Assessment of Association between NINJ2 Polymorphisms and Suicide Attempts in an Iranian Population

(1)

Assessment of Association between NINJ2 Polymorphisms and Suicide Attempts in an Iranian Population

Amin Safa^1,2&Mir Davood Omrani³&Fwad Nicknafs⁴&Vahid Kholghi Oskooei^5,6&Mohammad Taheri³ &

Soudeh Ghafouri-Fard⁴

Received: 16 March 2020 / Accepted: 13 May 2020

#Springer Science+Business Media, LLC, part of Springer Nature 2020

Abstract

Suicidal behavior as a psychological problem with high public health burden is associated with a number of genetically determined risk factors. In the current study, we investigated the association between two polymorphisms within theNINJ2 gene and risk of suicide in an Iranian population. The study included 295 individuals who attempted suicide with soft suicide methods, 234 suicide victims and 410 normal controls. The rs11833579 SNP was associated with death from suicide in a codominant model in that the AG genotype decreased the risk of death from suicide compared with the GG genotype (OR (95% CI) = 0.49 (0.34–0.71), adjustedPvalue = 4e−04). This SNP was also associated with death from suicide in dominant (AG + AA versus GG: OR (95% CI) = 0.63 (0.46–0.87), adjustedPvalue = 0.011) and overdominant (AG versus GG + AA: OR (95% CI) = 0.49 (0.35–0.69), adjustedPvalue < 0.0001) models. In addition, this SNP was associated with soft suicide attempts in a codominant model (AG versus AA + GG: OR (95% CI) = 0.7 (0.5–0.98), adjustedPvalue = 0.02). The rs3806263 SNP was associated with death from suicide in allelic (A versus G: OR (95% CI) = 1.48 (1.17–1.88), adjustedPvalue = 0.002), codominant (AA versus GG: OR (95% CI) = 3.14 (1.89–5.21), adjustedPvalue < 0.0001), recessive (AA versus GG + AG: OR (95%

CI) = 3.47 (2.15–5.61), adjusted P value < 0.0001), overdominant (AG versus AA + GG: OR (95% CI) = 0.62 (0.45–0.87), adjustedPvalue = 0.0092) and log-additive models (OR (95% CI) = 1.45 (1.15–1.83), adjustedPvalue = 0.0034). When comparing allele/genotype frequencies of this SNP between suicide victims and soft suicide attempters, significant associations were found in allelic, codominant, recessive and log-additive models. The AG haplotype (rs11833579 and rs3806263, respectively) was significantly less prevalent among suicide victims compared with controls (OR (95% CI) = 0.37 (0.26–0.52), adjustedP value < 0.0001). This haplotype was also less prevalent among suicide victims vs. soft suicide attempters (OR (95% CI) = 0.43 (0.31–0.61), adjustedPvalue < 0.0001). The GA haplotype (rs11833579 and rs3806263, respectively) was less frequent among suicide victims compared with controls (OR (95% CI) = 0.63 (0.45–0.89), adjustedPvalue = 0.0156). Finally, the AA haplotype was more prevalent among suicide victims compared with both controls (OR (95% CI) = 2.37 (1.56–3.6), adjustedPvalue = 0.0002) and soft suicide attempters (OR (95% CI) = 1.92 (1.32–2.78), adjustedPvalue = 0.0012). Thus, these two SNPs might be regarded as genetic determinants of suicide risk in Iranian populations. Further studies in different populations are needed to verify these results.

Keywords Suicide attempt . NINJ2 . Polymorphism

* Mohammad Taheri

[email protected]

* Soudeh Ghafouri-Fard [email protected]

1 Institute of Research and Development, Duy Tan University, Da Nang 550000, Viet Nam

2 Department of Immunology, Ophthalmology and ENT, School of Medicine, Complutense University, Madrid, Spain

3 Urogenital Stem Cell Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran

4 Department of Medical Genetics, Shahid Beheshti University of Medical Sciences, Tehran, Iran

5 Department of Laboratory Sciences, School of Paramedical Sciences, Torbat Heydariyeh University of Medical Sciences, Torbat Heydariyeh, Iran

6 Neuroscience Research Center, Torbat Heydariyeh University of Medical Sciences, Torbat Heydariyeh, Iran

https://doi.org/10.1007/s12031-020-01584-x

(2)

Introduction

Successful suicide has a prevalence rate of 0.0145%, thus accounting for 1.5% of mortalities all over the world.

Ranking as the tenth leading cause of mortality, it causes a public health burden (Zai et al.2012). Several lines of evidence suggest the presence of genetic factors in determination of risk of suicide. A previous controlled family investigation in adolescent suicide victims has reported familial transmis- sion of suicidal behavior regarding attempts and completion aspects (Brent et al.1996). Further studies have verified the observed familial aggregation of suicide attempts or completion (Cheng et al.2000; Kim et al.2005; Mann et al.2005).

Based on the results of mentioned studies and other similar studies, a genetic component has been supposed for suicidal behavior which is present in both the suicide attempt and suicide completion (Zai et al.2012). Most notably, although suicidal behavior has been associated with neuropsychiatric disorders, the mentioned genetic factor might be independent of the presence of such disorders (Zai et al.2012). We have recently reported an association between some single- nucleotide polymorphisms (SNPs) and suicidal behavior in an Iranian population (Eftekharian et al.2018; Noroozi et al.

2018). In order to explore other aspects of a genetic role in suicidal behavior, in the current study we have focused on two SNPs within the Ninjurin 2 (NINJ2) gene. This gene encodes an adhesion protein which was firstly identified as a protein that is induced by nerve injury and which enhances axonal growth (Araki and Milbrandt 1996). Additional studies showed expression of this homophilic adhesion molecule in mature sensory and enteric neurons. Immunohistochemical studies in rat tissues showed its expression in radial glial cells of the central nervous system and numerous postmitotic neurons (Araki and Milbrandt2000).NINJ2polymorphisms have been associated with a number of neurologic disorders such as ischemic stroke (Wan et al.2011; Malekzadeh et al.2019) and multiple sclerosis (Noroozi et al.2019). Yet, the relationship between genetic polymorphisms within this gene and suicidal behavior is largely unknown. In the current study, we have chosen twoNINJ2SNPs, namely rs11833579 and rs3806263, as previous studies have reported evidence regarding the functionality of these SNPs. Located in the NINJ2 promoter, rs3809263 has been shown to affectNINJ2expression levels (Zhang et al.2016). In addition, rs11833579 has been shown to influence the risk of Alzheimer’s disease (Lin et al.2011).

Moreover, based on the results of a genome-wide association study, rs11833579 has been associated with the risk of ischemic stroke (Ikram et al.2009). Based on the expression pattern of NINJ2in neurons, reported associations between SNPs within this gene and risk of neuropsychiatric conditions, and associations between Alzheimer’s disease, stroke and suicide (Vijayan and Reddy2016; Serafini et al.2016), we hypothe- sized that SNPs within this gene might also affect the risk of

suicide attempt/completion. Thus, we designed the current study to verify this hypothesis.

Materials and Methods

Study Participants

The current study was conducted on 295 individuals who attempted suicide with soft suicide methods (male/female ratio = 66%/34% age (mean ± SD) = 36.2 ± 1.3), 234 suicide victims (male/female ratio = 67%/33% age (mean ± SD) = 37.01 ± 0.53) and 410 normal controls. Normal controls had no history of psychiatric disorders or suicide attempt and were matched with cases regarding sex and age. Blood samples obtained through cardiopuncture (in suicide victims) or pe- ripheral blood samples (in alive individuals) were used for genetics assay. The study protocol was approved by the local ethics committee. Written informed consent was obtained from study participants or their guardians.

SNP Features

The rs11833579 and rs3809263 SNPs are located on Chr 12:666033 and Chr 12:664290, respectively. The minor alleles of these SNPs have frequencies of 0.297 and 0.316, respectively, based on the results of the 1000 Genomes Project (https://www.ncbi.nlm.nih.gov/snp).

Genotyping

The rs11833579 and rs3809263 SNPs were genotyped in the three study groups mentioned above using the tetra-primer amplification-refractory mutation system (ARMS)-PCR tech- nique, as described previously (Malekzadeh et al.2019). In the process of experiment set-up, the genotyping in 10% of the samples was confirmed by Sanger sequencing. Reactions were prepared using Taq DNA Polymerase Master Mix RED (amplicon, Denmark). Nucleotide sequences of the PCR primers, the annealing temperatures and the anticipated sizes of PCR products for each allele are summarized in Table1.

Statistical Analyses

Statistical analyses were performed in SPSS software version 18. Accordance of genotype frequencies with Hardy– Weinberg equilibrium (HWE) was assessed using the Chi- square test. Associations between the suicidal behavior and the alleles/genotypes of rs11833579/rs3809263 were judged in codominant, dominant, recessive, overdominant and log- additive inheritance models. Haplotype frequencies were compared between suicide attempters and controls. Odds

(3)

ratios (OR), 95% confidence intervals (95% CI) andPvalues were measured to assess the association. P values were corrected for multiple comparisons using the Bonferroni cor- rection method by multiplyingP values by the number of comparisons. AdjustedPvalues less than 0.05 were regarded as significant. Haplotype frequencies were calculated using SNPStats (https://www.snpstats.net/start.htm) based on the expectation maximization algorithm. AdjustedPvalues were measured through multiplying the originalPvalued by the amount of comparisons.

Results

Exact Test for Hardy–Weinberg Equilibrium

Genotype frequencies of both SNPs were in accordance with HWE in controls (Pvalues = 0.61 and 0.13 for rs11833579 and rs3806263, respectively).

Association between Genotype/Allele Frequencies and Suicidal Behavior

The rs11833579 SNP was associated with death from suicide in the codominant model in that the AG genotype decreased the risk of death from suicide compared with the GG genotype (OR (95% CI) = 0.49 (0.34–0.71), adjustedPvalue = 4e−04).

This SNP was also associated with death from suicide in dominant (AG + AA versus GG: OR (95% CI) = 0.63 (0.46–0.87), adjusted P value = 0.011) and overdominant (AG versus GG + AA: OR (95% CI) = 0.49 (0.35−0.69), adjustedPvalue

< 0.0001) models. In addition, this SNP was associated with soft suicide attempt in a codominant model (AG versus AA + GG: OR (95% CI) = 0.7 (0.5−0.98), adjustedPvalue = 0.02).

The rs3806263 SNP was associated with death from suicide in allelic (A versus G: OR (95% CI) = 1.48 (1.17−1.88), adjustedPvalue = 0.002), codominant (AA versus GG: OR (95% CI) = 3.14 (1.89–5.21), adjustedPvalue < 0.0001), recessive (AA versus GG + AG: OR (95% CI) = 3.47 (2.15–

5.61), adjustedPvalue < 0.0001), overdominant (AG versus

AA + GG: OR (95% CI) = 0.62 (0.45–0.87), adjustedPval- ue = 0.0092) and log-additive models (OR (95% CI) = 1.45 (1.15–1.83), adjustedPvalue = 0.0034). There was no association between this SNP and soft suicide attempt in any inheritance model. However, when comparing allele/genotype frequencies of this SNP between suicide victims and soft suicide attempters, significant associations were found in allelic, codominant, recessive and log-additive models. Table 2 shows details of association analysis between mentioned SNPs and suicidal behavior.

The AG haplotype (rs11833579 and rs3806263, respectively) was significantly less prevalent among suicide victims compared with controls (OR (95% CI) = 0.37 (0.26–0.52), adjustedPvalue < 0.0001). This haplotype was also less prevalent among suicide victims vs. oft suicide attempters (OR (95% CI) = 0.43 (0.31–0.61), adjusted P value < 0.0001).

The G A haplotype (rs11833579 and rs3806263, respectively) was less frequent among suicide victims compared with controls (OR (95% CI) = 0.63 (0.45–0.89), adjustedPvalue = 0.0156). Finally, the AA haplotype was more prevalent among suicide victims compared with both controls (OR (95% CI) = 2.37 (1.56–3.6), adjustedPvalue = 0.0002) and soft suicide attempters (OR (95% CI) = 1.92 (1.32 – 2.78), adjustedPvalue = 0.0012). Table3shows the details of association analysis between NINJ2 haplotypes and suicidal behavior.

Discussion

In the present case–control study, we assessed the association between two NINJ2 polymorphisms and suicide attempt/

completion in an Iranian population. We found an association between rs11833579 and suicide completion in a codominant model in that the AG genotype decreased the risk of death from suicide compared with the GG genotype. This SNP was also associated with death from suicide in dominant and overdominant models. Moreover, rs11833579 was associated with soft suicide attempt in a codominant model. The G allele of this SNP has been associated with higher risk of Table 1 Characteristics of primer pairs and PCR condition (F: forward, R: reverse, i: inner, o: outer)

SNP Primer name Primer sequence Annealing temperature Band Size

rs11833579 Fo AATTTTTTTTTAATTGAGCTAGATGTGGC 50.1 Outer 351

Ro ATATTCGAGTACTGTTCTCTTTTGCATT

Fi (A) CTTTCTGGAAAACCTTAATTCGGCTA Fi (A) 170

Ri (G) GGATAAATAGTTAATATGTTGCTTCTTGC Ri (G) 236

rs3809263 Fo GACTAAAATATGGCACCCATCCTATCATC 52.7 Outer 437

Ro ATGGAGCATGGAGTAGTTGTACCTTCGA

Fi (G) CTTCAAGCCCTGAATTGGATTACTGG Fi (G) 262

Ri (A) GTAGACGTGCTTGGCAGAGTGTTCAT Ri (A) 227

(4)

Table2Resultsofassociationanalysisbetweenrs11833579/rs3809263SNPsandsuicidalbehavior SNPModelAllele/ GenotypeSamplesizeSuicidevictimsvs.controls CompletedsuicideSuicideattemptControlOddsratioPvalue rs11833579AlleleG296(63.2%)349(59.2%)495(60.4%)10.31 A172(36.8%)241(40.8%)325(39.6%)0.88(0.7–1.12) CodominantGG113(48.3%)121(41%)152(37.1%)12e−04 AG70(29.9%)107(36.3%)191(46.6%)0.49(0.34–0.71) AA51(21.8%)67(22.7%)67(16.3%)1.02(0.66–1.59) DominantGG113(48.3%)121(41%)152(37.1%)10.0055 AG+AA121(51.7%)174(59%)258(62.9%)0.63(0.46–0.87) RecessiveGG+AG183(78.2%)228(77.3%)343(83.7%)10.08 AA51(21.8%)67(22.7%)67(16.3%)1.43(0.95–2.14) OverdominantGG+AA164(70.1%)188(63.7%)219(53.4%)1<0.0001 AG70(29.9%)107(36.3%)191(46.6%)0.49(0.35–0.69) Log-additive0.9(0.72–1.2)0.34 rs3806263AlleleG285(60.6%)448(71.1%)570(69.5%)10.001 A185(39.4%)182(28.9%)250(30.5%)1.48(1.17–1.88) CodominantGG102(43.4%)160(50.8%)191(46.6%)1<0.0001 AG81(34.5%)128(40.6%)188(45.9%)0.81(0.57–1.15) AA52(22.1%)27(8.6%)31(7.6%)3.14(1.89–5.21) DominantGG102(43.4%)160(50.8%)191(46.6%)10.43 AG+AA133(56.6%)155(49.2%)219(53.4%)1.14(0.82–1.57) RecessiveGG+AG183(77.9%)288(91.4%)379(92.4%)1<0.0001 AA52(22.1%)27(8.6%)31(7.6%)3.47(2.15–5.61) OverdominantGG+AA154(65.5%)187(59.4%)222(54.1%)10.0046 AG81(34.5%)128(40.6%)188(45.9%)0.62(0.45–0.87) Log-additive1.45(1.15–1.83)0.0017 SNPAllele/GenotypeSuicidevictimsvs.controlsSoftsuicideattemptersvs.controlsSuicidevictimsvs.softsuicideattempters AdjustedPvaluesOddsratioPvalueAdjustedPvalues rs11833579G0.6210.170.34 A1.05(0.85–1.3) GG4e−0410.20.4 AG0.7(0.5–0.98) AA1.26(0.83–1.9) GG0.01110.090.18 AG+AA0.85(0.62–1.15) GG+AG0.1610.81 AA1.5(1.03–2.19) GG+AA<0.000110.120.24 AG0.65(0.48–0.89)

(5)

Table2(continued) 0.681.05(0.85–1.28)0.230.46 rs3806263G0.0021<0.0001<0.0001 A0.93(0.74–1.16) GG<0.00011<0.0001<0.0001 AG0.81(0.6–1.11) AA1.04(0.6–1.81) GG0.8610.090.18 AG+AA0.84(0.63–1.13) GG+AG<0.00011<0.0001<0.0001 AA1.15(0.67–1.96) GG+AA0.009210.140.28 AG0.81(0.6–1.09) 0.00340.92(0.73–1.16)7e−040.0014 Table3NINJ2haplotypefrequenciesineachofthreestudysubgroups.HaplotypeswerecalculatedusingtheSNPStats(https://www.snpstats.net/start.htm)basedontheexpectationmaximization algorithm rs11833579rs3806263Frequencyin suicidevictimsFrequencyin softsuicide attempters

Frequency incontrolsSuicidevictimsvs.controlsSoftsuicideattemptersvs.controlsSuicidevictimsvs.softsuicideattempters OR(95%CI)PvalueAdjusted PvaluesOR(95%CI)PvalueAdjusted PvaluesOR(95%CI)PvalueAdjusted Pvalues GG0.46620.39240.35251.00––1––1.00–– AG0.14070.31910.34260.37(0.26–0.52)<0.0001<0.00010.86(0.66–1.11)0.250.50.43(0.31–0.61)<0.0001<0.0001 GA0.16670.19920.25120.63(0.45–0.89)0.00780.01560.74(0.54–1)0.050.10.77(0.55–1.09)0.150.3 AA0.22640.08930.05372.37(1.56–3.6)1e−040.00021.41(0.87–2.29)0.160.321.92(1.32–2.78)6e−040.0012

(6)

Alzheimer’s disease in a population from Northern Taiwan (Lin et al.2011) and with risk of stroke in an Iranian population (Malekzadeh et al.2019). Previous studies have reported an association between cognitive change/dementia and suicide attempt (Draper et al.2010; Zucca et al.2019). Apart from the psychological parameters in determination of risk of suicide in these patients, one possible explanation for this observed association is the presence of common genetics factors for these two conditions. Yet, future studies are needed to verify this speculation.

The rs3806263 SNP was associated with death from suicide in allelic, recessive and log-additive models. When comparing allele/genotype frequencies of this SNP between suicide victims and soft suicide attempters, significant associations were found in allelic, codominant, recessive and log- additive models. The rs3809263 SNP has been associated with large artery atherosclerotic stroke in a Chinese population (Zhang et al.2016) and with risk of ischemic stroke in an Iranian population (Malekzadeh et al.2019). Besides, the A allele of this SNP has led to production of higherNINJ2tran- scripts (Zhang et al.2016).

The AG haplotype (rs11833579 and rs3806263, respectively) was significantly less prevalent among suicide victims compared with controls and among suicide victims vs. soft suicide attempters. The GA haplotype was less frequent among suicide victims compared with controls. Finally, the AA haplotype was more prevalent among suicide victims compared with both controls and soft suicide attempters.

Therefore, the results of haplotype analyses further support the role ofNINJ2SNPs in suicidal behavior. It is worth men- tioning that the mentioned haplotypes might include other functional SNPs in addition to the genotyped SNPs which influence the risk of suicide attempt/completion. Therefore, we recommend establishment of future genotyping studies to assess otherNINJ2SNPs in relation to suicidal behavior.

In brief, we reported associations between twoNINJ2 SNPs and suicidal behavior in an Iranian population. Thus, our results further support the possibility for functionality of these SNPs which have been discovered through in silico analyses (Ward and Kellis2012). The exact mechanism for functionality of these SNPs has not been assessed, but these SNPs can modulate gene splicing, mRNA degradation or binding of transcription factors. The lack of an association between these SNPs and psychiatric conditions in an Iranian population (Sayad et al.2019) further support the previously stated speculation by Zai et al., who reported that the genetic factors for suicidal behavior might be independent of the presence of such disorders (Zai et al.2012). Based on the recently reported association between these SNPs and risk of stroke in Iranian populations (Malekzadeh et al.2019), the high risk of post-stroke suicidal ideation or behavior (Pompili et al.2012) and the currently demonstrated association between the mentioned SNPs and suicide attempt/completion, special attention

should be paid to identifying patients who are at risk of developing these associated conditions due to their genetic back- ground. Therefore, our results have clinical implications not only in the identification of persons who are at risk of suicide attempt but also in the management of stroke patients.

In conclusion, these two SNPs might be regarded as genetic determinants of suicide risk in Iranian populations. Further studies in different populations are needed to verify these results. Our study has a limitation regarding lack of assessment of the effect of the mentioned SNPs in modulating the expression of NINJ2.

Acknowledgements The current study was supported by a grant from Shahid Beheshti University of Medical Sciences.

References

Araki T, Milbrandt J (1996) Ninjurin, a novel adhesion molecule, is induced by nerve injury and promotes axonal growth. Neuron 17:

353–361

Araki T, Milbrandt J (2000) Ninjurin2, a novel homophilic adhesion molecule, is expressed in mature sensory and enteric neurons and promotes neurite outgrowth. J Neurosci 20:187–195

Brent DA, Bridge J, Johnson BA, Connolly J (1996) Suicidal behavior runs in families. A controlled family study of adolescent suicide victims. Arch Gen Psychiatry 53:1145–1152

Cheng AT, Chen TH, Chen CC, Jenkins R (2000) Psychosocial and psychiatric risk factors for suicide. Case-control psychological au- topsy study. Br J Psychiatry 177:360–365

Draper B, Peisah C, Snowdon J, Brodaty H (2010) Early dementia diag- nosis and the risk of suicide and euthanasia. Elsevier

Eftekharian MM, Noroozi R, Omrani MD, Sharifi Z, Komaki A, Taheri M, Ghafouri-Fard S (2018) Single-nucleotide polymorphisms in interleukin 6 (IL-6) gene are associated with suicide behavior in an Iranian population. J Mol Neurosci 66:414–419

Ikram MA, Seshadri S, Bis JC, Fornage M, Destefano AL, Aulchenko YS, Debette S, Lumley T, Folsom AR, Van Den Herik EG (2009) Genomewide association studies of stroke. N Engl J Med 360:1718–

1728

Kim CD, Seguin M, Therrien N, Riopel G, Chawky N, Lesage AD, Turecki G (2005) Familial aggregation of suicidal behavior: a family study of male suicide completers from the general population. Am J Psychiatry 162:1017–1019

Lin K-P, Chen S-Y, Lai L-C, Huang Y-L, Chen J-H, Chen T-F, Sun Y, Wen L-L, Yip P-K, Chu Y-M, Chen WJ, Chen Y-C (2011) Genetic polymorphisms of a novel vascular susceptibility gene, Ninjurin2 (NINJ2), are associated with a decreased risk of Alzheimer's disease.

PLoS One 6:e20573–e20573

Malekzadeh V, Azari I, Noroozi R, Shams R, Farzaneh M, Taheri M, Ghafouri-Fard S (2019) Genetic variants withinNinjurin 2gene are associated with risk of ischemic stroke in Iranian population. Neurol Sci 40:2603–2607

Mann JJ, Bortinger J, Oquendo MA, Currier D, Li S, Brent DA (2005) Family history of suicidal behavior and mood disorders in probands with mood disorders. Am J Psychiatry 162:1672–1679

Noroozi R, Azari I, Taheri M, Omrani MD, Ghafouri-Fard S (2019) A single nucleotide polymorphism withinNinjurin 2is associated with risk of multiple sclerosis. Metab Brain Dis 34:1415–1419 Noroozi R, Omrani MD, Ayatollahi SA, Sayad A, Ata A, Fallah H,

Taheri M, Ghafouri-Fard S (2018) Interleukin (IL)-8 polymorphisms contribute in suicide behavior. Cytokine 111:28–32

(7)

Pompili M, Venturini P, Campi S, Seretti ME, Montebovi F, Lamis DA, Serafini G, Amore M, Girardi P (2012) Do stroke patients have an increased risk of developing suicidal ideation or dying by suicide?

An overview of the current literature. CNS Neurosci Ther 18:711– 721

Sayad A, Ghafouri-Fard S, Omrani MD, Taheri M (2019) Associations between two single-nucleotide polymorphisms in NINJ2 gene and risk of psychiatric disorders. J Mol Neurosci 1–10

Serafini G, Calcagno P, Lester D, Girardi P, Amore M, Pompili M (2016) Suicide risk in Alzheimer’s disease: a systematic review. Curr Alzheimer Res 13:1083–1099

Vijayan M, Reddy PH (2016) Stroke, vascular dementia, and Alzheimer's disease: molecular links. J Alzheimer's Dis : JAD 54:427–443 Wan XH, Li SJ, Cheng P, Zhang Q, Yang XC, Zhong GZ, Hu WL, Jin L,

Wang XF (2011)NINJ2polymorphism is associated with ischemic stroke in Chinese Han population. J Neurol Sci 308:67–71

Ward LD, Kellis M (2012) HaploReg: a resource for exploring chromatin states, conservation, and regulatory motif alterations within sets of genetically linked variants. Nucleic Acids Res 40:D930–D934 Zai CC, De Luca V, Strauss J, Tong RP, Sakinofsky I, Kennedy JL

(2012) 11 Genetic factors and suicidal behavior. Neurobiol Basis Suicide 213

Zhang Z, Ni G, Xu G, Xu J, Liu X (2016) A novel functional polymorphism in theNINJ2promoter predicts risk of large artery atherosclerotic stroke. Mol Neurobiol 53:7178–7183

Zucca M, Rubino E, Vacca A, Govone F, Gai A, De Martino P, Boschi S, Gentile S, Giordana MT, Rainero I (2019) High risk of suicide in behavioral variant frontotemporal dementia. Am J Alzheimers Dis Other Dement 34:265–271

Publisher’s NoteSpringer Nature remains neutral with regard to jurisdic- tional claims in published maps and institutional affiliations.