Developing CRISPR Strategies to Generate Stable Cell Lines that Expressed GABRA1 Subunit for alzheimer Disease Models

(1)

(2)

PREFACE

This internship report is dedicated to the completion of the credit internship program in Indonesia International Institute for Life Sciences (i3L) at the Department of Biomedicine. The aim of this project is to generate the stable cell lines using the CRISPR-Cas9 system for Alzheimer’s Disease.

The internship program aims to enhance the skill of the student especially in in-silico study while studying in university or for future prospects in the real-work setting. Besides, the student is also expected to obtain and broaden their knowledge about genetics and genomic modification which may be regarded to be significantly prominent from what has been studied at the institution.

This credit internship project cannot be successfully done without the support from all people who have been involved in the project. First and foremost, I would like to express my gratitude to Rio Hermantara, , S.Si., M.Biotech., Ph.D. who has accepted me to join in the project and supervise me throughout the period of the internship. I also want to thank my group mates “The GABA Gang”, my family, and friends, who have been supporting me during the internship. I had an amazing time during the internship and I hope the knowledge I have obtained will be helpful for my future career.

(3)

ACKNOWLEDGEMENT PAGE

Developing CRISPR Strategies to Generate Stable Cell Lines that Expressed GABRA1 Subunit for Alzheimer Disease Models

Indonesia International Institute for Life Sciences (i3L)

AUTHOR:

VIRGINIA GLADYS LEE 19010147 BIOMEDICINE

ACKNOWLEDGED BY:

FIELD AND SUPERVISOR AT I3L

Rio Hermantara, S.Si., M.Biotech., Ph.D.

HEAD OF DEPARTMENT AT I3L

Elizabeth Sidhartha, B.Sc., M.Sc.

(4)

LIST OF FIGURES

Figure 1. Cas9-expressing plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 from Feng Zhang Lab Figure 2. AAVS1-targeting empty backbone pAAVS1-P-MCS from Knut Woltjen Lab

Figure 3. Illustration of transgene insertion into the pAAVS1-P-MCS plasmid; the GABRA1 gene that will be inserted is from the GABRA1 expressing plasmid, pCMV-GABRA1-IRES2-EGFP

Figure 4. Cas9-gRNA expressing plasmid design

Figure 5. The coding sequence (exons) of GABRA1 subunit

Figure 6. The alignment of the CDS of GABRA1 with GABRA1 gene from GABRA1 expressing plasmid Figure 7. Alignment of the HA-L from pAAVS1-P-MCS plasmid with the flanking site of the AAVS1 gene

Figure 8. Alignment of the HA-R from pAAVS1-P-MCS plasmid with the flanking site of the AAVS1 gene

Figure 9. Final design of Cas9-gRNA expressing plasmid containing gRNA from AAVS1 gene Figure 10. Final design of AAVS1 expressing plasmid containing the transgene

(6)

LIST OF TABLES

Table 1. List of gRNA obtained from the AAVS1 gene Table 2. AAVS1 target gRNA design

(7)

LIST OF ABBREVIATIONS

AAVS1 : Adeno-associated virus integration site 1 AD : Alzheimer’s Disease

AmpR : Ampicillin Resistance Gene

CRISPR : Clustered Regularly Interspaced Short Palindromic Repeats DSB : Double Strand Break

GABA : Gamma Amino-butyric Acid GABRA : GABA Receptor Alpha GABRB : GABA Receptor Beta GABRG : GABA Receptor Gamma

gRNA : guide RNA

GSH : Genomic Safe Harbors HDR : Homology-Directed Repair

KI : Knock In

MCS : Multiple Cloning Site PCR : Polymerase Chain Reaction PuroR : Puromycin Resistance Gene

(8)

ABSTRACT

GABA or gamma-aminobutyric acid is the major neurotransmitter that acts as inhibitors in the central nervous system. It is synthesized by the GAD or glutamic acid decarboxylase and transported into the synaptic system. GABAAreceptors are a protein consisting of at least 20 different subunits and considered as a complex molecule in the human brain. Specifically, theα1 subunit is abundantly expressed in the stratum radiatum of the CA1 region as it occupies 60% of the total subunit present in the brain. It is known that in Alzheimer Disease patients, the GABAAα1 receptor undergoes some alteration, resulting in many harm risks such as losing the binding site for important drugs as well as the binding of GABA itself which plays a crucial role in preserving memories. The new technology of CRISPR-Cas9 gene editing is expected to be a promising research for Alzheimer Disease models as the process is low on the cost, straightforward, and precise. The model is also chosen because in-vitro model of AD is not yet available. Thus, this in-silico study opens a research area on in-vitro models of AD especially for developing stable cell lines that can express the GABRA1 subunit. The procedure was done by using CRISPR-Cas9 genome editing technology where knock-in strategies to initiate homology directed repair is focused. Thus, the project expects that these procedures can be implemented by hands-on experiments as promising research for in-vitro Alzheimer’s Disease models in the future.

(9)

CHAPTER 1: INTRODUCTION

1.1. Host Institution

1.1.1. Description about the Institution

Indonesia International Institute of Life Sciences (i3L) is a private university and research institute located in Jakarta, Indonesia. It was established in collaboration with Karolinska Institute and Swedish University of Agricultural Sciences in 2014. The university is currently offering 10 undergraduate programs from School of Life Sciences which are Bioinformatics, Biomedicine, Biotechnology, Food Science and Nutrition, Food Technology, and Pharmacy, and School of Business which are Business and Entrepreneurship in Life Sciences, Creative Digital Marketing, International Applied Accounting, and International Business Management. i3L has the vision to become the leading and globally-connected interdisciplinary institution that impacts society through science and innovation by competing in national and international prospects.

1.1.2. Description of Department

Biomedicine is a study program focusing on human health and well-being. The department provides teaching and learning materials in analyzing human samples, performing pre-clinical and clinical trials, developing new drugs and vaccines both in the private industry and governmental agencies. The study is crucial for developing drug discovery design. Currently, the Department of Biomedicine offers two specialization streams which are infectious disease and tumor biology. All of them are expected to be implemented in academic, business, and government sectors in the future and also bring beneficial developments in medicine for the society.

1.1.3. Product of the Host Institution

The institution is an educational institution as well as a research institution that provides knowledge and hands-on experience that will be helpful for the graduates to implement them in a work-setting environment.

(10)

CHAPTER 2: PROJECT DESCRIPTION

2.1. Internship Project 2.1.1. Project Background

GABA or gamma-aminobutyric acid is a one of neurotransmitters that is majorly presented in the human brain as it is also considered to have multiple functions in the nervous system and other neuronal tissues. GABA function can be expressed when it binds to the GABA receptor. There are two types of GABA receptor, the first one is the ligand gated chloride channel receptor which are the GABAA and GABAC, and the second one is the metabotropic receptor which is the GABAB receptor (Watanabe et al., 2002). GABAAreceptor is a pentamer formed byα1-6,β_1-3,γ_1-2, andδsubunits. Each of them is made from a large extracellular N-terminal domain and four hydrophobic membrane-spanning domains, along with the extracellular C-terminal domain (Watanabe et al., 2002). The GABAAreceptor also has intracellular loops that can be targeted by protein kinases and also required for other functions such as anchoring the receptor to the cytoskeleton. In this project, the one that was studied is GABAAreceptor, especially theα1 subunit that is majorly presented in the limbic system; the area of the brain which generates feelings and emotional memories. When a GABAA receptor containing α1 subunit is activated, it will produce sleepiness, sedation, and anti epilepsia (Shibasaki et al., 2016). In this experiment, GABAAreceptorα1 is studied for the Alzheimer Disease model as it is one of the most subunits that is present in the human brain.

In this experiment, GABAAreceptorα1 is studied for the Alzheimer Disease model because it is one of the most subunits that is present in the human brain. AD is associated with the development of dementia through a loss of synapse density as well as degeneration of glutamatergic and cholinergic pathways (Limon et al., 2012). A study showed that in AD patients, the binding of benzodiazepines is decreased by 13%-17%, meaning that there is a decrease of GABAAreceptors in AD. It can happen because some of the receptors in AD patients undergo alteration in their function (Limon et al., 2012). Several studies have been done using in-vivo models that are often used to study AD. However, they are often induced by chemical (scopolamine) treatment that might not represent the actual AD. In-vitro models are not yet available, and due to that reason, we aim to develop an in-vitro model for AD using other cell lines which are easier to grow and engineered to express the GABAAreceptor in the in-vitro model of AD.

In order to modify the cell, genetic engineering by CRISPR-Cas9 was done. CRISPR-Cas9 is a technology to target a specific gene site and cut it precisely. Cas9 itself is a protein that is vital in defending bacteria from DNA viruses and foreign plasmids. The system promotes genome editing by

(11)

generating the double-strand break (DSB) and initiating the DNA damage repair pathways (Ran et al., 2013).

This study is expected to be involved in further research of the AD model as it can later be used for various experimental purposes such as testing substances that interact with GABAAreceptor α1. Thus, successfully generating the stable cell lines that express the GABA_Areceptor α1 subunit receptor by in-silico is a crucial step for doing the hands-on experiment in the future.

2.1.2. Scope of the project

This project is an in-silico design of Developing CRISPR Strategies to Generate Stable Cell Lines expressing GABA α1 subunit receptor for Alzheimer Disease Models. This would include the design of donor plasmids containing GABA α1 subunit coding sequence (CDS) flanked by AAVS1 homology arms, AAVS1 gRNA, and all-in-one Cas9-gRNA expressing plasmid.

2.1.3. Objectives

The aim of this project is to design strategies to develop stable cell lines expressing the GABA α1 receptor for Alzheimer’s Disease cellular modeling.

2.1.4. Problem formulation and Proposed Solutions

This project is conducted due to the absence of cellular models for the disease including the GABAA receptors. Thus, the strategies to do the genetic engineering were designed using thein-silico approach. The strategy that was used is knock-in strategies, a process in which the target sequence is inserted to the target site using the CRISPR-Cas9 system.

2.1.5 Materials and Methods 2.1.5.1 Materials

In order to generate the stable cell lines, two plasmids were needed which are (i) the Cas9-expressing plasmid and (ii) the GABAA-expressing plasmid. The Cas9-expressing plasmid will cut the gene in the target site and the AAVS1-targeting empty backbone plasmid with puromycin selection will be inserted into the target site, inserting the gene that has been cut by Cas9 in the cleaved site.

The plasmid that was used in this experiment is pSpCas9(BB)-2A-Puro (PX459) V2.0 which has 9174 base pairs (Figure 1) (Ran et al., 2013). There are several component in the plasmid such as Cas9, a protein that is present in the bacteria and play big role in genetic engineering, PuroR (puromycin resistance gene) for mammalian selection, AmpR (ampicillin resistance gene) that play an important role in switching the gene expression on and off and acts as catalyst in antibiotic

(12)

resistance, U6 promoter that will be recognized by the RNA polymerase III which transcribes short RNAs (Cheng & Chang, 2007), and restriction enzymes that is crucial in genetic editing.

Figure 1. Cas9-expressing plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 from Feng Zhang Lab

The second plasmid is the AAVS1-targeting empty backbone or donor vector that will be inserted by the GABA transgene. In this project, pAAVS1-P-MCS which plasmid which has 5504 base pairs was used (Figure 2) (Oceguera-Yanez et al., 2016). The components in this plasmid are PuroR (puromycin resistance gene), the left and right homology arms of AAVS1, and restriction enzymes.

(13)

Figure 2. AAVS1-targeting empty backbone pAAVS1-P-MCS from Knut Woltjen Lab

2.1.5.2 Methods Benchling

This project used a software called Benchling to do the genomic editing. It is used to design the gRNA from the gene by using the feature “Design and Analyze guide” as well as aligning one sample to another by using the “Sequence Alignment” feature. The step starts with adding all the plasmids and genes into the Benchling and annotating them using the “Annotation” feature.

GABAA1 Transgene Sequence

The NCBI GABRA1 subunit sequence contains a CDS region that is involved in protein expression. The CDS were generated by splicing out the intron sequence. Consequently, the GABAA1-expressing plasmid from Addgene (https://www.addgene.org/170820/) was collected and the sequence was aligned with the GABRA1 CDS.

Cloning the GABRA1 Transgene into the Donor Vector

The transgene or GABRA1 coding sequence will then be inserted into the donor vector which is the pAAVS1-P-MCS plasmids by conducting the PCR cloning procedure. The GABRA1 subunit has the size of 52kb and after the introns being spliced out, the remaining exons form 8 exons with a size of 1288 base pairs sequence. Subsequently, the transgene will be amplified with the PCR sequences

(14)

that have the restriction enzyme at both ends or called as overhangs. The transgene sequence that will be used here is from the Addgene plasmid and it is not an endogenous sequence. The restriction enzyme that was used is SpeI and XbaI, where both of them are located in AAVS1 locus and also the pAAVS1-P-MCS plasmid. Since the plasmid has both restriction enzymes and we want to insert the transgene into it, designing primers to attach with the transgene so it can be cloned into the plasmid sequence were conducted. PCR cloning will then have the transgene amplification, resulting in its attachment to the plasmid as shown in Figure 3.

Figure 3. Illustration of transgene insertion into the pAAVS1-P-MCS plasmid; the GABRA1 gene that will be inserted is from the GABRA1 expressing plasmid, pCMV-GABRA1-IRES2-EGFP.

Designing the gRNA/Spacer

The gRNA or spacer designing can be done in the Benchling by using its feature called

“Design and Analyze Guide”. The first step is finding the AAVS1 gene and collecting the homology arms from the sequence map. The gRNA location must be between the left homology arm (HA-L) and the right homology arm (HA-R) of the AAVS1. The gRNA was obtained from the Benchling and it is shown below in Table 1.

(15)

Table 1. List of gRNA obtained from the AAVS1 gene

No gRNA PAM On-target Score Off-target Score

1 GGGGCCACTAGGGACAGGAT TGG 54.5 57.3

2 GTCACCAATCCTGTCCCTAG TGG 61.0 57.7

From the target gene, which is AAVS1, there are two gRNA that are possible to be used for the Cas9-gRNA plasmid. From the table, we can see that there is a difference between the on-target score and the off-target score from each gRNA. The on-target score shows the efficiency of Cas9 cleavage, and since the scoring system is not linear, the gRNAs that have a score of 60 or higher are only 5%. On the other hand, the off-off target score represents the inverse probability of the Cas9 binding, which means if the score is higher, then the sequence has a lower possibility of binding to other sequences in the genome. Thus, the gRNA used in this project is the second in Table 1, which is GTCACCAATCCTGTCCCTAG, as it has higher both on-target and off-target scores.

After the gRNA is obtained, the next step is to clone the gRNA into the Cas9-gRNA expressing plasmid, which is the pSpCas9(BB)-2A-Puro (PX459) V2.0. The gRNA will be placed between two BbsI restriction enzymes, a type II S restriction enzyme that can recognize the sequence specifically and generate overhangs and the restriction site outside the recognition site. The gRNA will then be cloned into the plasmid by completing the complementary sequences that complement the overhangs, as shown in Figure 3 below.

Figure 4. Cas-9gRNA expressing plasmid design

From Figure 4, it can be seen that at the BbsI restriction site, there are overhangs at the sticky ends which are labeled with the red color. The left overhang is the TGTGG and the right overhang is the GTTTT, both of which will be complementary to their complement and the gRNA will successfully be cloned into the plasmid. The gRNA design can be seen in the Table 2 below.

(16)

Table 2. AAVS1 target gRNA design

No gRNA design

1 AAVS1 target gRNA1

Sense : CACCGGGGCCACTAGGGACAGGAT Antisense : CCCCGGTGATCCCTGTCCTA CAAA Oligo 1 : CACCGGGGCCACTAGGGACAGGAT Oligo 2 : AAACATCCTGTCCCTAGTGGCCCC 2 AAVS1 target gRNA2

Sense : CACCGTCACCAATCCTGTCCCTAG Antisense : CAGTGGTTAGGACAGGGATCCAAA Oligo 1 : CACCGTCACCAATCCTGTCCCTAG

Oligo 2 : AAACCTAGGGACAGGATTGGTGAC

(17)

CHAPTER 3: FINDINGS

3.1. Result

In the GABRA1 subunit, there is a region that expresses the functional protein called the coding sequence (CDS) or the exons of the sequence. The CDS was collected by splicing out the introns, leaving only the exons in the sequence as in Figure 4.

Figure 5. The coding sequence (exons) of GABRA1 subunit

The GABRA1 subunit has the size of 52kb and after the introns were spliced out, the exons were stitched together creating a sequence with a length of 1,368 base pairs. The obtained sequence will then be aligned with the GABRA1 expressing plasmid, which is the pCMV-GABRA1-IRES2-EGFP to see if the sequence has the same nucleotides. Alignment process was performed by the Benchling feature “Sequence Alignment” and the result is shown in Figure 6 below.

(18)

Figure 6. The alignment of the CDS of GABRA1 with GABRA1 gene from GABRA1 expressing plasmid

From Figure 6, it can be seen that the CDS of GABRA1 match with the GABRA1 gene from the pCMV-GABRA1-IRES2-EGFP plasmid. All of the exons are present in the plasmid, meaning that all the functional protein can be successfully expressed later in the cell lines.

Following the transgene, the gRNA for the Cas9-gRNA all-in-one plasmid was also made by generating it from the flanked sequence in AAVS1 gene. From the target gene, which is AAVS1, there are two gRNA that are possible to be used for the Cas9-gRNA plasmid. From Table 1, we can see that there is a difference between the on-target score and the off-target score from each gRNA. The on-target score shows the efficiency of Cas9 cleavage, and since the scoring system is not linear, the gRNAs that have a score of 60 or higher are only 5%. On the other hand, the off-off target score represents the inverse probability of the Cas9 binding, which means if the score is higher, then the sequence has a lower possibility of binding to other sequences in the genome. Thus, the gRNA used in this project is the second in Table 1, which is GTCACCAATCCTGTCCCTAG, as it has higher both on-target and off-target scores.

In order to insert the donor vector into the AAVS1 gene, the plasmid needs to have the same homology arms sequence as the gene. It can be obtained by aligning the HA-L and HA-R from the pAAVS1-P-MCS plasmid with the flanking site in AAVS1 gene using the “Sequence Alignment” feature in Benchling as the result shown below in Figure 7 and Figure 8.

(19)

Figure 7. Alignment of the HA-L from pAAVS1-P-MCS plasmid with the flanking site of the AAVS1 gene

Figure 8. Alignment of the HA-R from pAAVS1-P-MCS plasmid with the flanking site of the AAVS1 gene

It can be seen that both of the homology arms matched with the flanking sequence in the AAVS1 gene, meaning that the plasmid can be inserted into the AAVS1 gene specifically into the target site.

(20)

The last step is designing all of the plasmid in the Benchling. Figure 9 below shows the result of the final design of Cas-gRNA expressing plasmid. The gRNA that was generated from AAVS1 gene was inserted into the plasmid by complementing the sequence between BbsI restriction enzymes; it is a type IIS restriction enzyme that can recognize the sequence outside their recognition site.

Figure 9. Final design of Cas9-gRNA expressing plasmid containing gRNA from AAVS1 gene The last one is the insertion of the transgene into the AAVS1 locus that is shown in Figure 10 below.

Figure 10. Final design of AAVS1 expressing plasmid containing the transgene

(21)

3.2. Discussion

Alzheimer Disease is associated with the development of dementia through a loss of synapse density as well as degeneration of glutamatergic and cholinergic pathways (Limon et al., 2012). A study showed that in AD patients, the binding of benzodiazepines is decreased by 13%-17%, meaning that there is a decrease of GABAAreceptor expression in AD. It can happen because some of the receptors in AD patients undergo alteration in their function (Limon et al., 2012). The alteration of GABAAreceptors is dangerous because it affects the binding of important drugs as well as the GABA itself, which plays an important role in preserving memories in the brain.

Several studies have been done using in-vivo models that are often used to study AD.

However, they are often induced by a chemical treatment called scopolamine that might not represent the actual AD. Since the in-vitro models are not yet available, we focus on developing an in-vitro model for AD using other cell lines which are easier to grow and engineered to express the GABAAreceptor. The cell line that will be the target is HEK293 cells or Human Embryonic Kidney 293 cells. It is reported that HEK293 can be used for stable gene expression by modifying the target sequences ("Synthego", 2022). HEK293 cell is also easy to be cultured and can last longer unlike neuronal cells which have already matured and usually died after three days after it is cultured.

The new development of genome editing tools shows promising research for developing the in-vitro AD models as the actual model is difficult to be extracted and cultured. The procedure is to generate stable cell lines to induce the expression of GABAAreceptors. In this project, CRISPR-Cas9 method was used. CRISPR-Cas9 is a genome editing technology that offers efficient and precise gene targeting. It is chosen because it has a simpler procedure compared to other genomic tools such as zinc finger nucleases (ZFN) or transcription activator-like effector nucleases (TALENs). The CRISPR system has two major components, which are single guide RNA and Cas9 endonucleases. The gRNA will lead the Cas9 to the target site by changing 20 nucleotides sequences of the 5’ of the gRNA.

When the target is cut, DNA double strand break (DSB) will be generated. The donor vector which contains the transgene will be directed to the target site by the repair pathways within the flanked homologous sequence where the DNA breaks. There are two major pathways; the first one is the non-homologous end joining pathway (NHEJ) and the second one is the homologous-directed repair pathway (HDR). This project focuses on how the cell initiates the HDR process as it promotes a high fidelity feature that is expected to express the protein or transgene perfectly compared to NHEJ that is more prone to errors (Ran et al., 2013).

In order to make our target cell which is the HEK293 cell to express GABAAreceptor α1, a target gene called AAVS1 gene was chosen. It is a genomic safe harbor that can ensure to not cause

(22)

any alteration if it is inserted into the human and also it is commonly used to express the transgene perfectly. From the AAVS1 gene, gRNA for the CRISPR-Cas9 system was generated. There are two gRNAs; GGGGCCACTAGGGACAGGAT (on-target score: 54.5, off-target score: 57.3) and GTCACCAATCCTGTCCCTAG (on-target score: 61.0, off-target score: 57.7). On-target score means the inverse probability of Cas9 binding. The higher the on-target score, the higher chance of Cas9 to cut the area specifically and the higher the off-target score, the higher chance of Cas9 to cut outside the desired area, which can lead to off-target and undesired mutation (Haeussler et al., 2016). Thus, the second gRNA was chosen to be the guide as the scores are higher than the first gRNA.

In order to insert the transgene, a region between SpeI and XbaI restriction enzyme within the left and right homology arms in the pAAVS1-P-MCS plasmid was chosen. Those restriction enzymes were chosen because they promote multiple cloning sites and molecular orientation purposes. The transgene itself was not obtained from the whole GABRA1 gene due to the difficulty of neuronal cell extraction. Thus, GABRA1 expressing plasmid pCMV-GABRA1-IRES2-EGFP was used because the plasmid has already express the proteins, proven from the alignment of GABRA1 exons with pCMV-GABRA1-IRES2-EGFP. Afterwards, the GABRA1 will then be cloned by using PCR cloning method that requires primers to ligate the transgene with the end of restriction enzyme sequences.

CRISPR-Cas9 genome editing offers many possibilities for research in the future, such as generating monoclones, which were implemented in this project. Generating stable cell lines have to undergo several procedures; transfection, selection, and verification. The transfection process means inserting the foreign nucleic acids or DNA into the cell so the newly introduced genes can be expressed, but before it is achieved, the transfected cells need to undergo the selection process. The selection marker that is used in this project is G418 or geneticin. It is produced byMicromonospora rhodorangeaand commonly used for testing eukaryotic engineered cells.After all stable cell lines are selected, then they need to be verified first whether or not the gene that has been transfected is successfully expressed in the host cell. Since this project is an in-silico study, further research such as hands-on experiments is required to get the actual results.

(23)

CHAPTER 4: CONCLUSION AND RECOMMENDATION

To conclude, this in-silico study focuses on generating the stable cell lines expressing GABRA1 subunit in Alzheimer Disease in-vitro model. The HDR-based donor vector containing the GABRA1, AAVS1 gRNA, all-in-one Cas9-gRNA expressing plasmid is expected to be successful as it promotes the high-fidelity feature. Since this is anin-silicoproject, it is recommended to do the in-vitro cloning and genome editing with these plasmids by conducting hands-on experiments to get the actual results.

(24)

CHAPTER 5: SELF REFLECTION

Through this internship, I have learned more about genetic engineering and its application in in-silico studies. The procedure has many advantages, such as cost savings and not needing wet lab experiments. Stepping out of my comfort zone was not an easy move. Still, I believe I have developed myself by increasing my soft skill in communication, teamwork, and also enthusiasm for the project. I realized that I still had a lot of weaknesses throughout the process, especially adapting to online meetings, which have been my major issue during the pandemic. Still, in the end, I managed to understand all the materials after having struggles along the way. There were times when I did leave behind, but I tried my best to keep on track until the end of the internship period. Those ups and downs are the one that makes me who I am today; without the struggles, I would still be the old me.

I hope to be better at studying this topic and delivering it to others in the future.

(25)

APPENDICES

1. GABRA1 expressing plasmid pCMV-GABRA1-IRES2-EGFP

(26)

REFERENCES

Cheng, T., & Chang, W. (2007). Construction of Simple and Efficient DNA Vector-Based Short Hairpin RNA Expression Systems for Specific Gene Silencing in Mammalian Cells. Gene Function Analysis, 223-241. doi: 10.1007/978-1-59745-547-3_13

Haeussler, M., Schönig, K., Eckert, H., Eschstruth, A., Mianné, J., Renaud, J.-B., Schneider-Maunoury, S., Shkumatava, A., Teboul, L., Kent, J., Joly, J.-S., & Concordet, J.-P. (2016). Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR.Genome Biology,17(1).https://doi.org/10.1186/s13059-016-1012-2

Limon, A., Reyes-Ruiz, J. M., & Miledi, R. (2012). Loss of functional GABAAreceptors in the Alzheimer Diseased brain. Proceedings of the National Academy of Sciences, 109(25), 10071–10076.

https://doi.org/10.1073/pnas.1204606109

Oceguera-Yanez, F., Kim, S., Matsumoto, T., Tan, G., Xiang, L., & Hatani, T. et al. (2016). Engineering the AAVS1 locus for consistent and scalable transgene expression in human iPSCs and their differentiated derivatives. Methods, 101, 43-55. doi: 10.1016/j.ymeth.2015.12.012

Ran, F., Hsu, P., Wright, J., Agarwala, V., Scott, D., & Zhang, F. (2013). Genome engineering using the CRISPR-Cas9 system. Nature Protocols, 8(11), 2281-2308. doi: 10.1038/nprot.2013.143 Shibasaki, M., Mori, T., & Suzuki, T. (2016). The K + -cl − cotransporter KCC2 and Zolpidem.

Neuropathology of Drug Addictions and Substance Misuse, 317–324.

https://doi.org/10.1016/b978-0-12-800634-4.00031-7

Watanabe, M., Maemura, K., Kanbara, K., Tamayama, T., & Hayasaki, H. (2002). GABA and GABA receptors in the central nervous system and other organs.International Review of Cytology, 1–47.https://doi.org/10.1016/s0074-7696(02)13011-7