귀하는 이 저작물을 영리 목적으로 이용할 수 없습니다

(1)

저작자표시-비영리-변경금지 2.0 대한민국 이용자는 아래의 조건을 따르는 경우에 한하여 자유롭게

l 이 저작물을 복제, 배포, 전송, 전시, 공연 및 방송할 수 있습니다. 다음과 같은 조건을 따라야 합니다:

l 귀하는, 이 저작물의 재이용이나 배포의 경우, 이 저작물에 적용된 이용허락조건 을 명확하게 나타내어야 합니다.

저작권법에 따른 이용자의 권리는 위의 내용에 의하여 영향을 받지 않습니다. 이것은 이용허락규약(Legal Code)을 이해하기 쉽게 요약한 것입니다.

Disclaimer

저작자표시. 귀하는 원저작자를 표시하여야 합니다.

비영리. 귀하는 이 저작물을 영리 목적으로 이용할 수 없습니다.

변경금지. 귀하는 이 저작물을 개작, 변형 또는 가공할 수 없습니다.

(2)

Master's Thesis

Subin Bae

Department of Biological Sciences

Ulsan National Institute of Science and Technology

2023

Various histone purification and in vitro chromatin reconstitution for the study of biophysical properties

with magnetic tweezers assay

(3)

Subin Bae

Department of Biological Sciences

Ulsan National Institute of Science and Technology

Various histone purification and in vitro chromatin reconstitution for the study of biophysical properties

with magnetic tweezers assay

(4)

(5)

(6)

Abstract

Eukaryotic DNA has a compacted high-ordered structure, known as chromatin. The fundamental units of chromatin are nucleosomes, which consist of DNA and histone proteins.

Chromatin structure has many biological functions. For instance, chromatin protects DNA from damaging factors. DNA metabolism such as transcription and DNA repair is also regulated by chromatin structure. In addition, histone tail regions are targets for post-translational modification, which is associated with epigenetic control of DNA metabolism. In this paper, I purified all canonical Xenopus laevis core histone proteins in E. coli system with a milligram scale. Histone octamer was well assembled with dialysis and purified as size exclusion in vitro condition. Then, a single nucleosome was successfully reconstituted in vitro. Nucleosome reconstitution was confirmed with electrophoretic shift assay and micrococcal nuclease assay.

Multiple nucleosomes were also reconstituted with multiple Widom 601 sequences, which have high binding affinity to histone octamer, in vitro. To investigate the tail effect on nucleosome stability, histones, in which tail region is deleted, were generated using mutagenesis. The tailless histone was overexpressed in E. coli system and purified using size exclusion and ion- exchange chromatographic techniques, successively. Purified tailless histones can be still reconstituted into nucleosomes. Magnetic tweezers technique is one of the single molecule techniques to characterize the physical properties of DNA molecules. The multiple-nucleosome formation was confirmed using magnetic tweezers. With the method of this paper, in vitro multiple tailless nucleosomes will be able to reconstitute. In this case, it will be the key to histone tail effects research in vitro with magnetic tweezers. The undisclosed mechanism of some histone chaperones can be revealed with in vitro chromatin reconstitution and single molecule techniques.

(7)

(8)

List of Figures

Figure 1. Xenopus laevis canonical histone purification

Figure 2. Cloning strategy for multiple repeats of Widom 601 sequences

Figure 3. 4x Widom 601 sequence PCR

Figure 4. Flow chart for histone octamer assembly

Figure 5. Flow chart for nucleosome reconstitution

Figure 6. Tailless histone purification

Figure 7. 4x Widom 601 with handle for magnetic tweezers PCR

Figure 8. Magnetic tweezers

Figure 9. Multiple nucleosome reconstitution

Figure 10. Histone octamer assembly (18% SDS-PAGE)

Figure 11. Multiple nucleosome reconstitution EMSA and MNase assay

Figure 12. Tailless histone octamer assembly

Figure 13. Nucleosome reconstitution with tailless histone proteins

Figure 14. 4x handle DNA reconstitution MNase assay

Figure 15. Bare DNA and nucleosome force-extension curve

(10)

Table 1. Oligomers

(11)

Abbreviations

EMSA: Electrophoretic Mobility Shift Assay

MNase: Micrococcal nuclease

MT: Magnetic tweezers

(12)

1

Ⅰ. Introduction

Eukaryotic DNA is compacted with histone proteins. This high-order structure is called chromatin [1,2]. The basic unit of chromatin is a nucleosome, which is composed of the histone octamer and about 147 bp of DNA that is wrapped around histone octamer. Histone octamer consists of two pairs of four core histones: H2A, H2B, H3, and H4 [3,4]. Chromatin structure has advantages. For example, endogenous and exogenous damage is blocked by the compact structure [5]. This compaction state is flexible, because basically compaction state is blocking the attachment of the protein including DNA replication proteins, DNA repair proteins, or transcription proteins [6]. Chromatin dynamics are important for the control of DNA metabolism with epigenetic information.

In the previous research, chromatin and nucleosomes were studied with histone derived from cell extracts [7,14]. The globular domain and tail domain of histones were defined by trypsinization with histone of chicken blood cell [7]. Canonical Xenopus laevis histones can be purified with a milligram scale in E. coli system, which suppresses post-translation modification. In addition, tailless histone can be edited with mutagenesis. Tailless histone can be expressed and purified [8]. I made plasmids containing tailless constructs for all four canonical histones using mutagenesis. Moreover, I purified the tailless histone with high expression as milligram scale.

All histone proteins are successfully purified and histone octamer was successfully assembled and purified. The nucleosome was also successfully reconstituted. For efficient wrapping of DNA, Widom 601 sequence was amplified with PCR. Widom 601 sequence has high-affinity binding to histone octamer [9]. The nucleosome reconstitution can be confirmed with electrophoretic shift assay (EMSA), and micrococcal nuclease (MNase) assay [10]. Multiple Widom 601 sequences are prepared with restriction enzymes of isocaudomer formation. Multiple nucleosome reconstitution was confirmed with EMSA and MNase assay.

Magnetic tweezers technique is one of single-molecule techniques to measure the biophysical properties of DNA molecules such as tension and torsion [11]. Not only DNA but also nucleosome can be analyzed using magnetic tweezers [12,13]. I also confirmed the reconstitution of multiple nucleosomes with magnetic tweezer data.

(13)

2

Ⅱ. Materials and Methods

2.1 Canonical histone purification 2.1.1 Purification of histone monomer

Xenopus laevis histone gene encoded plasmid was purchased from Genescript. The Vector plasmid is pET-3a. Xenopus laevis histone plasmid was transformed into BL21(DE3) pLysS cell strain with heat shock at 42℃ for 30 sec. Transformed cell incubated with S.O.C media at 37℃ in 220 rpm shaking incubator for 1 hr. The incubated cell was spread on the LB agar plate with ampicillin. The LB plate was incubated overnight at 37℃ incubator. LB media for seed culture were incubated with a single colony and 10 mg/ml of ampicillin overnight in 37℃, 220 rpm shaking incubator. A large-scale cultured cell was induced with 0.4 mM IPTG (isopropyl β-D-1-thiogalactopyranoside) when OD⁶⁰⁰reached 0.6.

After induction, the cell was harvested (RC 12BP+ centrifuge, SORVALL) at 4000 g for 18 min. The supernatant was removed, and the pellet was resuspended with a wash buffer A (50 mM Tris-HCl [pH 7.5], 100 mM NaCl and 1 mM 2-Mercaptoethanol). The resuspended cell was broken with lysozyme incubated at 37℃ for 10 min. A mixture of cell extract and wash buffer B (50 mM Tris-HCl [pH 7.5], 100 mM NaCl, 1 mM 2-Mercaptoethanol and 1 mM PMSF) with 1% Triton X was blended by homogenizer (IKA, T10 basic, Cat. No. 3737000). All blending step was performed on the ice because of the heating of the homogenizer. After blending, the pellet and supernatant were separated in a centrifuge at 18000 g, 20 min. Pellet was resuspended with wash buffer B with Triton X and was blended one more time. After blending, the pellet was centrifuged at 18000 g for 20 min. The blending and centrifuge step was repeated with wash buffer B without Triton X. Specifically, blending was performed without homogenizer only pipetting was used. After two times of blending and centrifuge, supernatants from all steps and pellet were run SDS-PAGE (18%, 235 V, 45 min). The inclusion body pellet was mixed with 1 ml DMSO for each pellet. Each pellet was mixed with unfolding buffer (6 M guanidine- HCl, 20 mM Sodium Acetate [pH 5.2] and 5 mM DTT) gently. A multi mixer (SeouLin Bioscience, SLRM-3) was used with 50 rpm rotation rate at room temperature (23℃, RT) for 1 hr. The supernatant was taken from the centrifuge at 14000 g for 15 min. Pellet was resuspended with 10 ml of the unfolding buffer and was centrifuged under the same condition. The supernatant was poured with a new falcon tube and was mixed with the supernatant from before step. The mixed supernatant was centrifuged one more time with the same condition. The final supernatant was loaded into the S-200 column (GE Healthcare Sephacryl S-200 High Resolution) with a superloop. The sample was loaded with 1~3 ml/min under column maximum pressure. After all sample loading, the fraction was undergone 10 ml of each medical tube with the SAUDE 200 buffer (7 M Urea, 20 mM Sodium Acetate [pH 5.2], 5 mM 2-Mercaptoethanol, 1 mM EDTA and 200 mM NaCl). The fraction was checked with absorbance of

(14)

3

260 nm in the AKTA system. SDS-PAGE was run to double-check size exclusion results. Fractions with target size were pooled. The pooled sample was then loaded onto the cation exchange column (TOSOH Bioscience TSKgel SP-5PW) with a peristaltic pump under 10 ml/min flow rate. The fraction was collected in 10 ml of each medical tube with 5 ml/min flow rate with SAUDE 200 buffer and SAUDE 1000 buffer (7 M Urea, 20 mM Sodium Acetate [pH 5.2], 5 mM 2-Mercaptoethanol, 1 mM EDTA and 1 M NaCl). The buffer gradient increased from 200 mM NaCl to 1 M NaCl for 150 min. After fraction collecting, the peak fraction was confirmed with SDS-PAGE. All confirmed fraction was pooled, and dialysis with 1 mM BME added water using a membrane tube (Spectra/Por molecularporous membrane tubing, MWCO 6~8 kDa) at 4℃ was performed. Dialysis proceeded for 24 hr with a buffer change step each 4 hr. After dialysis, the concentration was measured with Nanodrop. The sample was concentrated until 2 mg/ml with Amicon Ultra centrifugal filter (MWCO 10 K). The concentrated sample was aliquoted by 1 ml and was lyophilized at -121℃ until all water was removed.

(a) (b)

(15)

4

Figure 1. Xenopus laevis canonical histone purification. (a) Induction test result. (b) Inclusion body prep result. (c) Size exclusion result. (d) Ion-exchange result.

2.1.2 Electrophoretic mobility shift assay (EMSA)

Histone protein was made as histone octamer. DNA was wrapped with histone octamer. Finally, the nucleosome was reconstituted. Electrophoretic mobility shift assay used the difference of mobility between DNA and DNA with DNA binding protein in native gel. 180 bp DNA with Widom 601 sequence was used as control DNA. The nucleosome was reconstituted using the salt dialysis method with the ratio of DNA and nucleosome of 1:1 in molarity. DNA ladder and control DNA and nucleosome were loaded in the 5% native gel (5% polyacrylamide, 1x TBE, 0.1% APS and 0.1% TEMED). The gel was run at 4℃ at 150 V for 70 min. After the gel running, the gel was stained as Sybr gold (Invitrogen, S11494) in the RT for 10 min with gently shaking.

2.1.3 Micrococcal nuclease assay (MNase assay)

MNase degrades double-stranded and single-stranded DNA and RNA with endonuclease activity.

When MNase reacts with nucleosome, nucleosome-wrapped DNA was protected from MNase. The wrapped DNA length is known as 147 bp. This assay proves that nucleosomes are properly reconstituted.

10 nM nucleosome was reacted in the total reaction volume of 100 ul with 0.5 U/ul MNase (NEB, M0247S), 1x BSA (NEB, B0247S), 1x MNase reaction buffer (50 mM Tris-HCl [pH 7.9] and 5 mM CaCl²) for 30 min in 37℃. 10 ul of 0.5 M EDTA blocked the MNase reaction. 25 uq of Proteinase K also blocked the MNase activity for 20 min at 50C. MNase blocked sample was purified with a cleanup kit (GeneAll Expin^TM CleanUp SV, Cat. No. 113-150). The purified DNA sample was loaded in 5%

native gel and run at 4℃ at 150 V for 70 min.

(c) (d)

(16)

5 2.2 In vitro chromatin reconstitution

2.2.1 Multiple Widom 601 DNA preparation

Widom 601 sequence has specificity with histone octamer. Widom 601 sequence for the insert was designed with BamHI-HF (NEB, R3136S) and XhoI (NEB, R0146L) at each end. Vector plasmid (pET- 28a) has a BamHI site upstream of SalI. SalI site and XhoI site were isocaudomer relation. These two restriction enzyme sites were connected with T4 ligase (Enzynomics, M0202T). Single Widom 601 sequence insert was copied as PCR with Q5 High-Fidelity DNA Polymerase (NEB, M0491L). PCR mixture was composed with 10 uM Widom Forward primer, 10 uM Widom Backward primer, 10 mM dNTPs, 1x Q5 Reaction buffer (B0927S), 60 ng/ul template plasmid with single Widom 601 sequence, and 2 U/ul Q5 High-fidelity DNA polymerase. Initial denaturation was performed in 98℃ for 30 sec.

Thermocycle was repeated 35 times. Each thermocycle included denaturation (98℃, 10 sec), annealing (63℃, 30 sec), and elongation (72℃, 30 sec). And the samples were extended at 72℃ for 2 min. PCR products were purified with a PCR purification kit (GeneAll, ExpinTM PCR SV, Cat. No. 103-150).

Vector was cut with BamHI-HF and SalI-HF (Neb, R3138L) at 37℃ overnight. A template was purified with a clean-up kit. Template and insert were mixed with a ratio of 1 to 20 and T4 ligase was added with 1x T4 ligase buffer (50 mM Tris-HCl [pH 7.5], 10 mM MgCl2, 10 mM DTT and 1 mM ATP) overnight in RT. After ligation, ligase was blocked with 65℃ heating for 20 min. Competent DH5α cell was prepared for transformation. 50 ul DH5α cell and ligated plasmid were mixed and heated at 42℃

for 30 sec. 450 ul SOC media were added and incubated in a 37℃ shaking incubator for 1 hr.

Transformed cell was spread on the LB agar plate with antibiotics (Kanamycin, Thermofisher, Cat.

No.11815032). The spread cell was incubated at 37℃ for overnight. For miniprep, 5 ml LB media with one single colony was picked and incubated in a 37℃ shaking incubator overnight. Transformed DNA was extracted by miniprep (GeneAll, Plasmid SV mini, Cat.101-150). Miniprep plasmid was cut with BamHI-HF and XhoI at 37℃ for 1 hr. The DNA fragment was submitted to 1% agarose electrophoresis at RT for 135 V, 20 min.

(17)

6

Figure 2. Cloning strategy for multiple repeats of Widom 601 sequences

Multiple Widom 601 fragments for nucleosome reconstitution were made with PCR. Almost the same condition was applied; however, the elongation time was increased to 1 min. For the pure quality of DNA, the PCR product was run in 1% agarose gel at RT for 100 V for 45 min. The DNA sample was purified as gel extraction (NEB, Monarch DNA Gel Extraction Kit, T1020S).

(18)

7

Figure 3. 4x Widom 601 sequence PCR (a) Plasmid map of multiple Widom 601 sequence for PCR. (b) 4x Widom 601 PCR result, 1% agarose gel.

2.2.2 Histone octamer assembly

Lyophilized histone monomers were dissolved in 1 ml unfolding buffer (6 M Guanidine, 20 mM Tris- HCl [pH 7.5] and 10 mM DTT) for 1 hr. Before assembly, each histone concentration was measured by Nanodrop. Each monomer was mixed at the same molar concentration. The total volume was fit by adding unfolding buffer up to 4 ml. The mixture of all four histones was dialyzed in the membrane tube against the refolding buffer (2 M NaCl, 10 mM Tris-HCl [pH 7.5], 1 mM EDTA and 5 mM BME) for 20 hr at 4℃. After the dialysis, aggregates were separated via centrifuging 20000 g for 10 min. Only supernatant was injected in the size exclusion column (GE Healthcare HiLoad 26/600 Superdex^TM 200pg) at 2 ml/min flow ration with 5 ml fraction. Absorbance was measured with the AKTA system. Each fraction was run using SDS-PAGE.

(a) (b)

(19)

8

Figure 4. Flow chart for histone octamer assembly

2.2.3 Reconstitution of nucleosome

Nucleosome was reconstituted using the salt dialysis method. DNA and 4 M KCl were mixed with the same volume. Basically, the same molarity of nucleosome was added at one Widom 601 sequence. For optimization, the molarity of nucleosomes was changed from 90% to 110% of DNA molarity.

Reconstitution buffer-high (2 M KCl, 10 mM Tris [pH 7.5], 1 mM EDTA and 1 mM DTT) was added for final volume 50~100 ul. The mixture was then transferred into the dialysis button (Humpton Research 20 ul dialysis button). The dialysis button was placed in the 500 ml of reconstitution buffer- high. Reconstitution buffer-low was put into reconstitution buffer-high using the peristaltic pump as 1 ml/min for 1.5 L. At this step, the beaker with reconstitution buffer-high was 500 ml volume. This beaker was put in the 4 L volume beaker for taking overflowed buffer. The dialysis buffer was changed to 500 ml reconstitution buffer-low for 2 hr. After the dialysis, the reconstituted sample volume was measured by pipetting. The final concentration was calculated by volume change.

(20)

9

Figure 5. Flow chart for nucleosome reconstitution

2.3 Tailless histone purification

2.3.1 Mutagenesis for deletion mutant plasmid

The deletion region was checked using Luger paper [9]. The Primer sequence is written in Table 1.

The deletion mutation was accomplished with Q5 Site-Directed Mutagenesis Kit (NEB, E0054S). PCR mixture was composed with 10 uM of forward and backward primer of each histone deletion, 10 mM dNTPs, 1x Q5 Reaction buffer (B0927S), 200 ng/ul template plasmid with single Widom 601 sequence, 2 U/ul Q5 High-fidelity DNA polymerase. Initial denaturation was performed in 98℃ for 30 sec.

Thermocycle was repeated 35 times. Each thermocycle was composed with denaturation (98℃, 10 sec), annealing (66℃, 30 sec), and elongation (72℃, 3 min). The samples were extended in 72℃ for 2 min.

PCR products were purified with PCR purification kit (GeneAll, Expin^TM PCR SV, Cat. No. 103-150).

Dpn1(Enzynomics Cat. No. R054L) was reacted with purified PCR products in 37℃ for 4 hr to remove original plasmid. Then T4 PNK (NEB, Cat. No. M0201L) and T4 ligase were added for formation of circular DNA at 37℃ for overnight. After reaction, sample was heat in 65℃ for 20 min. The cloned plasmid was transformed into DH5a E coli cell line and was incubated at 37℃ for overnight.

(21)

10 2.3.2 Purification of tailless histone

Tailless histone plasmid was transformed into BL21(DE3) pLysS cell strain with heat shock at 42℃

for 30 sec. Transformed cell incubated with S.O.C media at 37℃ in 220 rpm shaking incubator for 1 hr.

The incubated cell was spread on the LB agar plate with ampicillin. The LB plate was incubated overnight at 37℃ incubator. LB media for seed culture were incubated with a single colony and 10 mg/ml of ampicillin overnight in 37℃, 220 rpm shaking incubator. A large-scale cultured cell was induced with 0.4 mM IPTG when OD600reached 0.6. After induction, the cell was harvested at 4000 g for 18 min. The supernatant was removed, and the pellet was resuspended with a wash buffer A. The resuspended cell was broken with lysozyme incubated at 37℃ for 10 min. A mixture of cell extract and wash buffer B with 1% Triton X was blended by homogenizer. All blending step was performed on the ice because of the heating of the homogenizer. After blending, the pellet and supernatant were separated in a centrifuge at 18000 g, 20 min. Pellet was resuspended with wash buffer B with Triton X and was blended one more time. After blending, the pellet was centrifuged at 18000 g for 20 min. The blending and centrifuge step was repeated with wash buffer B without Triton X. Specifically, blending was performed without homogenizer only pipetting was used. After two times of blending and centrifuge, supernatants from all steps and pellet were run SDS-PAGE (18%, 235 V, 45 min). The inclusion body pellet was mixed with 1 ml DMSO for each pellet. Each pellet was mixed with unfolding buffer gently.

A multi mixer was used with 50 rpm rotation rate at RT for 1 hr. The supernatant was taken from the centrifuge at 14000 g for 15 min. Pellet was resuspended with 10 ml of the unfolding buffer and was centrifuged under the same condition. The supernatant was poured with a new falcon tube and was mixed with the supernatant from before step. The mixed supernatant was centrifuged one more time with the same condition. The final supernatant was loaded into the S-200 column with a superloop. The sample was loaded with 1~3 ml/min under column maximum pressure. After all sample loading, the fraction was undergone 10 ml of each medical tube with the SAUDE 200 buffer. The fraction was checked with absorbances of 260 nm in the AKTA system. SDS-PAGE was run to double-check size exclusion results. Fractions with target size pooled a beaker. The pooled sample was then loaded into the cation exchange column with a peristaltic pump under a 10 ml/min flow rate. The fraction was collected in 10 ml of each medical tube with a 5 ml/min flow rate with SAUDE 200 buffer and SAUDE 1000 buffer. The buffer gradient increased from 200 mM NaCl to 1 M NaCl for 150 min. After fraction collecting, the peak fraction was confirmed with SDS-PAGE. All confirmed fraction was pooled, and dialysis with 1 mM BME added water using a membrane tube at 4℃ was performed. Dialysis proceeded for 24 hr with a buffer change step each 4 hr. After dialysis, concentration was measured with Nanodrop.

The sample was concentrated until 2 mg/ml with Amicon Ultra centrifugal filter (MWCO 10 K). The concentrated sample was aliquot 1 ml and was lyophilized at -121℃ until all water was removed.

(22)

11

(a) (b)

(c) (d)

(e) (f)

(23)

12

Figure 6. Tailless histone purification (a) Tailless H2A induction test. (b) Tailless H2A inclusion body prep. (c) Tailless H2A size exclusion. (d) Tailless H2A ion-exchange chromatography. (e) Tailless H2B induction test. (f) Tailless H2B inclusion body prep. (g) Tailless H2B size exclusion. (h) Tailless H2B ion-exchange chromatography. All SDS-PAGE gels are 18%. Red boxes indicate target histones.

2.4 Magnetic tweezers

2.3.1 Multiple Widom 601 DNA preparation for magnetic tweezers

For the magnetic tweezer assay, DNA was prepared with PCR. The PCR mixture consisted of 10 uM Forward MT, 10 uM Backward MT, 10 mM dNTPs, 1x Q5 Reaction buffer (B0927S), 60 ng/ul template plasmid with single Widom 601 sequence, 2 U/ul Q5 High-fidelity DNA polymerase. Initial denaturation was performed in 98℃ for 30 sec. Thermocycle was repeated 35 times. Each thermocycle was composed of denaturation (98℃, 10 sec), annealing (67℃, 2 min), and elongation (72℃, 30 sec).

Final extension was performed at 72℃ for 2 min. PCR products were then purified with a PCR purification kit (GeneAll, ExpinTM PCR SV, Cat. No. 103-150).

(g) (h)

(24)

13

Figure 7. 4x Widom 601 with handle for magnetic tweezers PCR (a) Plasmid map of multiple Widom 601 sequence for PCR. (b) 4x Widom 601 with MT handle PCR result, 1% agarose gel.

2.3.1 Magnetic tweezers

For the sample chamber assembly, polyethylene glycol (PEG) was coated on the coverslips.

Coverslips were sonicated in acetone for 1 hr and washed with DI water. And Etching was performed with 10 M KOH for 10 min. in addition, coverslips were washed with DI water and dried with N2 gas.

Salinization was performed with methanol, acetic acid, and amino-silane. Coverslips were PEG-coated with PEG solution (160 mg mPEG, 2 mg biotinPEG were solved in 640 ul of 1 M NaHCO3). The PEGylation surface of coverslips was attached and incubated overnight. After then, each coverslip was washed with DI. M270-amine (Invitrogen, 14307D) and DBCO (sigma, 762040-1MG) were incubated at RT for 3 hr with slow rotation. The sample chamber was made with the attachment of the PEGylation surface of coverslips with two-sided tape. Multiple nucleosomes were reconstituted with the salt dialysis method. Reconstituted nucleosomes were incubated with neutravidin at RT for less than 15 min. The sample chamber was washed with streptavidin-coated polystyrene particles (SPHEROTM Streptavidin Coated Particles, SVP-10-5) for surface reference. BSA was injected for passivation. The TE buffer (10 mM Tris-HCl [pH 7.2] and 1 mM EDTA) flowed into the chamber. Neutravidin-nucleosome complexes were injected into the chamber and incubated in RT for 5 min. The surplus biotin-binding site of neutravidin was saturated with biotin-modified ssDNA. The chamber was washed with TE buffer.

M270-DBCO was injected and incubated at RT for 1 hr.

(a) (b)

(25)

14

Figure 8. Magnetic tweezers

Ⅲ. Results

3.1 Histone purification, histone octamer assembly, and nucleosome reconstitution

The nucleosome reconstitution of histone proteins was determined using two kinds of experiments.

EMSA data show the binding of histone protein to DNA. MNase assay shows the wrapping of histone protein to DNA. After purification of the histone monomer, histone protein was run SDS-PAGE to confirm the protein size (Figure 1). In the EMSA data, the 180 bp of the Widom 601 sequence band were in the exact ladder site. The reconstituted nucleosome was in the upper location than DNA only band. In addition, the MNase reacted nucleosome band was in the ~150 bp size.

(26)

15

Figure 9. Multiple nucleosome reconstitution (a) Single Widom 601 sequence reconstitution results in 5% native gel. (b) MNase assay result in 5% native gel. 150 bp size band was detected.

3.2 In vitro chromatin reconstitution

For multiple nucleosome reconstitution, I made four tendon sequences of Widom 601. The 4x Widom 601 sequence was amplified with PCR. Histone octamer assembly was prepared as dialysis and size exclusion. Histone octamer was run by SDS-PAGE. Each monomer was denatured.

(a) (b)

(27)

16

Figure 10. Histone octamer assembly (18% SDS-PAGE)

Multiple nucleosomes were reconstituted using the salt dialysis method. The results were confirmed with EMSA method and MNase assay. EMSA data show the shifted reconstituted nucleosome band in the well. Since multiple nucleosomes cannot go through into the 5% native gel, MNase assay data show

~140 bp band and its multiple size bands.

Figure 11. Multiple nucleosome reconstitution EMSA and MNase assay (a) EMSA result in 5%

native gel. The histone octamer ratio was various for optimization. (b) MNase assay result. MNase was partially reacted at multiple nucleosomes.

3.3 Nucleosome reconstitution with tailless histone proteins

Tailless histone plasmid mutant was cloned as site-directed mutagenesis. Purification results were confirmed with SDS-PAGE. Purified protein was confirmed with the histone octamer assembly. Tailless H2A and H2B were well assembled with H3 and H4 monomers. Tailless histone octamer assembly was

(28)

17

purified as dialysis and size exclusion. The assembled histone octamer was shown each size band in exact size. Tailless nucleosome was reconstituted with H2A tailless histone octamer and H2A, H2B tailless histone octamer.

Figure 12. Tailless histone octamer assembly (a)WT histone octamer 18% SDS-PAGE result. (b) H2A deletion mutant, WT H2B, WT H3, WT H4 histone octamer SDS-PAGE result. (c) H2B deletion mutant, WT H2A, WT H3, WT H4 histone octamer SDS-PAGE result. (d) H2A deletion mutant, H2B deletion mutant, WT H3, WT H4 histone octamer SDS-PAGE result. All histone octamer was purified with size exclusion.

(a) (b) (c) (d)

(29)

18

Figure13. Nucleosome reconstitution with tailless histone proteins (a) Gel shift assay in 5%

native gel. (b) MNase assay.

3.4 Mechanical property of multiple nucleosomes

I made 4x multiple Widom 601 sequence DNA with 5’ azide and 3’ dual biotin modified handle DNA for magnetic tweezers. The reconstitution of multiple nucleosomes was confirmed with MNase assay.

Bare DNA got the force from about 700 nm. The length of bare DNA increases linearly after 800 nm.

However, the nucleosome got a plateau of about 580 nm (purple arrow). When the length is 680 nm, about 25 nm step was observed. The steps were observed every 25 nm step until 5 steps (black arrow).

This multiple-step involved unwrapping of each nucleosome.

(a) (b)

(30)

19

Figure 14. 4x handle DNA reconstitution MNase assay ~150 bp size of wrapped DNA was observed.

Figure 15. Bare DNA and nucleosome force-extension curve. The green line is the nucleosome curve. The red line is a bare DNA curve.

(31)

20

Ⅳ. Discussion and Conclusions

In eukaryotic cells, nucleosome formation is catalyzed by histone chaperones for example FACT and CAF-1 [18,19]. Even though nucleosomes are reconstituted in vitro using purified histone chaperones, the residual histone chaperones might disturb the interaction between nucleosomes and other proteins.

Instead, in vitro, nucleosome can be reconstituted without histone chaperone by salt dialysis. Purified histones in the E. coli system are not posttranslationally modified. In this study, I purified Xenopus laevis core histone monomer from the E. coli system with the inclusion body prep and size exclusion and ion exchange chromatography. Purification of histone in vitro is important for research on its properties. The function can be studied as pure histone [8]. I confirmed the histone octamer assembly and nucleosome reconstitution with purified histone. EMSA and MNase assay showed the nucleosome reconstitution. In vivo nucleosomes are spaced by 20~90 bp linker DNA [17]. I made multiple nucleosomes with multiple Widom 601 sequence repeats with 58 bp linker DNA. The formation of multiple nucleosomes was confirmed by molecular biological assay: EMSA, MNase assay, and biophysical assay: magnetic tweezer assay. The force-extension curve shows the unwrapping of nucleosomes with multiple steps. More stable in vitro chromatin can be made with more repeats of multiple Widom 601 sequences.

The function of histone tail regions is related to chromatin compaction and relaxation [15]. However, in the previous studies, histone proteins were obtained from cell extracts and tail deletion was performed by a protease, trypsin [7] or clostripain [14]. To overcome the complexity of modified tail effects, previous in vitro chromatin studies used mutagenesis for tail deletion. I made deletion mutant of H2A and H2B histone with site-directed mutagenesis. I then purified tailless histones with size exclusion and ion exchange chromatography. These steps were almost identical to WT histone monomer purification.

However, the deleted region was important for the induction of protein. I made 10 types of deletion mutants. However, several kinds of deletion mutants (H2A 11 amino acid deletion, H3 44 amino acid deletion, H3 62 amino acid deletion) were not expressed presumable because of unexpected misfolding or degradation. Histone octamer containing tailless histones was still assembled with dialysis at high salt concentration. Histone octamer containing tailless histones was purified with size exclusion so clearly. Nucleosome formation with tailless histones was tested by the EMSA and MNase assay. Single mutant tailless nucleosome and double mutant tailless nucleosome has similar stability with WT nucleosome. This research can be the key to the tail function research of in vitro chromatin properties.

The histone chaperone mechanism was studied using the DNA curtain technique [16]. Nucleosome and tailless nucleosome chromatin will help to figure out the mechanism of histone chaperone.

In vivo nucleosome reconstitution was confirmed with the magnetic tweezers data. The Plateau region

(32)

21

showed the effect of nucleosome stacking effects. The next steps showed the nucleosome wrapping. 5 steps meant that 5 nucleosomes were reconstituted. Each 25 nm size was proven. Four nucleosomes were wrapped on each Widom 601 sequence, and one more nucleosome was wrapped in the handle DNA for magnetic tweezers experiments. With nucleosome reconstitution protocol, multiple tailless nucleosomes will be reconstituted. Finally, based on the results, it was confirmed that the function of the tailless region of the nucleosome in the chromatin structure can be studied using magnetic tweezers experiments. The mechanical properties of multiple tailless nucleosome will compare with WT chromatin fiber.

(33)

22

Oligomers for the Experiments

Table 1. Oligomers

Name Sequence

PCR primer forward Widom 1st 5’- AAGAAGGAGATATAATA GAATTCCC-3’

2^nd backward Widom 5’- GGAGGAACTATATCCGG -3

Forward MT 5’-azide GTCTTCATGGGAGAAAATAATACTG -3’

Backward MT 5’- GGTTATCAAGTCACAAATCACCATG dual biotin-3’

H2A 13del forward 5’-AAGGCGAAAACCCGTAGC -3’

H2A 13del backward 5’-

GAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATA TG-3’

H2B 27 del forward 5’-AAAAAGCGCAGGAAGACAAGG-3’

H2B 27del backward 5’-

CCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGAT ATACATATG-3’

(34)

23

REFERNECES

1. Woodcock, C. L., & Ghosh, R. P. (2010). Chromatin higher-order structure and dynamics. Cold Spring Harbor perspectives in biology, 2(5), a000596.

2. K Kim, K., Eom, J., & Jung, I. (2019). Characterization of Structural Variations in the Context of 3D Chromatin Structure. Molecules and Cells, 42(7), 512-522.

3. Kornberg, R. D. (1974). Chromatin structure: A repeating unit of histones and DNA. Science, 184(4139), 868–871.

4. McGhee, J. D., & Felsenfeld, G. (1980). Nucleosome structure. Annual Review of Biochemistry, 49(1), 1115–1156. https://doi.org/10.1146/annurev.bi.49.070180.005343

5. Takata, H., Hanafusa, T., Mori, T., Shimura, M., Iida, Y., Ishikawa, K., Yoshikawa, K., Yoshikawa, Y., & Maeshima, K. (2013). Chromatin Compaction Protects Genomic DNA from Radiation Damage. PLOS ONE, 8(10), e75622.

6. Ehrenhofer-Murray A. E. (2004). Chromatin dynamics at DNA replication, transcription and repair. European journal of biochemistry, 271(12), 2335–2349.

7. Ausio, J., Dong, F., & van Holde, K. (1989). Use of selectively trypsinized nucleosome core particles to analyze the role of the histone “tails” in the stabilization of the nucleosome. Journal of Molecular Biology, 206(3), 451-463.

8. Luger, K., Rechsteiner, T. J., Flaus, A. J., Waye, M. M., & Richmond, T.

J. (1997). Characterization of nucleosome core particles containing histone proteins made in bacteria. Journal of Molecular Biology, 272(3), 301-311.

9. Lowary, P., & Widom, J. (1998). New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning. Journal of Molecular Biology, 276(1), 19-42.

(35)

24

10. Mattiroli, F., Gu, Y., & Luger, K. (2018). Measuring Nucleosome Assembly Activity in vitro with the Nucleosome Assembly and Quantification (NAQ) Assay. Bio-protocol, 8(3), e2714.

11. Kruithof, M., Chien, F., de Jager, M., & van Noort, J. (2008). Subpiconewton Dynamic Force Spectroscopy Using Magnetic Tweezers. Biophysical Journal, 94(6), 2343-2348.

12. Kaczmarczyk, A., Meng, H., Ordu, O., Noort, J. van, & Dekker, N. H. (2020).

Chromatin fibers stabilize nucleosomes under torsional stress. Nature Communications, 11(1).

13. Kruithof, M., Chien, F.-T., Routh, A., Logie, C., Rhodes, D., & van Noort, J. (2009).

Single-Molecule Force Spectroscopy reveals a highly compliant helical folding for the 30- nm chromatin fiber. Nature Structural & Molecular Biology, 16(5), 534–540.

14. Morales, V., & Richard-Foy, H. (2000). Role of Histone N-Terminal Tails and Their Acetylation in Nucleosome Dynamics. Molecular and Cellular Biology, 20(19), 7230-7237.

15. Grant, P. A. (2001). A tale of histone modifications. Genome Biology, 2(4), reviews0003.1.

16. Kang, Y., Bae, S., An, S., & Lee, J. Y. (2022). Deciphering Molecular Mechanism of Histone Assembly by DNA Curtain Technique. Journal of visualized experiments : JoVE, (181), 10.3791/63501.

17. Szerlong, H. J., & Hansen, J. C. (2011). Nucleosome distribution and linker DNA:

connecting nuclear function to dynamic chromatin structure. Biochemistry and cell biology

= Biochimie et biologie cellulaire, 89(1), 24–34.

18. Kadyrova, L. Y., Rodriges Blanko, E., & Kadyrov, F. A. (2013). Human CAF-1-dependent nucleosome assembly in a defined system. Cell cycle (Georgetown, Tex.), 12(20), 3286–3297.

19. Gurova, K., Chang, H. W., Valieva, M. E., Sandlesh, P., & Studitsky, V. M. (2018). Structure and function of the histone chaperone FACT - Resolving FACTual issues. Biochimica et

(36)

25

biophysica acta. Gene regulatory mechanisms, S1874-9399(18)30159-7. Advance online publication.

(37)

26