Contents lists available atScienceDirect
Cellular Immunology
journal homepage:www.elsevier.com/locate/ycimm
Research paper
Sodium azide suppresses LPS-induced expression MCP-1 through regulating I κ B ζ and STAT1 activities in macrophages
Cho-Yi Park
a, Jae-Nyoung Heo
a, Kyoungho Suk
b, Won-Ha Lee
a,⁎aSchool of Life Sciences, BK21 Plus KNU Creative BioResearch Group, Kyungpook National University, Daegu 41566, Republic of Korea
bDepartment of Pharmacology, Brain Science & Engineering Institute, BK21 Plus KNU Biomedical Convergence Program, Kyungpook National University School of Medicine, Daegu 41944, Republic of Korea
A R T I C L E I N F O
Keywords:
LPS MCP-1 Signaling Macrophage STAT1 IκBζ
A B S T R A C T
Sodium azide (NaN3) is a chemical compound with multiple toxic effects on vascular and neuronal systems, causing hypotension and neurotoxicity, respectively. In order to test its effects on the immune system, human and mouse macrophage-like cell lines were treated with nontoxic doses of NaN3and the changes in LPS-induced inflammatory activation was measured. Interestingly, the LPS-induced expression of monocyte chemoattractant protein (MCP)-1 was suppressed by NaN3without affecting the expression of IL-8 and TNF-α. Further analysis of cellular signaling mediators involved in the expression of these cytokines revealed that NaN3suppressed the LPS- induced activation of signal transducers and activator of transcription (STAT)1 and inhibitor ofκB (IκB)ς, which are involved in the LPS-induced expression of MCP-1, while the LPS-induced activation of nuclear factorκ-light- chain-enhancer of activated B cells (NF-κB) was not affected. The LPS-induced expression of MCP-2 and CXCL10, which are also regulated by STAT1, was suppressed by NaN3. Similarly, the LPS-induced expression of IL-6, which is regulated by IκBζ, was suppressed by NaN3. These results demonstrate that NaN3selectively suppresses the LPS-induced expression of pro-inflammatory mediators through the suppression of STAT1 and IκBζ activation. These newfindings about the activity of NaN3may contribute to the development of specific regulators of macrophage activity during acute and chronic inflammation.
1. Introduction
Sodium azide (NaN3) is a highly water soluble toxic chemical compound without any color, taste, or odor[1]. It is frequently used as a preservative for aqueous laboratory reagents and biologicalfluids because of its acute toxicity toward insects, weeds, nematodes, fungi, and bacteria[2]. High dose ingestion of NaN3can lead to headaches and hypotension through its acute vasodilatory function [3,4]. A neurotoxic effect of chronic NaN3delivery to the brain hippocampus area has also been reported[5]. In rat primary cortical neurons, NaN3
treatment increased intracellular calcium concentration and inhibited ATP hydrolysis. In addition, animals exposed to NaN3 developed hypoxia and impairment in learning and memory[6,7]. NaN3impairs mitochondrial function through inhibiting the electron transport chain.
This is possible due to its inhibitory activity towards cytochrome c oxidase (complex IV) [8–10]. Similarly, NaN3 treatment affects the reorganization of the mitochondria-rich cytoplasm for the establish- ment of the anteroposterior axis in ascidian eggs [11]. Industrially, NaN3is used as the main chemical in automobile airbags, which rely on the explosive conversion of NaN3into nitrogen gas, which is triggered
by an electrical charge upon automobile impact[12].
As one of the main cell types involved in inflammation, macro- phages play multiple functions including phagocytosis, antigen pre- sentation and immunoregulation[13,14]. Macrophages, once activated through recognition of pathogens or cytokines from other immune cells, express various inflammatory mediators which can be either pro- inflammatory or anti-inflammatory depending upon the stimulation that macrophage receives and/or the type of macrophage that responds (such as M1 and M2)[15,16]. These inflammatory mediators expressed from macrophage include various cytokines (IL-1, IL-6, IL-10, IL-12, TNFs, IFNs, etc), chemokines (IL-8, MCP-1, CXCL10, GRO, IP-10, etc), lipid metabolites (leukotrienes and prostaglandins), and reactive oxy- gen/nitrogen species [17–19]. Prolonged activation of macrophages can damage the tissue leading to the development of various chronic inflammatory diseases and inflammation is strongly associated with the development of cancer [20–22]. Atherosclerosis is one example of chronic inflammatory diseases where macrophages are involved at the initiation (by forming fatty streak after digestion of oxidized-LDL), development (by transforming into foam cells which is one of the main constituents of atherosclerotic plaques), and plaque rupture (by secret-
http://dx.doi.org/10.1016/j.cellimm.2017.02.007
Received 21 October 2016; Received in revised form 22 February 2017; Accepted 27 February 2017
⁎Corresponding author at: School of Life Sciences and Biotechnology, Kyungpook National University, Daegu 702-701, Republic of Korea.
E-mail address:[email protected](W.-H. Lee).
Available online 04 April 2017
0008-8749/ © 2017 Elsevier Inc. All rights reserved.
MARK
Bacterial lipopolysaccharide (LPS) and NaN3were purchased from Sigma-Aldrich (St. Louis, MO). Antibodies against STAT1, phospho- STAT1 (tyr701), IκBζ, IκB-α, phospho-IκB-α (ser32/36) (5A5), and phospho-NF-κB p65 (ser536) were purchased from Cell Signaling Technology (Danvers, MA, USA). Monoclonal antibodies against NF- κB p65, polyclonal antibodies againstβ-actin and secondary antibodies for Western blotting (donkey anti-goat immunolgolobulin [IgG]-horse- radish peroxidase [HRP], goat anti-mouse IgG-HRP, and goat anti- rabbit IgG-HRP) were obtained from Santa Cruz Biotechnology (Dallas, TX, USA).
2.2. Cell culture and activation
The human monocytic leukemia cell line THP-1 and mouse macro- phage-like cell RAW264.7 were purchased from and maintained as suggested by ATCC. To test the effects of sodium azide on THP-1 cells, cells were seeded on sterilized 12-well, 24-well and 96-well tissue culture plates in RPMI 1640 medium supplemented with 10% (v/v) fetal bovine serum. The cells were pre-treated with 1–10 μ g/ml of sodium azide for 1 h. Cells were then stimulated with 1μg/ml of LPS for THP-1 and 100 ng/ml for RAW264.7 cells.
2.3. Western blotting
Western blot analysis was performed as previously described [26,27]. Cell lysates were collected in 100μl of NP-40 (IGEPAL®CA- 630) lysis buffer (150 mM NaCl, 1% [v/v] NP-40, 50 mM Tris, pH 8.0) containing protease inhibitor cocktail (Calbiochem, San Diego, CA, USA). The debris was then removed from total cell lysates by centrifugation, and the remaining proteins were separated by SDS- PAGE. The proteins were then blotted onto nitrocellulose membranes (Roche, Penzberg, Germany), and the membranes were incubated in a blocking solution (5% [w/v] nonfat dried milk in TBS containing 0.1%
[v/v] Tween®-20 [TBST]) for 1 h. The membranes were then washed with TBST 3 times at 10 min intervals and incubated overnight at 4 °C with primary antibodies in TBST. Following incubation, the membranes were washed with TBST and incubated with HRP-conjugated secondary antibodies for 3 h. Finally, the membranes were washed in TBST and then reacted with enhanced chemiluminescence detection reagents (Biosesang, Seongnam, Korea). The specific bands on membranes were visualized using the Davinch-Chemi™ Chemiluminescence Imaging System (CoreBio, Seoul, Korea).
2.4. Enzyme-linked immunosorbent assay (ELISA)
The quantity of cytokines present in the supernatant was measured using a sandwich ELISA (R & D Systems, Minneapolis, MN, USA).
Briefly, flat-bottomed 96-well plates were coated with capture anti- bodies (diluted to 1/250 in coating buffer [R & D Systems]) and
USA). The RNA was used as a template for the generation offirst-strand complementary DNAs (cDNAs) using a RevertAid™first strand cDNA synthesis kit (Fermentas, Hanover, MD, USA) with 500 ng oligo (dT)12–18 primers. PCR primers were designed using ABI PRISM®
Primer Express 2.0 software (Applied Biosystems, Foster City, CA, USA), and prepared by Geno Tech Corp (Daejeon, Korea). Primer sequences are listed inTable 1. After the PCR reaction, threshold cycle (Ct) values obtained for each reaction were normalized using the GAPDHCt value. Data points represent values relative to those of the baseline control which were set to 1.
2.6. Statistical analysis
All data were presented as the mean ± standard error of the mean (SEM), and the number of independent experiments performed was indicated in eachfigure legend. All analyses were performed using SPSS software (IBM, Armonk, NY, USA) with one-way analysis of variance (ANOVA) or the paired or unpaired Student’s t-test, as appropriate.
Differences were considered significant atp< 0.05.
3. Results
3.1. Sodium azide suppresses the LPS-induced expression of monocyte chemoattractant protein 1 (MCP-1) without affecting cell viability
In this study, we focused our investigation on the effect of sodium azide on the LPS-induced expression of pro-inflammatory mediators.
First, we confirmed the effect of sub-lethal doses of sodium azide on LPS-induced MCP-1 production. MCP-1 (CCL2) is a member of the CC
Table 1
Primer sequences used in the experiment.
Primer sequence (5′-3′)
MCP-1 F ACTCTCGCCTCCAGCATGAA
R TTGATTGCATCTGGCTGAGC
TNF-α F GGAGAAGGGTGACCGACTCA
R CTGCCCAGACTCGGCAA
CXCL10 F GAAATTATTCCTGCAAGCCAAT
R CAGACATCTCTTCTCACCCTTCT
CCL8 F CATGCTGAAGCTCACACCCT
R GTCCCTGAGGGCTGAAAGTG
IL-6 F GGTACATCCTCGACGGCATCT
R GTGCCTCTTTGCTGCTTTCAC
GAPDH F TGGGCTACACTGAGC
R GGGTGTCGCTGTTGAAGTCA
Mouse MCP-1 F GAAGGAATGGGTCCAGACAT
R ACGGGTCAACTTCACATTCA
Mouse GAPDH F CGACTTCAACAGCAACTCCCACTCTTCC
R TGGGTGGTCCAGGGTTTCTTACTCCTT
family of chemokines and mediates the chemotactic recruitment of circulating monocytes to inflammatory sites[28,29]. THP-1 cells were pre-treated with various doses of sodium azide for 1 h. Then, the cells were stimulated with LPS for 24 h. Sodium azide suppressed LPS- induced MCP-1 production in a dose-dependent manner (Fig. 1A).
Cytotoxicity was not detected at the concentrations of sodium azide used for treatment (Fig 1B). In order to test whether the suppressive effect of NaN3on MCP-1 production occurs at the transcriptional level, the amount of its mRNA was then tested. Sodium azide inhibited the LPS-induced expression of MCP-1 mRNA (Fig 1C). These results suggest that sodium azide inhibited LPS-induced MCP-1 production by regulat- ing the transcription of the gene without affecting cell viability.
We then tested whether the suppressive effect of NaN3on the LPS- induced expression of MCP-1 occurs in other monocyte/macrophage cell lines. When the mouse macrophage-like cell line RAW264.7 was treated with NaN3, a significant decrease in LPS-induced mRNA synthesis was detected (Fig. 1D). The measurement of mRNA levels in the presence of actinomycin D revealed that NaN3treatment did not affect mRNA stability (data not shown). The analysis of intracellular MCP-1 levels after LPS stimulation revealed that NaN3treatment did not affect the secretion of newly-synthesized MCP-1 (data not shown).
These results indicate that NaN3treatment suppressed the LPS-induced expression of MCP-1 through regulating the signaling pathway that leads to the transcriptional activation of the gene without affecting its mRNA stability or secretion of newly synthesized MCP-1 in macro- phages.
3.2. Sodium azide does not affect the LPS-induced expression of TNF-αand IL-8
TNF-α is major pro-inflammatory cytokine that is known to be involved in the regulation of infection, inflammation, the autoimmune response, and the development of the immune system[30]. The pre- treatment of THP-1 cells with sodium azide did not suppress LPS- induced TNF-αproduction (Fig 2A). In contrast, TNF-αlevels showed a tendency to slightly increase after NaN3pretreatment and LPS stimula- tion, but this change was not statistically significance. When mRNA levels for TNF- αwere tested, similar results were obtained (Fig 2B).
NaN3pretreatment did not affect the LPS-induced expression of IL-8 either, which was detected both at the protein and mRNA levels (Fig. 2C and D). These data indicate that the suppressive effect of
sodium azide is specific. The expression of IL-10, an anti-inflammatory cytokine, was not affected by sodium azide treatment (data not shown).
3.3. Sodium azide does not affect the LPS-induced phosphorylation/
degradation of IκB and subsequent activation of NF-κB
In an effort to determine the molecular mechanism responsible for the NaN3-mediated suppression of MCP-1 expression, the activation statuses of transcription factors involved in MCP-1 activation were analyzed. NF-κB is the major transcription factor involved in the expression of MCP-1 in macrophages that have been activated with LPS. The activation of NF-κB requires previous phosphorylation and degradation of its inhibitor IκB. When IκB was analyzed in THP-1 cells that were pretreated with NaN3and activated with LPS, no significant changes were detected in comparison to cells without NaN3pretreat- ment (Fig. 3A). Phosphorylation of the NF-κB p65 subunit is one of the key events required for NF-κB activation. As shown inFig. 3B, the LPS- induced phosphorylation of p65 was not affected by sodium azide treatment. These results indicate that the treatment with sodium azide did not affect the LPS-mediated NF-κB signaling pathway.
The expression of MCP-1 can be regulated by factors other than NF- κB. Friend leukemia integration 1 transcription factor (FLI-1), a member of the ETS family of transcription factors, was recently reported to regulate MCP-1 expression through its interaction with the NF-κB p65 subunit[31]. On the other hand, the cytokine-induced expression of MCP-1 was shown to be down-regulated by co-treatment with transforming growth factor (TGF)-β[32]. The activation status of FLI-1 and the expression level of TGF-β, however, were not affected by NaN3pretreatment in LPS-stimulated THP-1 cells (data not shown). In contrast, the activation statuses of STAT1 and IκBζwere affected by NaN3as presented in the following sections.
3.4. Sodium azide suppresses the LPS-induced phosphorylation of STAT1
STAT1 has been reported to be involved in regulating MCP-1 expression[33–35] and its activity has been found to be associated with the development of diseases such as systemic lupus erythematosus and diabetic nephropathy[36,37]. STAT1 is phosphorylated at Tyr701 and Ser727, and these sites are often responsible for maximal transcrip- tional activity in response to a specific stimulus. Phosphorylation at Tyr701 of STAT1 was increased by LPS stimulation in THP-1 cells and Fig. 1.Sodium azide (SA) inhibits lipopolysaccharide (LPS)-induced monocyte chemoattractant protein (MCP)-1 production in macrophage-like cell lines. (A) THP-1 cells were pretreated with 1, 5, or 10μg/ml of SA for 1 h and stimulated with or without 1μg/ml of LPS. Culture supernatants were collected at 24 h after stimulation for the analysis of MCP-1 production using ELISA. (B) THP-1 cells were treated with 1, 5, or 10μg/ml of sodium azide for 1 h and then with 1μg/ml of LPS for 28 h. Then, the cells were counted using trypan blue staining.
Cell viability was represented by cell number relative to the untreated control. THP-1 (C) and RAW264.7 (D) cells were pretreated with 10μg/ml of SA for 1 h. Then, the cells were stimulated for 12 h with 1μg/ml and 100 ng/ml of LPS, respectively. Total cellular RNAs were isolated forMCP-1andGAPDHmRNA measurements using qPCR. Relative mRNA levels to the baseline control were calculated as described in the Materials and Methods. Each experiment was repeated more than three times with essentially the same results.
pre-treatment with sodium azide suppressed LPS-induced STAT1 phos- phorylation (Fig. 4A and B).
Since NaN3suppresses the phosphorylation of STAT1, it is likely that the expression of other STAT1-dependent genes will also be affected. In human monocytic lineage cells, STAT1 activation leads to the activation of the genes encoding CCL2 (MCP-1), CCL8 (MCP-2) and CXCL10[38,39]. CXCL10 and MCP-2 mRNA levels were measured in LPS-treated cells after sodium azide pretreatment. As shown in Fig. 4C and D, sodium azide suppressed the LPS-induced increase of CXCL10 and MCP-2 mRNA levels. These data indicate that NaN3
suppresses the expression of a specific subset of chemokines by regulating STAT1 activity.
3.5. Treatment with sodium azide suppresses the LPS-induced expression of IκBζ, a transcriptional regulator of MCP-1
IκBζis a novel member of the IκB family that has been identified by a differential screening approach in apoptosis-sensitive and -resistant
tumor cells[40]. As a transcriptional coactivator, IκBζis required for the selective expression of a subset of NF-κB secondary target genes including MCP-1[41,42]. In the current study, the expression level of IκBζwas then tested after treatment with NaN3and/or LPS. As shown in Fig. 5A and B, IκBζexpression was rapidly increased by LPS stimulation and pre-treatment with sodium azide resulted in a reduction of LPS- induced IκBζexpression. In order to confirm the effects of sodium azide on other IκBζ- dependent genes, IL-6 expression levels were tested. The gene encoding IL-6 is one of the IκBζ-dependent secondary response genes [43,44] and IL-6 expression has been shown to be severely impaired in IκBζ-/-macrophages that were stimulated with LPS[45]. As expected, pre-treatment with sodium azide suppressed the LPS-induced expression ofIL-6mRNA (Fig. 5C). These results indicate that treatment with sodium azide inhibited the LPS-induced expression of IκBζ, which subsequently affects the expression of genes including MCP-1 and IL-6.
4. Discussion
The current data indicate that NaN3pretreatment of macrophage- like cell lines resulted in the suppression of LPS-induced activation of STAT1 and IκBζwithout affecting NF-κB activation. This differential effect of NaN3 was manifested by its suppressive effect on the LPS- induced expression of MCP-1, MCP-2, CXCL10, and IL-6 all of which are regulated by STAT1 and/or IκBζ. In contrast, the LPS-induced expres- sion of TNF-αand IL-8, which are regulated by NF-κB but not by STAT1 or IκBζ, remain affected.
As a member of the CC chemokine family, MCP-1 has chemoat- tractant activity for monocytes, T cells, mast cells, and basophils [46,47]. The expression of MCP-1 can be induced by various stimuli such as TNF, IL-1β, IL-4, viruses, and endotoxins in both immune and nonimmune cells [46,48]. In addition to its chemotactic activities, MCP-1 also enhances integrin expression and tumoricidal activity in macrophages [49]. As a consequence, MCP-1 is involved in the pathogenesis of multiple forms of inflammatory disorders, such as atherosclerosis, multiple sclerosis, rheumatoid arthritis, glomerulone- phritis, sepsis, or inflammatory bowel disease[50,51]. MCP-2 (CCL8), a chemokine closely related to MCP-1, is an important mediator of lymphocyte and monocyte migration [52]. Mononuclear leukocytes, fibroblasts and cancer cells produce MCP-2 in response to interferon (IFN)-γ or IL-1β [53]. CXCL10 (IP-10, IFN-γ-inducible protein of 10 kDa), a chemoattractant for NK and activated T cells, is a chemokine Fig. 2.SA does not affect the LPS-induced production of interleukin(IL)-8 or tumor necrosis factor (TNF)-αin THP-1 cells. (A) THP-1 cells were pretreated with PBS or 10μg/ml of SA for 1 h and stimulated with 1μg/ml of LPS for 9 h. The secretion levels of TNF-αwere measured by ELISA. (B) Cells were pretreated as in A. Then, cells were stimulated with 1μg/ml of LPS for 4 h. Total cellular RNAs were isolated, and theTNFAandGAPDHmRNA levels were analyzed using qPCR. (C) Cells were pretreated as in A and stimulated with 1μg/ml of LPS for the indicated times. The secretion levels of IL-8 in culture supernatants were measured by ELISA. (D) Cells were pretreated as in A and stimulated with 1μg/ml of LPS for indicated times.
Total cellular RNAs were isolated and theIL-8andGAPDHmRNA levels were analyzed using qPCR. Each experiment was repeated more than three times with essentially the same results.
Fig. 3.SA does not affect LPS-induced NF-κB activation. THP-1 cells were pretreated with PBS or 10μg/ml of SA for 12 h. Cells were then stimulated with 1μg/ml of LPS for the indicated times. Then, cell lysates were collected, and the levels of (phospho-)IκB (A) and (phospho-)p65 (B) were measured by Western blot analysis. The protein levels ofβ-actin were also measured as an internal control. Each experiment was repeated more than three times with essentially the same results.
induced by type I/II IFNs and LPS[18,54,55].
STAT1 is one of the common regulators of the expression of MCP-1, MCP-2, and CXCL10. STAT1 has been reported to be involved in regulating MCP-1 expression in cells treated with plasmin[33], TNF- α[34], and IFN-γ[35]. In addition, high STAT1 levels were found to be correlated with high serum MCP-1 levels in patients with systemic lupus erythematosus [36] and the suppression of STAT1 activation was correlated with the down-regulation of MCP-1 in a mouse model of diabetic nephropathy [37]. Through electrophoretic mobility shift assay and chromatin immunoprecipitation in mouse and human macrophage cells, it has been demonstrated that STAT1 binds to the IFN-γ-activated sites on the promoters of responsive genes. In addition, mutation of STAT1 phosphorylation sites or mutation of its upstream
regulator Janus Kinase (JAK) resulted in a significant suppression of MCP-1 expression after IFN-γtreatment[56]. Sodium azide exerted its inhibitory effect through the suppression of STAT1 activity.
Since suppressor of cytokine signaling (SOCS)-1 is a negative feedback regulator of the JAK-STAT pathway[57], it is possible that NaN3regulates STAT1 activation through SOCS-1. Western blot analy- sis showed that SOCS-1 levels were not affected by NaN3 (data not shown). Since IFN-γstimulates MCP-1 expression through the JAK/
STAT pathway, it is possible that the suppressive effect of NaN3was possible through the regulation of IFN-γexpression. Our results showed that NaN3treatment did not reduce LPS-induced IFN-γexpression (data not shown). The mechanism responsible for the suppression of STAT1 activity in cells treated with NaN3is not known and could be the subject Fig. 4.SA inhibits the LPS-induced activation of signal transducer and activator of transcription (STAT)1. (A) THP-1 cells were pretreated with PBS or 10μg/ml of SA 1 h. Cells were then stimulated with 1μg/ml of LPS for the indicated times. Cell lysates were then collected, and the levels of (phospho-)STAT1 andβ-actin were measured by Western blot analysis. (B) The experiment in A was repeated 3 times and the relative densities of phospho-STAT1 to STAT1 were quantified using densitometry (*p < 0.05,**< 0.01). (C–D) THP-1 cells were pretreated with 10μg/ml of SA for 1 h. Then, the cells were stimulated with 1μg/ml of LPS for 12 h. Total cellular RNAs were isolated, and the mRNA levels of MCP-2 (C), CXCL10 (D), and GAPDH were analyzed using qPCR. Each experiment was repeated more than three times with essentially the same results.
Fig. 5.SA suppresses LPS-induced IκBζexpression. (A) THP-1 cells were pretreated with PBS or 10μg/ml of SA for 1 h. The cells were then stimulated with 1μg/ml of LPS for the indicated times. Then, cell lysates were collected, and the levels of protein were measured by Western blot analysis. (B) The experiment in A was repeated 3 times, and the relative densities of IκBζtoβ-actin were quantified using densitometry (**p < 0.01,***< 0.001). (C) Cells were pretreated as in A. Then, cells were stimulated with 1μg/ml of LPS for the indicated times. Total cellular RNAs were isolated and theIL-6andGAPDHmRNA levels were analyzed using qPCR. Each experiment was repeated more than three times with essentially the same results.
consequently, that of down-stream genes such asMCP-1andIL-6.
In order to understand the full scope of cellular response after sodium azide treatment, THP-1 cells were treated with LPS and/or sodium azide and the gene expression pattern was analyzed using microarray. Results confirmed the suppression of chemokine expression after sodium azide treatment (data not shown). Interestingly, sodium azide treatment also induced genes involved in ER stress (CHOP, ATF6, GADD34, EIF2α, etc). Preliminary analysis indicated that sodium azide treatment also induced activation of ER-stress related signaling mole- cules such as PERK and IRE- α (our unpublished observations).
However, sodium azide-induced ER stress was not involved in the suppression of chemokine expression since pharmacological inhibition of ER stress failed to block the effect of sodium azide on chemokine expression in THP-1 cells.
Chemokines including MCP-1 are involved in the pathogenesis of multiple forms of inflammatory disorders including atherosclerosis, rheumatoid arthritis, glomerulonephritis, sepsis, and inflammatory bowel disease. Efficient regulation of the expression of these chemo- kines is expected to be beneficial for the treatment of these inflamma- tory disorders. NaN3 treatment resulted in the suppression of the expression of several pro-inflammatory chemokines and cytokines such as MCP-1, MCP-2, CXCL10, and IL-6. Further analysis of the mechanism responsible for this NaN3-mediated suppression of inflammatory signal- ing and the identification of the key molecule(s) involved in this regulation is expected to be beneficial for the efficient treatment of inflammatory diseases.
Acknowledgments
This research was supported by Kyungpook National University– Republic of Korea Research Fund, 2016.
References
[1] J.D. Graham, Actions of sodium azide, Br. J. Pharmacol. Chemother. 4 (1949) 1–6.
[2] S. Chang, S.H. Lamm, Human health effects of sodium azide exposure: a literature review and analysis, Int. J. Toxicol. 22 (2003) 175–186.
[3] A.N. Swafford Jr., I.N. Bratz, J.D. Knudson, P.A. Rogers, J.M. Timmerman, J.D. Tune, G.M. Dick, C-reactive protein does not relax vascular smooth muscle:
effects mediated by sodium azide in commercially available preparations, Am. J.
Physiol. Heart Circ. Physiol. 288 (2005) H1786–H1795.
[4] E. Qamirani, H.M. Razavi, X. Wu, M.J. Davis, L. Kuo, T.W. Hein, Sodium azide dilates coronary arterioles via activation of inward rectifier K+ channels and Na +-K+-ATPase, Am. J. Physiol. Heart Circ. Physiol. 290 (2006) H1617–H1623.
[5] M.J. Delgado-Cortes, A.M. Espinosa-Oliva, M. Sarmiento, S. Arguelles, A.J. Herrera, R. Maurino, R.F. Villaran, J.L. Venero, A. Machado, R.M. de Pablos, Synergistic deleterious effect of chronic stress and sodium azide in the mouse hippocampus, Chem. Res. Toxicol. 28 (2015) 651–661.
[6] S. Marino, L. Marani, C. Nazzaro, L. Beani, A. Siniscalchi, Mechanisms of sodium azide-induced changes in intracellular calcium concentration in rat primary cortical neurons, Neurotoxicology 28 (2007) 622–629.
[7] R. Selvatici, M. Previati, S. Marino, L. Marani, S. Falzarano, I. Lanzoni, A. Siniscalchi, Sodium azide induced neuronal damage in vitro: evidence for non-
[16] E. Vergadi, E. Ieronymaki, K. Lyroni, K. Vaporidi, C. Tsatsanis, Akt signaling pathway in macrophage activation and M1/M2 polarization, J. Immunol. 198 (2017) 1006–1014.
[17] S. Jovinge, M.P. Ares, B. Kallin, J. Nilsson, Human monocytes/macrophages release TNF-alpha in response to Ox-LDL, Arterioscler. Thromb. Vasc. Biol. 16 (1996) 1573–1579.
[18] Y. Ohmori, T.A. Hamilton, A macrophage LPS-inducible early gene encodes the murine homologue of IP-10, Biochem. Biophys. Res. Commun. 168 (1990) 1261–1267.
[19] H.H. Shin, H.W. Lee, H.S. Choi, Induction of nitric oxide synthase (NOS) by soluble glucocorticoid induced tumor necrosis factor receptor (sGITR) is modulated by IFN- gamma in murine macrophage, Exp. Mol. Med. 35 (2003) 175–180.
[20] R.D. Stout, J. Suttles, T cell signaling of macrophage function in inflammatory disease, Front. Biosci. 2 (1997) d197–d206.
[21] H. Lu, W. Ouyang, C. Huang, Inflammation, a key event in cancer development, Mol. Cancer Res. 4 (2006) 221–233.
[22] A. Mantovani, P. Allavena, A. Sica, F. Balkwill, Cancer-related inflammation, Nature 454 (2008) 436–444.
[23] P. Libby, Y.-J. Geng, M. Aikawa, U. Schoenbeck, F. Mach, S.K. Clinton, G.K. Sukhova, R.T. Lee, Macrophages and atherosclerotic plaque stability, Curr.
Opin. Lipidol. 7 (1996) 330–335.
[24] O. Kutuk, H. Basaga, Inflammation meets oxidation: NF-kappaB as a mediator of initial lesion development in atherosclerosis, Trends Mol. Med. 9 (2003) 549–557.
[25] P.K. Shah, Role of inflammation and metalloproteinase in plaque disruption and thrombosis, Vasc. Med. 3 (1998) 199–206.
[26] W.J. Kim, M.Y. Lee, J.H. Kim, K. Suk, W.H. Lee, Decursinol angelate blocks transmigration and inflammatory activation of cancer cells through inhibition of PI3K, ERK and NF-kappaB activation, Cancer Lett. 296 (2010) 35–42.
[27] J.K. Kim, S.M. Lee, K. Suk, W.H. Lee, A novel pathway responsible for lipopoly- saccharide-induced translational regulation of TNF-alpha and IL-6 expression involves protein kinase C and fascin, J. Immunol. 187 (2011) 6327–6334.
[28] R.T. Palframan, S. Jung, G. Cheng, W. Weninger, Y. Luo, M. Dorf, D.R. Littman, B.J. Rollins, H. Zweerink, A. Rot, U.H. von Andrian, Inflammatory chemokine transport and presentation in HEV: a remote control mechanism for monocyte recruitment to lymph nodes in inflamed tissues, J. Exp. Med. 194 (2001) 1361–1373.
[29] M. Takahashi, C. Galligan, L. Tessarollo, T. Yoshimura, Monocyte chemoattractant protein-1 (MCP-1), not MCP-3, is the primary chemokine required for monocyte recruitment in mouse peritonitis induced with thioglycollate or zymosan A, J.
Immunol. 183 (2009) 3463–3471.
[30] M. Pasparakis, L. Alexopoulou, V. Episkopou, G. Kollias, Immune and inflammatory responses in TNF alpha-deficient mice: a critical requirement for TNF alpha in the formation of primary B cell follicles, follicular dendritic cell networks and germinal centers, and in the maturation of the humoral immune response, J. Exp. Med. 184 (1996) 1397–1411.
[31] M.L. Lennard Richard, T.K. Nowling, D. Brandon, D.K. Watson, X.K. Zhang, Fli-1 controls transcription from the MCP-1 gene promoter, which may provide a novel mechanism for chemokine and cytokine activation, Mol. Immunol. 63 (2015) 566–573.
[32] J.M. Weiss, C.A. Cuff, J.W. Berman, TGF-beta downmodulates cytokine-induced monocyte chemoattractant protein (MCP)-1 expression in human endothelial cells.
A putative role for TGF-beta in the modulation of TNF receptor expression, Endothelium 6 (1999) 291–302.
[33] L. Burysek, T. Syrovets, T. Simmet, The serine protease plasmin triggers expression of MCP-1 and CD40 in human primary monocytes via activation of p38 MAPK and janus kinase (JAK)/STAT signaling pathways, J. Biol. Chem. 277 (2002) 33509–33517.
[34] T. Aomatsu, H. Imaeda, K. Takahashi, T. Fujimoto, E. Kasumi, A. Yoden, H. Tamai, Y. Fujiyama, A. Andoh, Tacrolimus (FK506) suppresses TNF-alpha-induced CCL2 (MCP-1) and CXCL10 (IP-10) expression via the inhibition of p38 MAP kinase activation in human colonic myofibroblasts, Int. J. Mol. Med. 30 (2012) 1152–1158.
[35] S. Roth, M.R. Spalinger, I. Muller, S. Lang, G. Rogler, M. Scharl, Bilberry-derived
anthocyanins prevent IFN-gamma-induced pro-inflammatory signalling and cyto- kine secretion in human THP-1 monocytic cells, Digestion 90 (2014) 179–189.
[36] P.R. Dominguez-Gutierrez, A. Ceribelli, M. Satoh, E.S. Sobel, W.H. Reeves, E.K. Chan, Elevated signal transducers and activators of transcription 1 correlates with increased C-C motif chemokine ligand 2 and C-X-C motif chemokine 10 levels in peripheral blood of patients with systemic lupus erythematosus, Arthritis Res.
Ther. 16 (2014) R20.
[37] Y. Shi, C. Du, Y. Zhang, Y. Ren, J. Hao, S. Zhao, F. Yao, H. Duan, Suppressor of cytokine signaling-1 ameliorates expression of MCP-1 in diabetic nephropathy, Am.
J. Nephrol. 31 (2010) 380–388.
[38] R. Mariman, F. Tielen, F. Koning, L. Nagelkerken, The probiotic mixture VSL#3 dampens LPS-induced chemokine expression in human dendritic cells by inhibition of STAT-1 phosphorylation, PLoS One 9 (2014) e115676.
[39] S. Chmielewski, A. Olejnik, K. Sikorski, J. Pelisek, K. Blaszczyk, C. Aoqui, H. Nowicka, A. Zernecke, U. Heemann, J. Wesoly, M. Baumann, H.A. Bluyssen, STAT1-dependent signal integration between IFNgamma and TLR4 in vascular cells reflect pro-atherogenic responses in human atherosclerosis, PLoS One 9 (2014) e113318.
[40] G. Totzke, F. Essmann, S. Pohlmann, C. Lindenblatt, R.U. Janicke, K. Schulze- Osthoff, A novel member of the IkappaB family, human IkappaB-zeta, inhibits transactivation of p65 and its DNA binding, J. Biol. Chem. 281 (2006) 12645–12654.
[41] D.G. Hildebrand, E. Alexander, S. Horber, S. Lehle, K. Obermayer, N.A. Munck, O. Rothfuss, J.S. Frick, M. Morimatsu, I. Schmitz, J. Roth, J.M. Ehrchen, F. Essmann, K. Schulze-Osthoff, IkappaBzeta is a transcriptional key regulator of CCL2/MCP-1, J. Immunol. 190 (2013) 4812–4820.
[42] S.T. Smale, Selective transcription in response to an inflammatory stimulus, Cell 140 (2010) 833–844.
[43] M. Zimmermann, F. Arruda-Silva, F. Bianchetto-Aguilera, G. Finotti, F. Calzetti, P. Scapini, C. Lunardi, M.A. Cassatella, N. Tamassia, IFNalpha enhances the production of IL-6 by human neutrophils activated via TLR8, Sci. Rep. 6 (2016) 19674.
[44] J. Lorenz, J. Zahlten, I. Pollok, J. Lippmann, S. Scharf, P.D. N'Guessan, B. Opitz, A. Flieger, N. Suttorp, S. Hippenstiel, B. Schmeck, Legionella pneumophila-induced IκBζ-dependent expression of interleukin-6 in lung epithelium, Eur. Respir. J. 37 (2011) 648–657.
[45] M. Yamamoto, S. Yamazaki, S. Uematsu, S. Sato, H. Hemmi, K. Hoshino, T. Kaisho, H. Kuwata, O. Takeuchi, K. Takeshige, T. Saitoh, S. Yamaoka, N. Yamamoto, S. Yamamoto, T. Muta, K. Takeda, S. Akira, Regulation of Toll/IL-1-receptor- mediated gene expression by the inducible nuclear protein IκBζ, Nature 430 (2004) 218–222.
[46] S.W. Chensue, K.S. Warmington, J.H. Ruth, P.S. Sanghi, P. Lincoln, S.L. Kunkel, Role of monocyte chemoattractant protein-1 (MCP-1) in Th1 (mycobacterial) and Th2 (schistosomal) antigen-induced granuloma formation: relationship to local inflammation, Th cell expression, and IL-12 production, J. Immunol. 157 (1996) 4602–4608.
[47] E.J. Leonard, T. Yoshimura, Human monocyte chemoattractant protein-1 (MCP-1), Immunol. Today 11 (1990) 97–101.
[48] A.W. Bossink, L. Paemen, P.M. Jansen, C.E. Hack, L.G. Thijs, J. Van Damme, Plasma levels of the chemokines monocyte chemotactic proteins-1 and -2 are elevated in human sepsis, Blood 86 (1995) 3841–3847.
[49] Y. Jiang, D.I. Beller, G. Frendl, D.T. Graves, Monocyte chemoattractant protein-1
regulates adhesion molecule expression and cytokine production in human mono- cytes, J. Immunol. 148 (1992) 2423–2428.
[50] S.L. Deshmane, S. Kremlev, S. Amini, B.E. Sawaya, Monocyte chemoattractant protein-1 (MCP-1): an overview, J. Interferon Cytokine Res. 29 (2009) 313–326.
[51] C. Daly, B.J. Rollins, Monocyte chemoattractant protein-1 (CCL2) in inflammatory disease and adaptive immunity: therapeutic opportunities and controversies, Microcirculation 10 (2003) 247–257.
[52] M. Baggiolini, B. Dewald, B. Moser, Interleukin-8 and related chemotactic cytokines–CXC and CC chemokines, Adv. Immunol. 55 (1994) 97–179.
[53] E. Van Coillie, I. Van Aelst, P. Fiten, A. Billiau, J. Van Damme, G. Opdenakker, Transcriptional control of the human MCP-2 gene promoter by IFN-gamma and IL- 1beta in connective tissue cells, J. Leukoc. Biol. 66 (1999) 502–511.
[54] M. Loetscher, B. Gerber, P. Loetscher, S.A. Jones, L. Piali, I. Clark-Lewis, M. Baggiolini, B. Moser, Chemokine receptor specific for IP10 and mig: structure, function, and expression in activated T-lymphocytes, J. Exp. Med. 184 (1996) 963–969.
[55] A.D. Luster, J.C. Unkeless, J.V. Ravetch, Gamma-interferon transcriptionally regulates an early-response gene containing homology to platelet proteins, Nature 315 (1985) 672–676.
[56] C.V. Ramana, M.P. Gil, R.D. Schreiber, G.R. Stark, Stat1-dependent and -indepen- dent pathways in IFN-gamma-dependent signaling, Trends Immunol. 23 (2002) 96–101.
[57] Y. Morita, T. Naka, Y. Kawazoe, M. Fujimoto, M. Narazaki, R. Nakagawa, H. Fukuyama, S. Nagata, T. Kishimoto, Signals transducers and activators of transcription (STAT)-induced STAT inhibitor-1 (SSI-1)/suppressor of cytokine signaling-1 (SOCS-1) suppresses tumor necrosis factor alpha-induced cell death in fibroblasts, Proc. Natl. Acad. Sci. U.S.A. 97 (2000) 5405–5410.
[58] S. Yamazaki, T. Muta, S. Matsuo, K. Takeshige, Stimulus-specific induction of a novel nuclear factor-kappaB regulator, IkappaB-zeta, via Toll/Interleukin-1 recep- tor is mediated by mRNA stabilization, J. Biol. Chem. 280 (2005) 1678–1687.
[59] S. Yamazaki, T. Muta, K. Takeshige, A novel IkappaB protein, IkappaB-zeta, induced by proinflammatory stimuli, negatively regulates nuclear factor-kappaB in the nuclei, J. Biol. Chem. 276 (2001) 27657–27662.
[60] H. Kayama, V.R. Ramirez-Carrozzi, M. Yamamoto, T. Mizutani, H. Kuwata, H. Iba, M. Matsumoto, K. Honda, S.T. Smale, K. Takeda, Class-specific regulation of pro- inflammatory genes by MyD88 pathways and IkappaBzeta, J. Biol. Chem. 283 (2008) 12468–12477.
[61] K. Okamoto, Y. Iwai, M. Oh-Hora, M. Yamamoto, T. Morio, K. Aoki, K. Ohya, A.M. Jetten, S. Akira, T. Muta, H. Takayanagi, IkappaBzeta regulates T(H)17 development by cooperating with ROR nuclear receptors, Nature 464 (2010) 1381–1385.
[62] T. Miyake, T. Satoh, H. Kato, K. Matsushita, Y. Kumagai, A. Vandenbon, T. Tani, T. Muta, S. Akira, O. Takeuchi, IkappaBzeta is essential for natural killer cell activation in response to IL-12 and IL-18, Proc. Natl. Acad. Sci. U.S.A. 107 (2010) 17680–17685.
[63] F. Hanihara, Y. Takahashi, A. Okuma, T. Ohba, T. Muta, Transcriptional and post- transcriptional regulation of IkappaB-zeta upon engagement of the BCR, TLRs and FcgammaR, Int. Immunol. 25 (2013) 531–544.
[64] A. Okuma, K. Hoshino, T. Ohba, S. Fukushi, S. Aiba, S. Akira, M. Ono, T. Kaisho, T. Muta, Enhanced apoptosis by disruption of the STAT3-IkappaB-zeta signaling pathway in epithelial cells induces Sjogren's syndrome-like autoimmune disease, Immunity 38 (2013) 450–460.
