ALBERT THOMAS THENNAR
19010181
Rio Hermantara, , S.Si,. M.BIOTECH., PH.D.
(Field Supervisor)
Rio Hermantara, , S.Si,. M.BIOTECH., PH.D.
(i3L Supervisor)
(i3L)
PREFACE
This paper details the findings of a research that involved internships at the Indonesian International Institute for Life Sciences (i3L). This research, titled "Generating Stable Cell Lines Expressing Monoclonal Antibodies or Inducible Cas9" intends to incorporate monoclonal antibodies into the human genome by utilizing Cas9 for gene integration so that they may be produced in a stable manner.
I also want to thank Rio Hermantara, S.Si., M.Biotech., Ph.D., the head of Biomedicine, Elizabeth Sidhartha, B.Sc., M.Sc., who oversaw my internship and served as my field supervisor, as well as Marsia Gustiananda, S.Si., Ph.D., who served as my academic advisor. Without their direction and assistance, this project could not have been completed. Additionally, I'd like to thank all of my coworkers and my CRISPR Cas9 group that I can’t mention their names one by one who shared their knowledge, offered advice, and provided encouragement throughout this internship period.
Last but not least, I would like to express my gratitude to the Indonesia International Institute for Life Sciences (i3L) for allowing me to complete my internships here despite the pandemic conditions.
Sincerely,
Albert Thomas Thennar
In silico Design of Plasmid to Generate Stable Cell Line Expressing Monoclonal Antibodies with CRISPR Cas9 for Precision Gene Integration
Indonesia International Institute for Life Sciences
AUTHOR:
Albert Thomas Thennar 20010007 BIOMEDICINE
ACKNOWLEDGED BY:
HEAD OF DEPARTMENT AT I3L
ELIZABETH SIDHARTHA, B.Sc., M.Sc,
FIELD SUPERVISOR I3L
RIO HERMANTARA, , S.Si,.
M.BIOTECH., PH.D.
TABLE OF CONTENTS
Table of Contents
COVER 0
PREFACE i
ACKNOWLEDGEMENT PAGE ii
TABLE OF CONTENTS iii
LIST OF FIGURES iv
LIST OF TABLES v
LIST OF ABBREVIATIONS vi
SUMMARY/ABSTRACT 1
CHAPTER 1: INTRODUCTION 2
CHAPTER 2: PROJECT DESCRIPTION 3
CHAPTER 3: FINDINGS 9
Determine mAb system 9
Stable cell line knock-in experiment design 10-12
Clone donor plasmid 12-13
Integration location 13-14
CRISPR guide RNA 14-15
Determine Cas9 system 16
CHAPTER 4: CONCLUSION AND RECOMMENDATION 22
CHAPTER 5: SELF REFLECTION 23
APPENDICES 24
REFERENCES 25
Generating stable cell lines expressing monoclonal antibodies 9
LIST OF FIGURES
Figure 1. Illustration of a complete antibody 3
Figure 2. pVITRO1-Trastuzumab-IgG4/K 9
Figure 3. Infusion cloning of the mAb gene 12
Figure 4. Cloned donor plasmid with the mAb genes flanked by the HAs 12
Figure 5. The AAVS GSH sequence in the first intron of the PPP1R12C gene 13
Figure 6. AAVS1 locus annotated with gRNA spacer sequence candidate and aligned with homology
arms 14
Figure 7. Integration of the gRNA spacer sequence to the Cas9 plasmid 15
Figure 8. Cas9 plasmid integrated with the gRNA spacer sequence 16
LIST OF TABLES
Table 1 List of forward primer candidates for cloning the kappa and gamma chain of the mAb gene to
the donor plasmid 10
Table 2 List of reverse primer candidates for cloning the kappa and gamma chain of the mAb gene to
the donor plasmid 11
LIST OF ABBREVIATIONS gRNA: guidance RNA
CRISPR: clustered regularly interspaced short palindromic repeats Cas9: CRISPR associated protein 9
HDR: Homology directed repair HA: Homology arms
GSH site: Genomic safe harbor site KI: Knock in
mAb: monoclonal antibody
SUMMARY/ABSTRACT
Therapeutic mAbs are the class of innovative therapeutic molecules with the highest growth (mAbs). They have great potential for the treatment of many diseases, including cancer and chronic inflammatory conditions. In 1975 in order to develop monoclonal antibodies 2 scientists, Kohler and Milstein developed a technique in the fusion of myeloma cells with immunized mouse immune cells resulting in hybridoma cells capable of producing mAbs. However, this conventional method of producing mAb is not only costly and time demanding, but it also results in a decrease in the amount of viable antibodies because more than 99% of the cells do not survive the fusion process. The antibodies produced through hybridoma are also not a 100% human antibody gene but a mix of mouse or rodents which may possess immune reaction and reduced bioavailability. Over the course there have been several ways to improve the production of monoclonal antibodies namely using genetic vectors such as plasmid to integrate the mAb gene into the target expression system. This could reduce production cost and also reduce toxicity and prolong bioavailability. Genome editing technology has been to insert genetic material at specific spots into the human genome for practically a while, this insertion ensured that the desired gene would be stably expressed in the expression system. Here, I have designed plasmid vectors for monoclonal antibody gene insertion into HEK293 cells using CRISPR technology. First, the AAVS1 locus was recognized as the precise location where the mAb genes would be cloned. For this, a donor vector bearing certain HAs and an all-in-one Cas9-expressing vector are required. As a result, a donor vector was created by fusion cloning the mAb genes into the HA-containing, empty donor vector. Finally, gRNA spacer sequences were cloned into the Cas9 expressing plasmid to direct the Cas9 system to cut in the required particular location.
Keyword:CRISPR Cas9; Monoclonal Antibody; Stable cell line expression; PCR cloning; gene knock-in
CHAPTER 1: INTRODUCTION
1.1 Description about the Company
As a premier school for higher education specifically in the life sciences, Indonesia International Institute for Life Sciences (i3L) was founded in 2014. Both the school of business and the school of biological sciences are available as study program categories on i3L. Six undergraduate programs are available at the school of life sciences at i3L: biomedicine, bioinformatics, pharmacy, food technology, and food sciences and nutrition. While the school of business provides four core degrees, including Business & Entrepreneurship in Life Sciences, International Business Management, Creative Digital Marketing, and International Applied Accounting.
A leading, globally networked, multidisciplinary organization that influences society via research and innovation must be the goal of i3L. In order to realize these goals, i3L works to maximize national resources in order to boost Indonesia's worldwide competitiveness in all spheres.
Additionally, i3L offers top-notch instructors, cutting-edge facilities, and international partnerships with businesses, communities, academic institutions, and governments. In order to develop a fresh and promising generation of leaders and entrepreneurial scientists, i3L also places a strong emphasis on providing a distinctive, multidisciplinary, and integrative learning environment to all students.
1.2 Description of Department
Biomedicine is a research that primarily targets the development of new therapeutics to aid cure human disease. Tumor biology and infectious diseases, two important health issues in Indonesia, are the emphasis of the biomedicine program at i3L. By using it on research projects, biomedicine students in i3L receive training in both theoretical and advanced laboratory techniques.
Students will learn about creating treatment plans, examining human samples, running research on both human and animal illnesses, and comprehending the molecular mechanisms behind how the human body functions.
1.3 Product of the Host Institution/Company
Students have several possibilities to increase their knowledge and soft skills through research as well as in the actual world of employment thanks to i3L, including becoming a teaching assistant, research assistant, or aiding faculty professors with their research projects. Additionally, i3L allows students to take part in several research projects that are contests and conferences both domestically and abroad. With the help of the iisma program run by the Indonesian government and university MoA, i3L has also been successful in sending its students abroad to the UK, Taiwan, China, Korea, Australia, and many other nations.
CHAPTER 2: PROJECT DESCRIPTION
2.1 Internship Project
The project titled Generating Stable Cell Lines Expressing Monoclonal Antibodies or Inducible Cas9 took place within the internee home for two months, starting from July 1stuntil August 31st, 2022.
1.1 Project Background
Monoclonal antibodies (mAbs) were discovered in 1975 where 2 scientists Kohler and Milstein developed a technique to produce this antibody called hybridoma in which immortal cancerous cell lines were fused with B cells producing antibodies. After the selected leads have been selected, these leads will then eventually be used to generate the humanized antibodies or chimeric.
The fastest-growing class of novel therapeutic compounds is therapeutic mAbs. They show considerable potential for the therapy of several illnesses, including cancer and chronic inflammatory disorders (Quinteros et.al, 2017). However, the existing manufacturing and purifying procedures have a limit on the amount of therapeutic antibodies that can be produced, which raises the price. Other than that it also possesses some safety concerns such as immune reaction and serum sickness amongst other things.
Figure 1. Illustration of a complete antibody (adapted from Bayat et.al, 2018 )
Four polypeptide chains—two light chains (L chains) and two heavy chains (H chains), linked together by disulfide bonds, make up the fundamental structure of all antibodies. These four polypeptide chains come together to create a symmetrical molecule that is frequently pictured as having the shape of a "Y" and being made up of two identical halves with identical antigen binding sites on both. Each antibody polypeptide chain has two primary sections (variable and constant) that may be distinguished based on amino acid sequence variations. A constant region especially includes a transmembrane domain that enables the expression of Ig on the surface of B cells (Schroeder &
Cavacini, 2010). They enable antigen-specific binding and subsequent B cell activation. The light chain on the other hand guarantees that functional antibodies are produced and secreted, and they also help antibodies bind to antigens by making antibodies more variable (Schroeder & Cavacini, 2010). The antigen-binding sites in both the light and heavy chains are formed by hypervariable sequences in the variable regions (Alberts et.al, 2002). The immunoglobulin class is determined by constant areas in heavy chains, which also enable complement proteins to bind.
Antibodies, which are produced quickly from vaccinated organisms, are crucial for the creation of therapeutic and diagnostic tools as well as for the advancement of vaccine research.
However the traditional way of producing mAbs through cell fusion or hybridomas was inefficient resulting in low expression of mAb (Scott & Crowe, 2015). By isolating and cloning variable region cDNAs from antigen-specific single B cells into antibody expression vectors, new methods have been devised to get beyond the drawbacks of hybridoma/immortal cell lines and combinatorial display platforms. Once the desired gene has been isolated and multiplied the gene needs to be integrated into a specific loci in the target genome to be able to stably express.
In order for the plasmid to be able to express inside the mammalian expression system it needs to be transfected into the mammalian cell first. There are several ways of transfection that could be used such as heat shock and electroporation however it has been stated by several researchers that these methods may alter cell viability (Chong et.al, 2021). Lipofection on the other hand is a safe method to transfect foreign DNA material into a host cell without disturbing the cell viability. The process involves encapsulation of the plasmid with the lipid membrane, after this when the lipid suspension is introduced to the cells, the lipid membrane will be endocytosed by the cells and become an endosome that will eventually released the plasmid to the cytoplasm.
Genes are characterized as discrete units of genetic data needed for the synthesis of polypeptides. Introns, the promoter and terminator, and the coding sequence are all included. A gene's transcription and translation are two ways that expression is characterized. A certain host is necessary for the expression of a specific gene. For the large-scale generation of recombinant proteins, a variety of expression methods are now available. These expression methods include E.
coli, yeast, various mammalian-based systems, and baculovirus-mediated insect cell expression.
Several mammalian cell lines have been used for gene expression, with HEK 293 (Human embryonic kidney) and CHO being the most popular (Chinese hamster ovary) (Khan, 2013). One of the major advantages of mammalian cell expression is the precise and efficient recognition of the signals for eukaryotic protein synthesis, processing, and secretion.
2.1.2 Scope of the Project
In silico design of plasmid containing CRISPR Cas9 system and Monoclonal antibody plasmid two each separate plasmid. This would include:
● Search and design the plasmid that contain the desired CRISPR Cas9 expression system from AddGene
● Design gRNA targeting the AAVS1 sequence
● Search and design a plasmid that contain the desired monoclonal antibody gene and design a donor plasmid that could contain the heavy and the light chains of the monoclonal antibody gene and the right and left homology arm (HA)
● Protocol for gene editing monoclonal cells that express the mAb genes 2.1.3 Objectives/Aims
The aim of this project is to design strategies and plasmid vectors to develop stable mammalian cell lines expressing monoclonal antibodies for biopharmaceutical productions
2.1.4 Problem Formulation and Proposed Solution
Up until now there is still a lack of research on production of a cell line that could express mAb and mostly also due to the high cost of the development. The conventional way of expressing antibodies involves the fusion of myeloma cells and spleen cells isolated from immunized mice where next they will use selection for their monoclonal antibodies. It takes a long time to complete this procedure, and the ingredients required for the fusion technique of producing monoclonal antibodies are not always inexpensive. A reduction in the number of usable antibodies that may be made against an antigen is caused by the fact that more than 99% of the cells do not survive throughout the fusion process.
However using genetic delivery such as plasmid carrying the monoclonal antibodies by in vivo production may become a solution to this problem. This method will use the CRISPR Cas9 system to allow precise gene integration into a loci that enables the mammalian cell to stably express the desired gene. With this method of integration of the gene the high cost of production could be reduced making it economically viable. Other than that this method will improve the stable expression of the desired gene which reduces toxicity and prolongs the mAbs life cycle in the host cells.
Materials and Methods Materials:
● Plasmid map downloaded from Addgene
○ p-AAVS1-PMCS (Addgene plasmid #80488)
○ pSpCas9 (Addgene plasmid #48138)
○ pVitro (Addgene plasmid #61887)
● Benchling (https://www.benchling.com/)
● Addgene (https://www.addgene.org/)
● NCBI (https://www.ncbi.nlm.nih.gov/)
● Genbank (https://www.ncbi.nlm.nih.gov/genbank/) 2.1.5 Methodology
Determine mAb system
The sequences of the monoclonal antibodies were obtained through Beavil and colleagues lab where in total plasmid containing different monoclonal antibodies were grouped according to the target of the antibody binds. One plasmid contains antibodies that target grass pollen allergen. Four plasmids contain antibodies that will bind to the HER2 receptor. Two plasmids contain antibodies that will bind to immunoglobulin. Lastly, only one plasmid contains an antibody that does not have specificity. After all plasmid has been collected and imported into a benchling website, each plasmid is then annotated with to note any important gene that was not shown initially in the plasmid maps.
From that list of groups the plasmid, pVITRO1-Trastuzumab-IgG4/k that contains the gamma heavy chain and the kappa light chain that together will form the isotypes IgG4 antibody was chosen to be used as the mAb system.
Integration location
Three commonly used genomic safe harbor sites were listed from literature review as possible sites for the desired gene namely CCR5, hRosa26, and AAVS . The sequences of all three GSHs were obtained from the Genbank and NCBI website and were listed into 1 google sheet file to be shared. After some more consideration, the AAVS1 site was chosen to be used as the genome site for the integration of the monoclonal antibody gene.
Clone donor plasmid
In this project a homology directed repair (HDR) knock in strategy was chosen to be used, for this to happen the mAb needed to be flanked with homology sequences of the target site. Therefore 3 possible donor plasmids containing the left homology arm and right homology arms were obtained from 2 separate labs which are Knot Woltjen and colleagues, also Doyon and colleagues where they were listed in one table. From the list one plasmid (pAAVS1-P-MCS) was chosen as the donor plasmid to integrate the monoclonal antibody gene flanked by the homology arms. In order for the mAb gene to be inserted into the donor plasmid a restriction digest needed to be performed therefore a restriction enzyme was chosen based on the availability of the plasmid which is PacI that will create
an overhang. Since the mentioned enzyme was absent in the mAb system an infusion cloning needed to be performed in order for the mAb gene sequences could be integrated into the donor plasmid.
The determination of the primer candidate was done by using the benchling website using the “Primer” option. The Primer wizard option was chosen and the parameters for the primers were inputted including the target region, the length of the primers, Tm, GC content, and the size of the amplicon. After that the system will generate the primers option and give the candidate list of primers which in this case results in 3 sets of primers to be chosen each for forward and reverse primers. From the list finally one set of the primers are chosen to be used in the PCR cloning method which is named as “Primer1” and “Primer2”. For each chain of the mAb genes a primer chosen by using the same primer wizard tool from benchling, additionally 15 nt conserve sequence upstream and downstream of PacI restriction enzyme in the p-AAVS-P-MCS was added to the 5’ end of the kappa chain and 3’ end of the gamma chain respectively. On the other hand, 15 nt conserve sequence to the gamma fragment was added to the 3’ end and 5’ end of the kappa and gamma chain respectively as depicted in Figure 7.
Determine Cas9 system
Plasmid sequences containing the CRISPR Cas9 system were obtained from addgene's repository site. In total, 12 plasmid from 6 different labs were listed in the sheet file. From that list, pSpCas9(BB)-2A-GFP (PX458) that contains 2 selection marker which is eGFP and AmpR also one single gRNA scaffold other than that the plasmid also contain the BbsI restriction enzyme was chosen to be used in Figure 8. The BbsI enzyme will recognize the recognition enzyme in the Cas9 plasmid and create an overhang on the DNA sequence as depicted in Figure 7.
CRISPR guide RNA
To easily determine where the gRNA will target, the HA in the donor plasmid and GSH sequence needs to be aligned therefore the homology arms can be seen and annotated in the GSH sequence site. By doing so gives a better visualization to where in the AAVS1 loci that the CRISPR Cas9 complex will cut. The spacer sequence of the gRNA is then determined by using the benchling website under the “CRISPR guide” and the GSH sequence selected to be target sequence either using a genbank file or FASTA sequence. After that the single guide RNA option was chosen with the length of 20 nucleotides with NGG as the selected PAM sequence that will help the gRNA to find the target site in the target genome.
The system will automatically generate the candidate sequence for the gRNA sequence with the on and off target sequence displayed on the most right hand side of the display. Finally for a total of 4 gRNA sequences were annotated through the benchling website listed as candidates referred
Table 1. In the end 1 final candidate was chosen as the gRNA was going to be inserted into the CRISPR Cas9 system upstream of the gRNA scaffold. The gRNA then was integrated to the Cas9 system plasmid using BbsI restriction enzymes to create an overhang upstream of the gRNA scaffold in the Cas9 plasmid. To ensure that the spacer sequence successfully integrated into the Cas9 plasmid a few nucleotides complementary to the overhand created by the digestion of BbsI was added in Figure 7. Finally by using ligation the sequence is integrated into the Cas9 plasmid.
CHAPTER 3: FINDINGS
3.1. Result
Determine mAb system
From a total of 4 pVITRO1 plasmid was taken from Beavil and colleagues lab. The particular pVITRO1-Trastuzumab-IgG4/kwas chosen to be used because the plasmid contains the gamma chain and kappa chain which combine they will make the IgG isotype of the antibody. Not only that IgG isotypes constitute 80% of the total antibody in the plasma it has also stated that the IgG antibody not only exhibits superior antitumor activity but also it did not weaken the effect of ADCC (antibody dependent cellular cytotoxicity).
Stable cell line knock-in experiment
Total of 3 candidates of the forward primers were chosen to be used as the primer for the cloning of the mAb gene into the donor plasmid. pVITRO1-Trastuzumab-IgG4/κ (Traztuzumab)-Antibody system indicates the name of the plasmid containing the mAb gene. The first number indicates the start of the primer and the second number indicates the end of the primer.
Meanwhile FWD indicated that it is the forward primer. Based on the GC content, Tm, and the length of the primers the pVITRO1-Trastuzumab-IgG4/κ (Traztuzumab)-Antibody system 3931-3952 FWD 6 and pVITRO1-Trastuzumab-IgG4/κ(Traztuzumab)-Antibody system 3931-3952 FWD 2 was chosen to be used to clone in the mAb gene.
Table 1List of forward primer candidates for cloning the kappa and gamma chain of the mAb gene respectively to the donor plasmid
No Name Forward Sequence GC
content
Melting temperature
Length
1 pVITRO1-Trastuzumab-Ig G4/κ
(Traztuzumab)-Antibody system 3931-3952 FWD 6 [Primer2]
tgctggccttttgctcacatgt 50.0% 59.7°C 22
2 pVITRO1-Trastuzumab-Ig G4/κ
(Traztuzumab)-Antibody system 507-528 FWD 2 (Primer1)
ggggagaacggtatataagtgc 50% 54.3°C 22
Total of 3 candidates of the forward primers were chosen to be used as the primer for the cloning of the mAb gene into the donor plasmid. pVITRO1-Trastuzumab-IgG4/κ (Traztuzumab)-Antibody system indicates the name of the plasmid containing the mAb gene. The first number indicates the start of the primer and the second number indicates the end of the primer.
Meanwhile REV indicated that it is the reverse primer. Based on the GC content, Tm, and the length of the primers the pVITRO1-Trastuzumab-IgG4/κ(Traztuzumab)-Antibody system 3931-3952 REV 6 and pVITRO1-Trastuzumab-IgG4/κ(Traztuzumab)-Antibody system 3931-3952 REV 2 was chosen to be used to clone in the mAb gene.
Table 2 List of reverse primer candidates for cloning the kappa and gamma chain of the mAb gene respectively to the donor plasmid
No Name Reverse Sequence GC
content
Melting temperature
Length
1 pVITRO1-Trastuzumab-IgG4 /κ (Traztuzumab)-Antibody system 3931-3952 REV 6 [Primer2]
tgccgatatactatgccgatga 45.5% 55.1°C 22
2 pVITRO1-Trastuzumab-IgG4 /κ (Traztuzumab)-Antibody system 507-528 REV 2 (Primer1)
ccccctgaacctgaaacataaa 45.5% 54.3°C 22
To introduce the mAb genes into the donor plasmid by using fusion cloning method. In one of the 5’ end and 3’ end of mAb genes a primer 15 nt conserve sequence of the donor plasmid was added and 15 nt conserve sequence of the donor plasmid was added to the other end of the mAb sequence.
Clone donor plasmid
This particular donor plasmid contains not only the HAs that would be needed to guide the antibody genes to the target integration site and direct the HDR in the integration of the desired gene, but also the plasmid possess 2 different selection markers for 2 different systems. One marker for selection of bacteria and one marker for selection in the mammalian system.
Integration location
The AAVS1 locus was found to be in the first intron of the PPP1R12C. Here as the figure depicted the first intron in located in the first 5,000 bp of the PPP1R12C gene sequence
The AAVS1 locus was then aligned with the homology arms from the donor plasmid and the candidate for the gRNA spacer sequence was also annotated on the sequence represented by small sequences hovering over the plasmid sequence.
CRISPR guide RNA
Total of 4 gRNA spacer sequences was obtained using the benchling “CRISPR Guide” tool with the average of 70 points for the on target score and 30 points on the off target score. The AAVS indicates the target site of the spacer sequence and the first number indicates the start of the sequence and the last number indicates the last number of the sequence. Meanwhile FWD indicates sense strand and REV indicates antisense strand. In this project based on the on and off target score the first gRNA spacer sequence was chosen as indicated in the bold characters.
Table 3List of gRNA candidates targeting the AAVS1 GSH site.
No Name Sequence Position On-target
score
Off target score
1 AAVS GSH sequence 1788-1807 FWD
5' gggaccaccttatattccca 3' +/ 1807 71.3 41.0
2 AAVS GSH sequence 1846-1865 FWD
5' ctgtcccctccaccccacag 3' +/ 1865 61.6 20.5
3 AAVS GSH sequence 1874-1893 REV
5' gtcaccaatcctgtccctag 3' –/ 1874 61.0 42.7
4 AAVS GSH sequence 1993-2012 REV
5' gagatggctccaggaaatgg 3' –/ 1874 70.3 33.0
The gRNA spacer sequence was inserted into the Cas9 expression plasmid by the help of PCR cloning. The spacer sequence will then be integrated to the plasmid through the restriction digestion site performed by BbsI. To make sure the sequence is integrated in the proper orientation, a few nucleotides complementary to the overhang end were added.
Determine Cas9 system
12 different plasmids was chosen from 6 different labs, what make this particular plasmid was chosen and what makes this plasmid different from the other 12 plasmid is that this plasmid not only contain the gRNA scaffold and the restriction enzyme to be used to integrate the gRNA spacer sequence but also the selection marker in the form of AmpR gene to choose which plasmid that has been successfully undergoes gene integration.
3.2 Discussion
Every gene needs a promoter in order for the gene to be transcripted which in this case is represented by the mEF-1 alpha promoter upstream of the heavy chain gene. This segment of gene has been reported to enhance the expression level of genes in many cell lines (Kim et.al, 2002). In this plasmid the SV40 poly A signal gene segment was also planned to be transcripted into the donor plasmid, this gene will ensure the ribosomes in the cytoplasm will convert the mature messenger RNA molecule into a protein before it is exported from the nucleus and also acts as a termination signal for plasmid transcription (Li et.al, 2012).
Numerous studies have been conducted in order to produce mAb, but Kohler and Milstein's 1975 study had the biggest impact on the ability to produce pure mAbs in large quantities. However, the most early research in developing mAb involved combining sequences from the murine variable domain and the human constant region and expressing them. It was discovered that this strategy has solved the issue of diminished immunogenic potential and effectiveness. However, using the aforementioned methods will result in a chimeric mAb that has both a murine and a human region.
This has the drawback of having a shorter half-life than a totally human antibody and lower activity (Gholmain et.al, 2018). Not only that, but a mAb with a murine and human area might result in an allergic response, according to Pintea I and colleagues in 2021. The next research by Davies et al. and Choi et al. used a yeast artificial chromosome vector in 1993 to insert human IgK and IgH to a mouse embryonic stem cell and successfully produced the human antibody rather than the mouse antibody.
This method was developed by scientists to produce a fully human antibody by inserting the human antibody gene into the murine genome and using the mouse or rodents as the expression system.
Similar studies were conducted by Taylor and colleagues in 1992, and they discovered that the mice produced the human heavy chain and kappa light chain. However, they also discovered that the amount of expressed human antibody was 10% lower than the amount of endogenous mouse antibody.
This project was adapted from several studies that tried to express monoclonal antibodies in a cell line using a plasmid design on which they inserted it into a mammalian expression system where they showed better expression of the antibody (Carrara et.al, 2021). One of them is a research that was done in 2016 by Jared and colleagues in which they wanted to produce a stable cell line expressing both structure of the mAb namely the heavy chain and the light chain in two different plasmids. In their case they found that the bicistronic plasmid produces a 1.5 to 2 fold of expression compared to the monocistronic plasmid. However it has been found that there is a large drawback to using a 2 different plasmid is that ratio of the expression of the heavy chain and the light chain (Ho et.al, 2012). Another study that was conducted by Bayat and colleagues found that plasmid
containing dual promoter systems expressed better mAb yield. However in this project it was found that by adding both of the heavy chain and the light chain alongside the promoters and the terminator into a bidirectional plasmid will resulting in the size of the donor plasmid will exceed 15,000 bp which might affect the success rate and the level of expression of the desired gene (Lesueur et.al, 2016).
Genomic safe harbors (GSHs) are locations in the genome that can accept the integration of additional genetic material while ensuring that the inserted genetic elements:operate reliably and do not result in changes to the host genome that put the host cell or organism at danger (Papapetrou &
Schambach, 2016). GSHs are therefore excellent transgene insertion sites that can be used to further functional genetics research in fundamental science and for therapeutic purposes in human gene therapy. There are several GSHs that have been used as a target for integration of genes amongst them is the AAVS1 gene. The AAVS1 locus itself is a sequence of genes that could be found specifically in the first intron of the PPP1R12C gene as depicted in Figure 5. The Cas9 gene, single-guide RNA (sgRNA), and homology arms must be added for precise gene editing utilizing homology-directed repair (HDR). These homology arms help to adjust the gRNA design so we would know where to target specifically in the AAVS1 locus in Figure 6.
In the human system there are 2 ways to repair strand breaks that happen in the DNA sequence namely Non homologous end joining (NHEJ) or homology directed repair (HDR). Ideally HDR is the choice for double strand breaks that require a donor template or sequence to direct the repair; without it the system will use the NHEJ process which is prone to error (Yang et.al, 2020).
Therefore to induce the HDR a homologous sequence of the target sequence is needed flanking the gene of interest as depicted in Figure 3. This homology arms sequence will have a complementary sequence to the target site which will pair itself with the broken DNA end resulting from the Cas9 complex accompanied by strand invasion and the formation of the holliday junction. The Holliday junction is then moved along DNA during branch migration, expanding the area of heteroduplex distant from the initial crossover point. By cleaving the junction to generate independent duplex DNA molecules once more, the Holliday junction intermediate is finally resolved. This particular donor plasmid was chosen because it contains the homology arms of the target sequence which is the AAVS1 GSH site.
In this experiment the mAb gene will be inserted into the donor plasmid by using the PacI restriction enzymes creating an overhang end and fusion cloning method. However since the mAb plasmid did not contain the same restriction enzyme in the mAb gene that contained in the donor plasmid a PCR cloning needed to be performed in order for the mAb could be integrated into the
donor plasmid. The cloning method requires additional few nucleotides complementary to the overhang produced by the restriction enzymes similarly for the integration of the process of integration of the spacer sequence into the Cas9 plasmid in Figure 3. The red sequence in the 3’ end of the kappa chain in Figure 3 represents the conserved region of the gamma chain and complementary to the red sequence in the 5’ end of the gamma chain. This complementary sequence was made in order for the gamma chain and the kappa chain to be one single strand under one same promoter which is the CMV promoter. Therefore when the transcription happens both genes will be transcribed. On the other hand the blue and green sequences in Figure 3 represent the conserve 15 nt that is complementary to the donor plasmid resulting from digestion with the restriction enzymes. This will ensure that the mAb gene will be integrated into the donor plasmid in the right orientation
The Cas9 system mostly consisted of two different yet connected part which is the Cas9 enzyme itself which is an endonuclease and the gRNA that will guide the Cas9 system to be able to specifically cut into the desired target site on the genome this made the high specificity properties of the Cas9 system. The Cas9 system itself will stay relatively the same between each plasmid design however the gRNA most specifically the spacer sequence that will guide the Cas9 system itself is the one that could be programmable or edited to guide the Cas9 system to specific sites in the genome.
In this project the Cas9 system was specifically designed to cut into a specific site in the PPP1R12C gene which is the 1 intron of the gene where the AAVS1 gene is located.
The gRNA spacer sequence was inserted just upstream of the gRNA scaffold into the Cas9 plasmid system using restriction enzymes digest, specifically BbsI enzyme. BbsI is categorized as a type II restriction enzyme meaning that the enzyme will create repeatable fragments and distinctive gel electrophoresis patterns by cleaving DNA at certain places in relation to its recognition sequence.
Compared to type I restriction enzymes type II restriction enzymes will cut directly at the recognition site and have a specific sequence of cleavage making this type of restriction enzymes to be mostly prefered in gene editing (Stier & Kiss, 2010). In this Cas9 expression plasmid upstream of the gRNA scaffold there is a restriction enzyme recognition site for BbsI enzyme which. This particular Cas9 expression plasmid was chosen because of its all-in-one purpose; it has the promoter and the enhancer to initiate and increase the transcription process of the gene. Also as earlier said that this plasmid has the recognition site for the BbsI restriction enzymes for the integration of the gRNA spacer sequence. Not only that, the plasmid also holds 2 selection markers which are the AmpR gene and the EGFP gene. This enzyme will recognize the specific restriction site in the DNA sequence as depicted on the blue barred sequence depicted in Figure 7A. The enzyme will then cut the specific site in the Cas9 system to create an overhang where the spacer sequence could be inserted into the
plasmid as depicted in Figure 7b represented by the blue color. Before the spacer sequence was inserted additional few base pairs complements to the overhang needed to be added to either 5’ of the spacer sequence and the 3’ of complementary sequence of the spacer, this will ensure the integration of the spacer sequence as represented by the red sequence as depicted in Figure3.
The spacer sequence of the gRNA was obtained from the “CRISPR guide” tool in benchling. In total 4 possible sequences for the spacer sequence were listed, amongst which 1 spacer was chosen based on the on and off target score of the spacer sequence which is the “AAVS GSH sequence 1788-1807 FWD”. A significant contact between the guide sequence and the complementary DNA sequence is required for a double-stranded break (DSB) to take place at the guide-specified position.
The likelihood of a successful DSB formation varies with the interaction of the gRNA and the target sequence. This interaction between the gRNA and the target sequence is called the on-target score which ranges from 0%-100%, a higher score indicates greater on-target proficiency. Doench et al.
formulated the "on-target score" in 2014 to assess how successfully a certain sgRNA directs Cas9 to the desired location for cleaving. The results have assisted researchers in choosing better sgRNAs for CRISPR trials. To better gauge the on-target activity of sgRNA, Doench and colleagues released the Rule Set 2 score in February 2016.
Doench et al created the primary new release of the on-goal rating in 2014 the use of statistics from 1,841 sgRNAs. To create the Rule Set 2 score, they blended the primary dataset with extra than 4,000 sgRNAs. Doench and associates formerly made a model to decide if a sure sgRNA is in the pinnacle 20% of on-goal interest amongst all sgRNA. Since the version categorizes a sgRNA into one in every of categories—pinnacle 20% (excessive on-goal interest) or now no longer pinnacle 20%—it's miles acknowledged as "type modeling" (low on-goal interest). It does, however, lose a number of statistics:withinside the CRISPR studies, a top 1% sgRNA could be extensively extra powerful than a top 10% sgRNA, however withinside the earlier modeling approach, their on-goal ratings could be equal. used gadget mastering algorithms that may rank all sgRNAs. In the Rule Set 2 rating Doench and associates used gadget mastering algorithms that may rank all sgRNAs. This form of computational modeling is referred to as a “regression version.” Using this modeling method, Rule Set 2 ratings for a top 1% sgRNA may be better than the ones for a top 10% sgRNA. Now you could evaluate which sgRNA may also have the best on-goal interest amongst all sgRNAs. To estimate the earlier on-goal rating of sgRNAs, Doench and associates created the very last version for the gadget mastering approach that had more new characteristic sets.
A given guide should have no homology with any other sequences in the genome and 100%
identity with the target sequence. There are several possible off-target locations that have one or
more mismatches, however since target sequence binding may tolerate multiple mismatches. An off-target score (between 0% and 100%) is calculated, with a higher value indicating targets with lesser off-target potential. It represents the inverse chance of cutting off-target. Hsu and colleagues published research on how the off-target score was made and calculated. In their result they demonstrate that by using four criteria, they should not be followed by a PAM containing either 5′-NGG or 5′-NAG sequences, first and foremost. Second, their overall sequence similarity to the target sequence should be kept to a minimum, and it's best to stay away from guide sequences that contain genomic off-target loci with less than three mismatches. Third, the off-target site should have two or more mismatches that are close to the PAM. Fourth, there shouldn't be more than one mismatch, and they should be located no more than four bases apart. Finally, the ratio of on-to-off-target cleavage may be optimized by titrating the amounts of SpCas9 and sgRNA. They developed a scoring method based on these parameters to quantify and combine the effects of mismatch position, density, and identity on SpCas9 on-target and off-target cleavage.
CHAPTER 4: CONCLUSION AND RECOMMENDATION
This In-silico uses the CRISPR Cas9 method for precise gene integration to create a viable cell line that could produce monoclonal antibody genes. As a start a CRISPR Cas9 expression plasmid was chosen and to make the Cas9 to cut into a specific target region the gRNA spacer sequence was chosen and cloned into the plasmid. After that the desired mAb genes were cloned into the donor plasmid containing two homology arms. These homology arms not only will act as a guide for the mAb gene to reach the target site but also to direct the insertion of the gene into the target strand to undergo HDR. Finally the plasmid will be transfected into the HEK293 cells to be expressed. Since this project is only done as an in-silico project to ensure the gene integration it is a good option to utilize PCR and sequencing to ensure that mAb gene has been successfully integrated and the genes were on the expected orientation. It is also a good opportunity to realize this project to become a hands on experiment.
CHAPTER 5: SELF REFLECTION
This internship has taught me a lot about my own strengths and weaknesses. It was thought to be self-controlled on when I should work on the project and when I should rest to avoid burnout. From this internship I found that I need to sacrifice a few things in order to achieve the end of this internship and achieve my goal and that helps with my critical thinking and my decision making. If I persevere and hold on to my goal I now know I could achieve anything. However I realize now from this internship I also know that sometimes I did not realize about timing which may or may not affect the pace of how I work which may result in my own burnout. Nevertheless I now know on which part I need to improve in myself in order for me to grow into a better person and scientist. The knowledge that i3L has provided me throughout my years of study including how BRIGHT sessions provide skills for me to be able to finish this internship project has proven to bear fruit.
APPENDICES
Appendix 1. pAAVS1-P-MCS donor plasmid containing the HAs
REFERENCES
Dodev TS, Karagiannis P, Gilbert AE, Josephs DH, Bowen H, James LK, Bax HJ, Beavil R, Pang MO, Gould HJ, Karagiannis SN, Beavil AJ. A tool kit for rapid cloning and expression of recombinant antibodies. Sci Rep. 2014 Jul 30;4:5885. doi: 10.1038/srep05885. PMID:
25073855; PMCID: PMC4115235.
Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott, D. A., & Zhang, F. (2013). Genome engineering using the CRISPR-Cas9 system. Nature protocols, 8(11), 2281–2308.
https://doi.org/10.1038/nprot.2013.143
Oceguera-Yanez, F., Kim, S. I., Matsumoto, T., Tan, G. W., Xiang, L., Hatani, T., Kondo, T., Ikeya, M., Yoshida, Y., Inoue, H., & Woltjen, K. (2016). Engineering the AAVS1 locus for consistent and scalable transgene expression in human iPSCs and their differentiated derivatives. Methods (San Diego, Calif.), 101, 43–55.https://doi.org/10.1016/j.ymeth.2015.12.012
Lesueur, L. L., Mir, L. M., & André, F. M. (2016). Overcoming the Specific Toxicity of Large Plasmids Electrotransfer in Primary Cells In Vitro. Molecular therapy. Nucleic acids, 5(3), e291.
https://doi.org/10.1038/mtna.2016.4
Ho, S. C., Bardor, M., Feng, H., Mariati, Tong, Y. W., Song, Z., Yap, M. G., & Yang, Y. (2012).
IRES-mediated Tricistronic vectors for enhancing generation of high monoclonal antibody expressing CHO cell lines. Journal of biotechnology, 157(1), 130–139.
https://doi.org/10.1016/j.jbiotec.2011.09.023
Bayat, H., Hossienzadeh, S., Pourmaleki, E., Ahani, R., & Rahimpour, A. (2018). Evaluation of different vector design strategies for the expression of recombinant monoclonal antibody in CHO cells.
Preparative biochemistry & biotechnology, 48(2), 160–164.
https://doi.org/10.1080/10826068.2017.1421966
Kim, S. Y., Lee, J. H., Shin, H. S., Kang, H. J., & Kim, Y. S. (2002). The human elongation factor 1 alpha (EF-1 alpha) first intron highly enhances expression of foreign genes from the murine cytomegalovirus promoter. Journal of biotechnology, 93(2), 183–187.
https://doi.org/10.1016/s0168-1656(01)00388-1
Li, S. P., Feng, J. J., Wang, H. G., Wang, X. F., & Lv, Z. J. (2012). Yi chuan = Hereditas, 34(1), 113–119.
https://doi.org/10.3724/sp.j.1005.2012.00113
Papapetrou, E. P., & Schambach, A. (2016). Gene Insertion Into Genomic Safe Harbors for Human Gene Therapy. Molecular therapy : the journal of the American Society of Gene Therapy, 24(4), 678–684.https://doi.org/10.1038/mt.2016.38
Ang, J. X., Nevard, K., Ireland, R., Purusothaman, D. K., Verkuijl, S., Shackleford, L., Gonzalez, E., Anderson, M., & Alphey, L. (2022). Considerations for homology-based DNA repair in mosquitoes: Impact of sequence heterology and donor template source. PLoS genetics, 18(2), e1010060.https://doi.org/10.1371/journal.pgen.1010060
Hsu, P., Scott, D., Weinstein, J. et al. DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol 31, 827–832 (2013).https://doi.org/10.1038/nbt.2647
Doench, J., Fusi, N., Sullender, M. et al. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol 34, 184–191 (2016).
https://doi.org/10.1038/nbt.3437
Doench JG, Hartenian E, Graham DB, Tothova Z, Hegde M, Smith I, Sullender M, Ebert BL, Xavier RJ, Root DE. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nat Biotechnol. 2014 Dec;32(12):1262-7. doi: 10.1038/nbt.3026. Epub 2014 Sep 3. PMID: 25184501; PMCID: PMC4262738.
Wilson, P. C., & Andrews, S. F. (2012). Tools to therapeutically harness the human antibody response.
Nature reviews. Immunology, 12(10), 709–719.https://doi.org/10.1038/nri3285
Quinteros, D. A., Bermúdez, J. M., Ravetti, S., Cid, A., Allemandi, D. A., & Palma, S. D. (2017).
Therapeutic use of monoclonal antibodies: general aspects and challenges for drug delivery.
Nanostructures for Drug Delivery, 807–833.
https://doi.org/10.1016/B978-0-323-46143-6.00025-7
Stier, I., & Kiss, A. (2010). The type II restriction endonuclease MvaI has dual specificity. Nucleic acids research, 38(22), 8231–8238.https://doi.org/10.1093/nar/gkq676
Smith, S. A., & Crowe, J. E., Jr (2015). Use of Human Hybridoma Technology To Isolate Human Monoclonal Antibodies. Microbiology spectrum, 3(1), AID–2014.
https://doi.org/10.1128/microbiolspec.AID-0027-2014
Chong, Z. X., Yeap, S. K., & Ho, W. Y. (2021). Transfection types, methods and strategies: a technical review. PeerJ, 9, e11165.https://doi.org/10.7717/peerj.11165
Yang H, Ren S, Yu S, Pan H, Li T, Ge S, Zhang J, Xia N. Methods Favoring Homology-Directed Repair Choice in Response to CRISPR/Cas9 Induced-Double Strand Breaks. Int J Mol Sci. 2020 Sep 4;21(18):6461. doi: 10.3390/ijms21186461. PMID: 32899704; PMCID: PMC7555059.
Megantara, S., Wathoni, N., Mohammed, A., Suhandi, C., Ishmatullah, M. H., & Putri, M. (2022). In Silico Study: Combination ofα-Mangostin and Chitosan Conjugated with Trastuzumab against Human Epidermal Growth Factor Receptor 2. Polymers, 14(13), 2747.
https://doi.org/10.3390/polym14132747
Khan K. H. (2013). Gene expression in Mammalian cells and its applications. Advanced pharmaceutical bulletin, 3(2), 257–263.https://doi.org/10.5681/apb.2013.042
Schroeder, H. W., Jr, & Cavacini, L. (2010). Structure and function of immunoglobulins. The Journal of
allergy and clinical immunology, 125(2 Suppl 2), S41–S52.
https://doi.org/10.1016/j.jaci.2009.09.046
Alberts B, Johnson A, Lewis J, et al. Molecular Biology of the Cell. 4th edition. New York: Garland
Science; 2002. B Cells and Antibodies. Available from:
https://www.ncbi.nlm.nih.gov/books/NBK26884/
Gholamin, S., Mirzaei, H., Razavi, S. M., Hassanian, S. M., Saadatpour, L., Masoudifar, A., ShahidSales, S., & Avan, A. (2018). GD2-targeted immunotherapy and potential value of circulating microRNAs in neuroblastoma. Journal of cellular physiology, 233(2), 866–879.
https://doi.org/10.1002/jcp.25793
Pintea, I., Petricau, C., Dumitrascu, D., Muntean, A., Branisteanu, D. C., Branisteanu, D. E., & Deleanu, D. (2021). Hypersensitivity reactions to monoclonal antibodies: Classification and treatment
approach (Review). Experimental and therapeutic medicine, 22(3), 949.
https://doi.org/10.3892/etm.2021.10381
Carrara, S. C., Fiebig, D., Bogen, J. P., Grzeschik, J., Hock, B., & Kolmar, H. (2021). Recombinant Antibody Production Using a Dual-Promoter Single Plasmid System. Antibodies (Basel, Switzerland), 10(2), 18.https://doi.org/10.3390/antib10020018
Davies, N. P., Rosewell, I. R., Richardson, J. C., Cook, G. P., Neuberger, M. S., Brownstein, B. H., ... &
Brüggemann, M. (1993). Creation of mice expressing human antibody light chains by introduction of a yeast artificial chromosome containing the core region of the human immunoglobulin κ locus. Bio/Technology, 11(8), 911-914.
Choi, T. K., Hollenbach, P. W., Pearson, B. E., Ueda, R. M., Weddell, G. N., Kurahara, C. G., Woodhouse, C. S., Kay, R. M., & Loring, J. F. (1993). Transgenic mice containing a human heavy chain immunoglobulin gene fragment cloned in a yeast artificial chromosome. Nature genetics, 4(2), 117–123.https://doi.org/10.1038/ng0693-117
Taylor, L. D., Carmack, C. E., Schramm, S. R., Mashayekh, R., Higgins, K. M., Kuo, C. C., Woodhouse, C., Kay, R. M., & Lonberg, N. (1992). A transgenic mouse that expresses a diversity of human sequence heavy and light chain immunoglobulins. Nucleic acids research, 20(23), 6287–6295.https://doi.org/10.1093/nar/20.23.6287
Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott, D. A., & Zhang, F. (2013). Genome engineering using the CRISPR-Cas9 system. Nature protocols, 8(11), 2281–2308.
https://doi.org/10.1038/nprot.2013.143
Oceguera-Yanez, F., Kim, S. I., Matsumoto, T., Tan, G. W., Xiang, L., Hatani, T., Kondo, T., Ikeya, M., Yoshida, Y., Inoue, H., & Woltjen, K. (2016). Engineering the AAVS1 locus for consistent and scalable transgene expression in human iPSCs and their differentiated derivatives. Methods (San Diego, Calif.), 101, 43–55.https://doi.org/10.1016/j.ymeth.2015.12.012
Addgene [Biology Software]. (2022). Retrieved fromhttps://www.addgene.org/
Benchling [Biology Software]. (2022). Retrieved fromhttps://benchling.com
