Journal of Tropical Life Science

(1)

2022, Vol. 12, No. 2, 199 – 206 http://dx.doi.org/10.11594/jtls.12.02.06

Research Article

Characterisation of a bacterium from Tebrau Strait and screening of microbial genomes for dehalogenases

Raja Nurulhafiza Raja Mohamed, Habeebat Adekilekun Oyewusi *, Fahrul Huyop

Department of Biosiences, Faculty of Science, Universiti Teknologi Malaysia, 81310 UTM Johor Bahru, Malaysia

Article history:

Submission July 2021 Revised July 2021 Accepted August 2021

ABSTRACT

Current study was to investigate the presence of dehalogenase in the isolated bacterium from Selat Tebrau that can grow on 2,2-dichloropropionic acid (2,2-DCP is an active compound in herbicide Dalapon^®). Strain RN1, a Gram-negative and rod in shape was tentatively identified as Enterobacter cancerogenus based on basic biochemical and the 16S rRNA gene analyses. The calculated cells doubling time were 5.29 hours based on growth of the bacterium in liquid minimal media with 10, 20 and 30 mM of 2,2-DCP, respectively. However, no growth was observed at 40 mM 2,2-DCP liquid minimal medium due to increase in 2,2-DCP toxicity. It was hypothesized that, strain RN1 produced dehalogenase(s) which merits a further study of the genomic data of the same genus and species available in the database. A putative dehalogenase, designated as DehRN was located in the published data of Enterobac- ter cancerogenus. Pairwise of DehRN amino acids with known dehalogenase re- sulted in sequence identity of <20%, suggesting a new class of dehalogenase enzyme in the Enterobacter cancerogenus.

Keywords: 2,2-DCP, dehalogenase, dichloropropionate, Enterobacter, haloalka- noic acid

*Corresponding author:

E-mail: [email protected]

Introduction

Herbicides are usually applied in the farm areas growing important crops. The herbicides are normally selective and only kill selected plant species. However, there are also broad spectrum herbicides that will kill all kinds of plant species.

If herbicides are used without any control, it will give rise to environmental issues. Sodium salt of 2,2-dichloropropionic acid (2,2-DCP) is an active ingredient in Dalapon^® and used as herbicide for various crops including citrus, sugarcane and sugar beets by farmers and agricultural workers.

Generally, any halogenated organic compounds are often found to be the major contributor to the pollution of water and soil [1]. Halogenated organic compound specifically 2,2-DCP is gaining interest for its recalcitrant properties. The persist- ence of 2,2-DCP in water can give adverse effect to marine habitats. Traces of 2,2-DCP could be eli- minated in the presence of dehalogenase-producing bacteria. Dehalogenase cleave the carbon-

halogen bond of 2,2-DCP, forming hydroxyal- kanoic from monosubstituted compounds [2, 3].

Microorganisms from seawater have been reported having the capability in utilizing 2,2-DCP as the sole energy and carbon source [3, 4].

The accumulation of 2,2-DCP in seawater due to its resistance to degradation could lead to marine pollution and adversely affect marine eco-system [5]. It was reported that several bacteria isolated from seawater were able to breakdown 2,2- DCP [3].

The rapid and continuing development of Next Generation Sequencing (NGS) technologies al- lowed many microorganisms of agricultural and ecological importance, as well as biomedical interest subjected to full genome analysis searching for a novel gene [6, 7, 8, 9].

Thus, the main objective was to isolate and characterize a bacterium from the seawater of Tebrau strait that can utilise 2,2-DCP as a carbon

(2)

source. The identity of the isolated bacterium will be ascertained and using bioinformatic tools, the full genome of the similar bacterium from the data base will be screened for the presence of new dehalogenase gene [9]. The results of this study will provide more insight into new microbial strain and to better understanding of the dehalogenase enzyme as a key component in the clean-up strat- egy for bioremediation of halogenated compounds.

Material and Methods Sample collection

Seawater (100 ml) was collected from Selat Tebrau area in Johor Bahru. The seawater samples were collected using sterilized Schott bottle. The seawater was stored at 4 °C until use.

Preparation of solution

Stock solution of 1 M sodium-2,2-dichloropropionate and growth media was prepared as previously described [10]. A 1 M stock solution of pyruvate was prepared by dissolving 5.5 g of sodium pyruvate in 50 mL distilled water. Filter- sterilization of the solution was done using 0.2 µm pore sized nylon filter and syringe into a sterile Schott bottle aseptically. The pyruvate was added into the minimal media following desired concentration. All media for growth experiment were autoclaved at 121°C (15 min, 15 psi). The 2,2- DCP and pyruvate was added to the autoclaved minimal media according to the desired final concentration. For solid minimal media, 1.5 % (w/v) agar N°1 (Oxoid, UK) was added in the prepared medium prior to sterlisation.

Bacteria screening and isolation

An approximately of 3 mL of seawater sample was added into the liquid minimal media supplemented with 10 mM of 2,2-DCP and incubated on rotary shaker of 150 rpm overnight at 30°C. A 100 µL from the mixture was then spread onto the solid minimal medium supplemented with 10 mM of 2,2-DCP and further incubated at 30°C for the growth of the bacteria. After the formation of bacterial colonies, one big colony was chosen and streaked onto fresh solid minimal medium supplemented with 10 mM of 2,2-DCP to obtain pure colonies.

Growth measurement of the bacteria

The optical density or turbidity of the medium

was measured using spectrophotometer at A680nm

prior to constructing the growth curve and subse- quently observed the growth of microorganisms in the selective medium supplied with one carbon source (2,2-DCP) with different concentrations (10 mM, 20 mM, 30 mM and 40 mM). The bacterial growth in the liquid minimal media supplemented with 20 mM pyruvate was also carried out.

Growth profile of a bacterium in different con- centrations of 2,2-DCP and pyruvate

The growth experiment was conducted in minimal media that contains various concentrations of 2,2-DCP (10 mM, 20 mM, 30 mM, and 40 mM) as the sole carbon and energy source. The temperature was maintained at 30°C on a rotary shaker set at 150 rpm. Growth was measured by taking samples at 1 ml each (in triplicates) aseptically at specific time intervals (of 2 hours) from the liquid minimal medium. Then it was measured at A680nm using spectrophotometer which identified the growth patterns of batch culture. Similar preparation was made for growth in pyruvate as sole source of carbon. Pyruvate was used instead of 2,2-DCP.

Microscopic analysis

A standard procedure for Gram-staining was performed to distinguish the basic morphological properties of the bacterium.

Basic biochemical and molecular analysis of the 16S ribosomal RNA (16S rRNA) gene se- quencing

The bacterium was identified using standard conventional biochemical methods [11]. Bacterial chromosomal DNA was prepared using Genomic Wizard Kit^®. The PCR product of the 16S rRNA was sent for sequencing at 1st Base Laboratory, Malaysia using initial primers as described by Fulton and Cooper (2005) [12]. The PCR conditions were based on the method by Hamid et al., [13, 14]. The full 16S rRNA gene sequence was subjected to BLASTn option (www.ncbi.nlm.nih.gov/BLAST/). The results were graphically displayed online on the Distribution of Blast Hits on the Query Sequence.

Analysis of dehalogenase amino acid sequence The amino acid sequences of dehalogenase were obtained from the National Centre for Bio-

(3)

technology Information (NCBI) (www.ncbi.- nlm.nih.gov/) and UniProt (www.uniprot.org/) database (accession number as listed in Table 1). The amino acid sequence of dehalogenase from genomic of Enterobacter cancerogenus (accession number KGT90704.1) was subjected to the Expert Protein Analysis System (EXPASY) Proteomic Server, which is a ProtParam web program (web.expasy.org/protparam/). The pairwise sequence alignment of the dehalogenase from E.

cancerogenus (accession number KGT90704.1) with selected dehalogenase (Table 1) was performed by using web program EMBOSS Needle (www.ebi.ac.uk/Tools/psa/emboss_needle/) to de- termine the percentage of identity.

Multiple sequence alignment

The multiple sequence alignment of the dehalogenases (Table 1) and dehalogenase from E.

cancerogenus (accession number KGT90704.1) was conducted by web program via Clustal Omega (www.ebi.ac.uk/Tools/msa/clustalo/).

Results and Discussions

Isolation and morphological analysis of a bac- terium on 10 mM 2,2-DCP growth medium

A single colony (strain RN1) was selected as shown in Figure 1. It was re-streaked onto a fresh minimal medium and was further incubated for an- other 7 days at 30°C to obtain a pure culture (Fig- ure 2). The isolated colony has creamy pigmenta- tion, raised elevation, circular in shape, entire

margin, and smooth, shiny, and viscous texture.

The microscopic observation at 100x magnifica- tion was shown in Figure 3.

Strain RN1 grew well on selective minimal media and utilise 2,2-DCP as a carbon source. It was hypothesise that this bacterium produces dehalogenases to convert 2,2-DCP into pyruvate [26]. Besides 2,2- DCP, degradation of many other halogenated aliphatic acids, such as a monochloroacetic acid (MCA) [27], trichloroacetic acid (TCA) [28], and D,L2-chloropropionic acid (D,L- 2CP) [29] were also reported. Most halogenated compounds are major environmental pollutants and was already been proven by numerous studies [30]. Therefore, isolation and investigation of mi- croorganism that are capable to remove toxic chemicals are needed.

Basic biochemical analysis and 16S rRNA gene sequencing

The basic biochemical tests were carried out for strain RN1. The results are shown in Table 2.

The results from biochemical test proposed the no- menclature and a possible genus name of the isolated bacteria based on Bergey’s Manual System- atic Bacteriology [31]. The biochemical characteristics fulfils the biochemical characteristics of En- terobacteriaceae. Previous study, the Enterobac- ter sp. has also shown the ability to degrade 2,2- DCP [30]. In addition, PCR of the 16S rRNA gene of the strain RN1 showed a band at approximately 1500 bp (data not shown). The gel purified 1500 Table 1. Selected dehalogenases for amino acid sequence comparison

Class Source Organism Dehalogenase Accession

Number Reference

Class 1D: D- isomer specific

Pseudomonas putida strain

AJ1

HadD AAA25831.1 [15, 16]

Rhizobium sp.

RC1

DehD CAA63793.1 [17, 18]

Class 1L: L- isomer specific

P. putida strain AJ1

HadL Q52087 [19]

Pseudomonas sp.

strain YL

L-DEX AAB31767.1 [20]

Rhizobium sp.

RC1

DehL CAA63794.1 [17, 21]

Class 2I: D-and L-isomers as substrate (inverts substrate product configuration)

Rhizobium sp.

RC1

DehE CAA75671.1 [22, 23]

Class 2R: D-and

L-isomers as substrate (retains substrate product configuration)

P. putida strain PP3

DehI AAN60470.1 [24, 25]

(4)

Figure 1. The growth of bacteria on 10 mM of 2,2- DCP minimal medium after 7 days of incu- bation period at 30 °C

Figure 2. A pure culture of strain RN1 on 10 mM of 2,2-DCP minimal medium growth at 30°C for 7 days

Figure 3. Morphological observation of Strain RN1 by simple staining method at 100× magnifica- tion showing rod in shape

Table 2. Partial biochemical profile and identification of strain RN1 by conventional biochemical tests.

Biochemical Tests/enzymes Conventional Glucose

Mannitol Indole Inositol Sucrose Melibiose

Lactose

Positive Positive Negative Negative Positive Positive Negative

Urease Negative

Citrate Negative

Oxidase β-galactosidase

Negative Postive

Catalase Positive

Starch hydrolysis Negative Lactose fermentation Negative

MacConkey agar Nitrate reduction

H2S Urease Gelatinase Identification

Positive Positive Negative Negative Negative Enterobacteriaceae bp PCR product was sent for DNA sequencing.

The full 16S rRNA gene sequencing data was BLASTn at NCBI database. The full 16S rRNA sequences of strain RN1 matched with the corresponding sequence of E. cancerogenus (GenBank Accession no. Z96078), (Figure 4). There were 12 base different between the Query and E. cancer- ogenus (99.2% identity), indicating that the isolate closely resembled E. cancerogenus. Therefore, strain RN1 was designated as E. cancerogenus RN1. In the previous literature E. cancerogenus was also know as Enterobacter taylorae and associated with medical infection of crush injury [33].

Basic groth analysis of strain RN1 on 2,2DCP minimal medium

The growth of strain RN1 was recorded over less than 20 hours period. Reading were taken in triplicates with standard deviation values. The values were base on A680nm reading using spectrophotometer. The maximum growth was exhibited in 20 mM concentration (A680nm = 1.104) while the least growth was observed in 40 mM concentration (A680nm = 0.238), suggesting the toxicity of the substrate to the bacterium thereby inhibit growth. The cells doubling time was also calculated in different concentrations of 2,2-DCP as summarized in Table 3. The overall doubling Strain

RN1

(5)

Figure 4. The 16S rRNA gene sequence of strain RN1 (Query) isolated from Selat Tebrau and the corresponding re-gion of E. cancerogenus (GenBank Accession no. Z96078). The dots bases represent those in Query and E. cancerogenus that are dif-ferent from the corresponding ones in the isolate

Table 3. The doubling time of strain RN1 growth in different concentrations of 2,2-DCP as a carbon source at 30^oC.

Concentration (mM) Doubling time (hours)

10 5.71 ± 0.087

20 5.13 ± 0.075

30 5.05 ± 0.101

40 No growth

Figure 5. Multiple sequence alignment of the selected dehalogenase amino acids containing no conserved amino acids residues

Query 1 ATTGAACTCTGGCGGCAGGCTTAACACATGCAAGTCGACCGGTACCACAG 50 |||||||.||||||||||||.|||||||||||||||||||||||||||||

E.cancerogenu 1 ATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGACCGGTACCACAG 50 Query 51 AGAGCTTGCTCTCGGGTGACGAGGGGCGGACGGGTGAGTAATGTCTGGGA 100 ||||||||||||||||||||||||||||||||||||||||||||||||||

E.cancerogenu 51 AGAGCTTGCTCTCGGGTGACGAGGGGCGGACGGGTGAGTAATGTCTGGGA 100 Query 101 AACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCA 150 ||||||||||||||||||||||||||||||||||||||||||||||||||

E.cancerogenu 101 AACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCA 150 Query 151 TAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCATCTTGCCATCAGAT 200 |||||||||||||||||||||||||||||||||||.||||||||||||||

E.cancerogenu 151 TAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCAGAT 200 Query 201 GTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGA 250 ||||||||||||||||||||||||||||||||||||||||||||||||||

E.cancerogenu 201 GTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGA 250 Query 251 CGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACA 300 ||||||||||||||||||||||||||||||||||||||||||||||||||

E.cancerogenu 251 CGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACA 300 Query 301 CGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGC 350 ||||||||||||||||||||||||||||||||||||||||||||||||||

E.cancerogenu 301 CGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGC 350 Query 351 GCAACCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGT 400 ||||||||||||||||||||||||||||||||||||||||||||||||||

E.cancerogenu 351 GCAACCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGT 400 Query 401 AAAGTACTTTCAGCGGGGAGGAAGGCGATAAGGTTAATAACCTTGTCGAT 450 ||||||||||||||||||||||||||||||||||||||||||||||||||

E.cancerogenu 401 AAAGTACTTTCAGCGGGGAGGAAGGCGATAAGGTTAATAACCTTGTCGAT 450 Query 451 TGACGTTACCCGCAGAAAAAGCACCGGCTAACTCCGTGCCAATAGCCGCG 500 |||||||||||||||||||||||||||||||||||||||||..|||||||

E.cancerogenu 451 TGACGTTACCCGCAGAAAAAGCACCGGCTAACTCCGTGCCAGCAGCCGCG 500 Query 501 GTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCA 550 ||||||||||||||||||||||||||||||||||||||||||||||||||

E.cancerogenu 501 GTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCA 550 Query 551 CGCAGGCGGTCTGTCAAGTCTGATGTGAAATCCCCGGGCTCAACCTGGGA 600 ||||||||||||||||||||.|||||||||||||||||||||||||||||

E.cancerogenu 551 CGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGA 600 Query 601 ACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTC 650 ||||||||||||||||||||||||||||||||||||||||||||||||||

E.cancerogenu 601 ACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTC 650 Query 651 CAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAA 700 ||||||||||||||||||||||||||||||||||||||||||||||||||

E.cancerogenu 651 CAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAA 700 Query 701 GGCGGCCCCCTGGACAAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGC 750 ||||||||||||||||||||||||||||||||||||||||||||||||||

E.cancerogenu 701 GGCGGCCCCCTGGACAAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGC 750 Query 751 AAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCGACTTG 800 ||||||||||||||||||||||||||||||||||||||||||||||||||

E.cancerogenu 751 AAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCGACTTG 800 Query 801 GAGGTTGTGCCCTTGAGGCGTGGCTTCCGGAGCTAACGCGTTAAGTCGAC 850 ||||||||||||||||||||||||||||||||||||||||||||||||||

E.cancerogenu 801 GAGGTTGTGCCCTTGAGGCGTGGCTTCCGGAGCTAACGCGTTAAGTCGAC 850 Query 851 CGCCTGGGGAGCACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGG 900 |||||||||||.||||||||||||||||||||||||||||||||||||||

E.cancerogenu 851 CGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGG 900 Query 901 CCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAACGCGAAGAAC 950 ||||||||||||||||||||||||||||||||||||||||||||||||||

E.cancerogenu 901 CCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAACGCGAAGAAC 950

(6)

time was 5.29 hours was the fastest cell growth compared to the previously reported on the same substrate [22].

Growth profile of strain RN1 on pyruvate Pyruvate was the product of 2,2-DCP dehalogenation as previously reported by the removal of the chloride ions by the action of dehalogenase enzyme [34, 35, 36, 37]. Pyruvate was then utilized by the bacterium as a carbon source. Growth experiment was carried out to see growth of strain RN1 on pyruvate. It was hypothesized that any bacteria that could degrade 2,2-DCP could also utilized pyruvate as their sole carbon source. The growth profile of strain RN1 in 20 mM pyruvate minimal medium showed the cells doubling time of strain RN1 was 2.01 ± 0.01 hours as expected suggesting pyruvate was product of 2,2-DCP dehalogenation.

Screening of the genome sequence of E. can- cerogenus from database for dehalogenase(s)

The genomic Enterobacter cancerogenus from NCBI database (BioProject:

PRJNA263657) was screened for dehalogenase(s). Dehalogenase amino acid sequence was detected with accession number of KGT90704.1. Hence, it was hypothesized that the current isolated bacteria Enterobacter cancerogenus strain RN1 contained dehalogenase as well.

Further analysis of dehalogenase gene and amino acids sequence by ProtParam

The putative dehalogenase from E. canceroge- nus was designated as DehRN consists of 222 amino acids residues with calculated molecular weight of 25,014.81 Da, and theoretical pI of 5.51.

This dehalogenase has a negative GRAVY value (grand average of hydropathicity) of 0.159. It contains 23 positively charged and 29 negatively charged amino acid residues. In addition, the total number of atoms was 3484 with an aliphatic index of 79.55 and a molecular formula of C1133H1726N288O322S15.

Pairwise sequence alignment was carried out to find the identity of the E. cancerogenus dehalogenase. Table 4 showed the summary of the percentage identity of the amino acid sequence. The percent identity was in the range 5-20%. Many microbial genomes harbour enzyme families containing dehalogenases, but a sequence-based identification of dehalogenases with high percent identity was almost impossible because of the low sequence conservation among these enzymes [6].

Multiple sequence alignment

This whole profile of dehalogenases using multiple sequence alignment was carried out to see dehalogenases shared patterns among important amino acids. The multiple sequence alignment of dehalogenase from Enterobacter cancerogenus, DehRN (KGT90704.1), Pseudomonas putida Table 4. The percentage of identity (values in parentheses) obtained through pairwise sequence alignment

Class Organism Dehalogenase Accession

Number

%Identity

Class 1D: D- isomer specific

Pseudomonas putida strain

AJ1

HadD AAA25831.1 41/382

(10.7%) Rhizobium sp. RC1 DehD CAA63793.1 24/425

(5.6%)

Class 1L: L- isomer specific

P. putida strain AJ1 HadL Q52087 50/248 (20.2%) Pseudomonas sp.

strain YL

L-DEX AAB31767.1 12/222 (5.4%) Rhizobium sp. RC1 DehL CAA63794.1 19/432 (4.4%) Class 2I: D-and L-isomers as sub-

strate (inverts substrate product configuration)

Rhizobium sp. RC1 DehE CAA75671.1 55/332 (16.6%) Class 2R: D-and

L-isomers as substrate (retains substrate product configuration)

P. putida strain PP3 DehI AAN60470.1 51/341 (15.0%)

(7)

strain AJ1 HadD (AAA25831.1), Rhizobium sp.

RC1 DehD (CAA63793.1), P. putida strain AJ1 HadL (Q52087), Pseudomonas sp. strain YL L- DEX (AAB31767.1), Rhizobium sp. RC1 DehL (CAA63794.1), Rhizobium sp. RC1 DehE (CAA75671.1), and P. putida strain PP3 Deh I (AAN60470.1) were performed (Figure 5). As shown in Figure 5, there was no conserved regions shown in this alignment possibly due to differ- ences in length in the amino acids and/or each type of dehalogenases came from different source of dehalogenase genes.

Conclusion

This study provides the identity of a single bacterium that can grow on a selected halogenated compund, 2,2-DCP. Following the success of the isolated bacterium in degrading 2,2-DCP, the future use of E. cancerogenus RN1 in bioremediation will provide greener alternative and an envi- ronmentally friendly usage of the species in detox- ifying halogenated compounds in the environment. Screening for new dehalogenases from the rapidly expanding genome sequence database is vital. This will accelerate the discovery of novel dehalogenases in future. Current identified putative dehalogenase might be a new kind of dehalogenase due to the many of amino acid sequence has different identity to the well established dehalogenases. Under current investigation, it is anticipate that both substrates specificity and specific amino acid sequence identity need to be matched to each other under one class/type, but it might not be the case. Therefore, the knowledge of diversity of dehalogenating enzymes is important for future developing effective detoxifica- tion methods.

Acknowledgement

We are grateful to the Fundamental Research Grant Scheme (FRGS/1/2019/STG05/UTM/01/1) R.J130000.7854.5F189-Ministry of Higher Edu- cation Malaysia and RUG-UTM-HR- Q.J130000.2414.08G59 for partial financial assis- tance for research materials.

References

1. Khosrowabadi, E, Huyop F (2014) Screening and characterization of several 2,2-dicholoropropionic acid–degrading bacteria isolated from marine sediment of Danga Bay and east coast of Singapore island. Bioremediation

Journal 18 (1): 20-27. doi:

10.1080/10889868.2013.834868

2. Ismail SNF, Wahab RAb, Huyop F (2017) Microbial isolation and degradation of selected haloalkanoic aliphatic acids by locally isolated bacteria: A review. Malaysian Journal of Microbiology 13 (3): 261-272.

doi:10.21161/mjm.92816

3. Zakary S, Oyewusi HA, Huyop F (2021a) Dehalogen- ases for pollutant degradation: A mini review. Journal of Tropical Life Science 11 (1): 17-24. doi:

10.11594/jtls.11.01.03

4. Edbeib MF, Wahab RAb, Huyop F (2017) Isolation and characterization of a novel 2,2-DCP-degrading Achro- mobacter sp. M×2 isolated from contaminated seawater of Desaru Beach, Southern Malaysia. Journal of Engi- neering and Applied Sciences 12 (17):4306-4309 5. Oyewusi HA, Wahab Rab, Huyop F (2020) Review:

Dehalogenase-producing halophiles and their potential role in bioremediation. Marine Pollution Bulletin 160:

111603. doi.org/10.1016/j.marpolbul.2020.111603 6. Chan WY, Max W, Guthrie J, Savchenko AV, Yakunin

AF, Pai EF, Edwards EA (2010) Sequence- and activity- based screening of microbial genomes for novel dehalogenases. Microbial Biotechnology 3(1): 107-120. doi:

10.1111/j.1751-7915.2009.00155.x

7. Shahid MS, Sattar MN, Iqbal Z, Raza A, Al-Sadi AM (2021) Next-Generation Sequencing and the CRISPR- Cas Nexus: A Molecular Plant Virology Perspective.

Frontiers in Microbiology 11: 3456-3470. doi:

10.3389/fmicb.2020.609376.

8. John G, Sahajpal NS, Mondal AK et al. (2021) Next- Generation Sequencing (NGS) in COVID-19: A Tool for SARS-CoV-2 diagnosis, monitoring new strains and phylodynamic modeling in molecular epidemiology.

Current Issues in Molecular Biology 43 (2):845-867. doi:

10.3390/cimb43020061.

9. Zakary S, Oyewusi HA, Huyop F (2021b). Genomic analysis of Mesorhizobium loti strain TONO reveals dehalogenases for bioremediation. Journal of Tropical Life Science 11 (1):67-77. doi: 10.11594/jtls.11.01.09.

10. Heidarrezaei M, Shokravi H, Huyop F et al. (2020) Iso- lation and characterization of a novel bacterium from the marine environment for trichloroacetic acid bioremediation. Applied Sciences 10 (13):4593. doi:

10.3390/app10134593

11. Murray PR, Baron EJ, Pfaller MA, Tenover FC, Yolken RH (Eds) (1999). Manual of clinical microbiology.

Washington D.C. American Society for Microbiology Press USA.

12. Fulton CK, Cooper RA (2005) Catabolism of sulfamate by Mycobacterium sp. CF1. Environmental Microbiol- ogy 7: 378–381. doi.org/10.1111/j.1462- 2920.2005.00719.x

13. Hamid, AAA, Hamdan S, Pakingking RV, Huyop F (2010a) Identification of Pseudomonas sp. Strain S3 based on small subunit ribosomal RNA gene sequences.

Biotechnology 9 (1):33-40. doi: 10.3923/biotech.2010.33.40

14. Hamid AAA, Hamdan S, Ariffin SHZ, Huyop F (2010b).

Molecular prediction of dehalogenase producing micro- organism using 16S rDNA analysis of 2,2-dichloropropionate (Dalapon) degrading bacterium isolated from vol- canic soil. Journal of Biological Sciences 10 (3):190- 199. doi: 10.3923/jbs.2010.190.199

15. Barth PT, Bolton L, Thomson JC (1992) Cloning and partial sequencing of an operon encoding two

(8)

Pseudomonas putida haloalkanoate dehalogenases of opposite stereospecificity. Journal of Bacteriology 174 (8):2612-2619. doi: 10.1128/jb.174.8.2612-2619.1992 16. Smith JM, Harrison K, Colby J (1990) Purification and

characterization of D-2-haloacid dehalogenase from Pseudomonas putida strain AJ1/23. Journal of General Microbiology 136(5): 881-886. DOI:

10.1099/00221287-136-5-881

17. Leigh J, Skinner AJ, Cooper RA (1986) Isolation and partial characterization of dehalogenase-deficient mu- tants of a Rhizobium sp. FEMS Microbiology Letters 36(2-3): 163-166. doi.org/10.1111/j.1574- 6968.1986.tb01688.x

18. Leigh J, Skinner AJ, Cooper RA (1988) Partial purification, stereospecificity and stoichiometry of three dehalogenases from a Rhizobium sp. FEMS Microbiology Let- ters 49 (3):353-356. doi: 10.1111/j.1574- 6968.1988.tb02756.x

19. Jones DHA, Barth PT, Byrom D, Thomas CM (1992).

Nucleotide sequence of the structural gene encoding a 2- haloalkanoic acid dehalogenase of Pseudomonas putida strain AJ1 and purification of the encoded protein. Jour- nal of General Microbiology 138 (4): 675-683. doi:

10.1099/00221287-138-4-675

20. Nardi-Dei V, Kurihara T, Okamura T et al. (1994) Com- parative studies of genes encoding thermostable L-2- halo acid dehalogenase from Pseudomonas sp. strain YL, other dehalogenases, and two related hypothetical pro- teins from Escherichia coli. Applied Environmental Mi- crobiology 60 (9): 3375-3380. doi:

10.1128/aem.60.9.3375-3380.1994

21. Cairns SS, Cornish A, Cooper RA (1996) Cloning, sequencing and expression in Escherichia coli of two Rhi- zobium sp. genes encoding haloalkanoate dehalogenases of opposite stereospecificity. European Journal of Bio- chemistry 235(3): 744-749. doi: 10.1111/j.1432- 1033.1996.t01-1-00744.x

22. Allison, N (1981) Bacterial degradation of halogenated aliphatic acids. PhD Thesis Trent Polytechnic, Not- tingham, United Kingdom.

23. Huyop FZ, Yusn TY, Ismail M et al. (2004). Overexpres- sion and characterisation of non-stereospecific haloacid Dehalogenase E (DehE) of Rhizobium sp. Asia-Pacific Journal of Molecular Biology and Biotechnology 12(1&2): 15-20. http://www.msmbb.my/index.php/ar- chive-issues

24. Weightman AJ, Weightman AL, Slater JH (1982) Stere- ospecificity of 2- monochloropropionate dehalogenation by the two dehalogenases of Pseudomonas putida PP3:

Evidence of two different dehalogenation mechanisms.

Journal of general microbiology, 128 (8): 1755-1762.

doi: 10.1099/00221287-128-8-1755

25. Topping AW (1992) An investigation into the transposi- tion and dehalogenase functions of DEH, a mobile ge- netic element, from Pseudomonas putida strain PP3, PhD Thesis, University of Wales, Cardiff, United Kingdom.

26. Huyop F, Nemati M (2010) Properties of dehalogenase from Rhizobium sp. RC1. African Journal of

Microbiology Research. 4 (25): 2836-2847. doi:

10.5897/AJMR.9000602.

27. Ismail SN, Taha AM, Jing NH et al. (2008). Biodegrada- tion of monochloroacetic acid by a presumptive Pseudo- monas sp. strain R1 bacterium isolated from Malaysian paddy (rice) Field. Biotechnology 7 (3): 481-486. doi:

10.3923/biotech.2008.481.486

28. Weightman AL, Weightman AJ, Slater JH (1992) Micro- bial dehalogenation of trichloroacetic acid. World Jour- nal of Microbiology and Biotechnology 8(5): 512-518.

doi: 10.1007/BF01201951

29. Thasif S, Hamdan S, Huyop F (2009) Degradation of D, L-2-chloropropionic acid by bacterial dehalogenases that shows stereospecificity and its partial enzymatic characteristics. Biotechnology 8(2): 264-269. doi: 10.3923/biotech.2009.264.269.

30. Pimviriyakul P, Wongnate T, Tinikul R, Chaiyen P (2020) Microbial degradation of halogenated aromatics: molecular mechanisms and enzymatic reactions. Microbial Bi- otechnology 13 (1): 67–86. doi: 10.1111/1751- 7915.13488.

31. Bergey DH, Sneath PHA, Holt JG (1986) Bergey's manual of determinative bacteriology. Williams & Wilkins.

32. Nemati M, Abdulghader MF, Gicana RG et al (2013) Identification of putative Cof-like hydrolase associated with dehalogenase in Enterobacter cloacae MN1 isolated from the contaminated sea-side area of the Philip- pines. Malaysian Journal of Microbiology 9 (3): 253- 259. doi: 10.21161/mjm.51113

33. Abbott SL, Janda JM (1997) Enterobacter cancerogenus (Enterobacter taylorae): Infections associated with se- vere trauma or crush injuries. American Journal of Clin- ical Pathology 107(3): 359–361. doi:

10.1093/ajcp/107.3.359

34. Niknam MR, Huyop F, Wahab RAb (2014) Identification and characterization of Raoutella ornithilolytica and de- termination of its herbicide 2,2-dichloropropionate (2,2- DCP) degradation potential. Malaysian Journal of Mi- crobiology 10(4): 249-254. doi: 10.21161/mjm.63714 35. Wahhab BHA, Anuar NFSK, Wahab Rab, Al-Nimer

MSM, Samsulrizal NH, Hamid AAA, Edbeib MF, Kaya Y, Huyop F (2020), Characterization of a 2,2-dichloropropionic acid (2,2-DCP) degrading alkalotorelant Ba- cillus megaterium strain BHS1 isolated from Blue Lake in Turkey. Journal of Tropical Life Science 10(3):2-8.

doi.org/10.11594/jtls.10.03.08

36. Kirkinci SF, Edbeib MF, Aksoy HM, Marakli S, Kaya Y (2021) Identification of Dalapon degrading bacterial strain, Psychrobacter sp. Tae Burcu 001 isolated from Antarctica. Polar Science 28: 100656. doi: 10.1016/j.polar.2021.100656

37. Jamil NA, Wahab RAb, Shariff AHM, Huyop F (2021) Isolation of Klebsiella pneumoniae from Sungai Skudai and in- silico analysis of dehalogenase protein. Malay- sian Journal of Microbiology 17(3):294-304. doi:

10.21161/mjm.201012