in genetic circuits. Nature, 467(7312):167–173, 2010.
[60] Ulrich Gerland and Terence Hwa. On the selection and evolution of regulatory DNA motifs. Journal of Molecular Evolution, 55(4):386–400, 2002.
[61] Johannes Berg, Stana Willmann, and Michael Lässig. Adaptive evolution of transcription factor binding sites. BMC Evolutionary Biology, 4(1):42, 2004.
[62] Konstantin B. Zeldovich and Eugene I. Shakhnovich. Understanding protein evolution: from protein physics to Darwinian selection. Annual Review of Physical Chemistry, 59(1):105–127, 2008.
[63] Shyam K. Sharan, Lynn C. Thomason, Sergey G. Kuznetsov, and Donald L.
Court. Recombineering: a homologous recombination-based method of ge- netic engineering. Nature Protocols, 4(2):206–223, 2009.
[64] Howard M. Salis, Ethan A. Mirsky, and Christopher A. Voigt. Automated design of synthetic ribosome binding sites to control protein expression.Nature Biotechnology, 27(10):946–950, 2009.
[65] Lynn C. Thomason, Nina Costantino, and Donald L. Court. E. coli genome manipulation by P1 transduction. Current Protocols in Molecular Biology, Chapter 1:Unit 1.17–1.17.8, 2007.
[66] Alfred Fernández-Castané, Claire E. Vine, Glòria Caminal, and Josep López- Santín. Evidencing the role of lactose permease in IPTG uptake by Es- cherichia coliin fed-batch high cell density cultures.Journal of Biotechnology, 157(3):391–398, 2012.
[67] Mitchell Lewis, Geoffrey Chang, Nancy C. Horton, Michele A. Kercher, He- len C. Pace, Maria A. Schumacher, Richard G. Brennan, and Ponzy Lu. Crystal structure of the lactose operon repressor and its complexes with DNA and in- ducer. Science, 271(5253):1247–54, 1996.
[68] Holden T. Maecker, Aline Rinfret, Patricia D’Souza, Janice Darden, Eva Roig, Claire Landry, Peter Hayes, Josephine Birungi, Omu Anzala, Miguel Garcia, Alexandre Harari, Ian Frank, Ruth Baydo, Megan Baker, Jennifer Holbrook, Janet Ottinger, Laurie Lamoreaux, C. Lorrie Epling, Elizabeth Sinclair, Maria A. Suni, Kara Punt, Sandra Calarota, Sophia El-Bahi, Gailet Alter, Hazel Maila, Ellen Kuta, Josephine Cox, Clive Gray, Marcus Altfeld, Nolwenn Nougarede, Jean Boyer, Lynda Tussey, Timothy Tobery, Barry Bredt, Mario Roederer, Richard Koup, Vernon C. Maino, Kent Weinhold, Giuseppe Pantaleo, Jill Gilmour, Helen Horton, and Rafick P. Sekaly. Standardization of cytokine flow cytometry assays. BMC Immunology, 6(1):13, 2005.
[69] Kenneth Lo, Ryan Remy Brinkman, and Raphael Gottardo. Automated gating of flow cytometry data via robust model-based clustering. Cytometry Part A, 73A(4):321–332, 2008.
[70] Nima Aghaeepour, Greg Finak, The FlowCAP Consortium, The DREAM Con- sortium, Holger Hoos, Tim R. Mosmann, Ryan Brinkman, Raphael Gottardo, and Richard H. Scheuermann. Critical assessment of automated flow cytome- try data analysis techniques. Nature Methods, 10(3):228–238, 2013.
[71] Alexandra K. Gardino, Brian F. Volkman, Ho S. Cho, Seok-Yong Lee, David E.
Wemmer, and Dorothee Kern. The NMR solution structure of BeF3-activated Spo0F reveals the conformational switch in a phosphorelay system. Journal of Molecular Biology, 331(1):245–254, 2003.
[72] Stephen Boulton and Giuseppe Melacini. Advances in NMR methods to map allosteric sites: From models to translation.Chemical Reviews, 116(11):6267–
6304, 2016.
[73] Stefan Oehler, Siegfried Alberti, and Benno Müller-Hill. Induction of thelac promoter in the absence of DNA loops and the stoichiometry of induction.
Nucleic Acids Research, 34(2):606–612, 2006.
[74] Mattias Rydenfelt, Hernan G. Garcia, Robert Sidney Cox, and Rob Phillips.
The influence of promoter architectures and regulatory motifs on gene expres- sion inEscherichia coli. PLoS ONE, 9(12):1–31, 2014.
[75] Alexander Schmidt, Karl Kochanowski, Silke Vedelaar, Erik Ahrné, Ben- jamin Volkmer, Luciano Callipo, Kèvin Knoops, Manuel Bauer, Ruedi Ae- bersold, and Matthias Heinemann. The quantitative and condition-dependent Escherichia coliproteome. Nature Biotechnology, 34(1):104–110, 2015.
[76] Chroma Technology Corporation. Chroma spectra viewer, 2016.
[77] Arthur D. Edelstein, Mark A. Tsuchida, Nenad Amodaj, Henry Pinkard, Ronald D. Vale, and Nico Stuurman. Advanced methods of microscope control usingµManager software. Journal of Biological Methods, 1(2):10–10, 2014.
[78] David Marr and Ellen Hildreth. Theory of edge detection. Proceedings of the Royal Society B: Biological Sciences, 207(1167):187–217, 1980.
[79] Steven Frank. Input-output relations in biological systems: measurement, information and the Hill equation. Biology Direct, 8(1):31, 2013.
[80] James N. Weiss. The Hill equation revisited: uses and misuses. The FASEB Journal, 11(11):835–41, 1997.
C h a p t e r 3