In conclusion, all selected phage-displayed peptides showed high binding selectivity but negative antibacterial activity towards P. Phage-displayed peptide against Pseudomonas aeruginosa 37 4.4 Antibacterial activity of phage-displayed peptides 45 4.5 Purity of the extracted phage genomic DNA 49.
Characteristics of Pseudomonas aeruginosa
Clinical Significant of Pseudomonas aeruginosa
Patients admitted to the Intensive Care Unit (ICU) also have a high probability of being infected by P . In addition, implantation of prosthetic heart valves and organ transplantation also increase the risk of hospital-acquired infections.
Multidrug Resistant in Pseudomonas aeruginosa
In addition, carbapenem-resistant strains producing imipenem-type metallo-β-lactamases have been reported (Senda et al., 1996). Antibiotic susceptibility is significantly reduced under anaerobes and the presence of biofilm (Hill et al., 2005).
Alternative Treatments for Pseudomonas aeruginosa Infections Several alternative treatments for multidrug resistant P. aeruginosa infections
Therefore, combination antibiotics are not the best solution for multidrug-resistant bacterial infection. Unlike antibiotics, the antibacterial peptide possesses completely different modes of killing action against bacteria (Ulvatne et al., 2001).
Antibacterial Peptides
Origin of Antibacterial Peptides
This is indicated by the growth of bacteria when an additional antibiotic is added to a previously bactericidal single antibiotic or a combination of antibiotics (Hill et al., 2005). 9 neutrophils, dendritic cells and monocytes/macrophages to rapidly neutralize a wide range of bacteria (Wetering et al., 2004).
Physiochemical Properties of Antibacterial Peptides
At slightly higher concentrations, antibacterial peptides exhibit a direct chemokine activity by interacting with the chemokine receptor of host immune cells (Tjabringa et al., 2006). At low to modest concentrations, antibacterial peptides can promote chemotaxis indirectly by stimulating the production of chemokines (Bowdish et al., 2005).
Strategies for Antibacterial Peptides Isolation and Development Lee (2002) had proposed a few steps for developing a potent, short
14 In addition to chemotactic activity, antibacterial peptides also promote other immunological aspects by inducing cellular differentiation and proliferation, prolonging the lifespan of neutrophils by suppressing apoptosis, activation and degranulation of mast cells, wound repair, stimulation of angiogenesis, and the ability of dendritic cells to absorb, enhance and present antigen (Davidson et al., 2004; Koczulla et al., 2003; Chen et al., 2006; Nagaoka et al., 2006).
Phage-Displayed Peptide Library
- Background and Principles of Phage-Displayed Peptide Library Phage display is pioneered by Smith (1985), who had great interest in
- Ph.D 12 Peptide Library
- Applications of Phage Display Technology in Antibacterial Peptide Discovery
- Advantages of using Phage-Displayed Peptide Library for Screening of Antibacterial Peptide
Phage display is not applicable to larger polypeptides in which fusions can lead to deleterious effects on coat protein function (Christensen et al., 2001). These few studies showed that phage display technology is a very potential tool for the isolation of antibacterial peptides.
General Experimental Design
Bacterial Strains
It was grown on Luria agar supplemented with tetracycline (20 mg/ml in 1:1 ethanol:water) and incubated overnight at 37ºC. It was incubated overnight at 37ºC and kept as a master culture at 4ºC after cultivation. The master culture can keep for a week and new master culture must be maintained to ensure the freshness of the colonies.
Phage-Displayed Peptide Library
Protocols
- Bacterial Glycerol Stock Preparation
- Bacterial Growth Curve Generation
- Affinity Selection
- Bacteria Suspension Preparation
- Phage Display Peptide Library Dilution
- Phage Amplification
- Phage Titering
- Individual Phage Clones Stock Preparation
- Bacterial Binding Selectivity Test
- Antibacterial Assay
- DNA Extraction and Sequencing
- Sequence Analysis
Bacterial growth curve was plotted as measured in OD600 and bacterial titer (CFU/ml). One hundred microliters of serially diluted bacteria were plated on MacConkey agar to determine the bacterial titer. Ten microliters of the phage eluate was titrated and the remaining phages were amplified to enrich phage clones for subsequent rounds of biopanning.
The suspended phage was centrifuged for five minutes and the 80% of the upper supernatant (800 µl) was transferred into a fresh microcentrifuge tube filled with 150 µl PEG/NaCl. Once the OD600 of the bacteria has reached its mid-log phase (about 0.5), the bacteria can be used for phage infection. However, instead of the additive phage eluate, 100 µl of individual phage clone stock was added to 20 ml of diluted bacterial culture.
The sample well having a lower OD600 value than the corresponding control well indicated antibacterial effect of the individual phage clone.
Bacterial Growth Curve
The selection yield (Table 4.2) of phages for each round of biopanning was calculated as a percentage of the output titer divided by the input titer. This indicated that only a certain number of input phage was selected in the biopanning. The selectivity of phage display peptide binding to bacteria was calculated based on the ratio of the OD405 of the sample to the OD405 reading of the negative control.
All 70 selected phage-displayed peptide clones did not show any antibacterial activity against P. The DNA of clone 4PA8 was poorly sequenced as shown in Figure 4.9(e), resulting in unsuccessful identification of the inserted oligonucleotide region. However, the DNA sequence possessed a deletion of library insert nucleotides (ACCTCCACC) and oligonucleotides located in the region of the peptide insert, which is indicated by dashes in the sequence alignment as shown in Figure 4.10.
ATGGGATTTTGCTAAACAACTTTCAACAGTTTCGGCCGA', which is part of the phage genome located upstream of the insert of interest, is highlighted in yellow in the sequence alignment (Figure 4.10). 53 Figure 4.9: Electropherogram of DNA sequence of oligonucleotides with inserted phages (yellow region) encoding the shown peptides. The number of phage clones that selectively bind to bacteria increases after each round of biopanning.
Binding Selectivity of Phage-Displayed Peptide to Pseudomonas aeruginosa
This may be due to saturation of phage clone enrichment after four rounds of biopanning. 59 increase the binding strength of the phage clone to bacteria, but only enrich the pool of phage clones with high binding affinity and selectivity. This is due to the random selection of phage clones from the titer plates, which may have selected phage clones with different binding affinities.
Individual phage clones were randomly selected from an IPTG/Xgal plate with approximately 100 plate forming units of phage clones. From 105 PFU/ml of phage clones, only a small fraction of phage clones were selected in which 40 clones from the third round and 30 clones from the fourth round eluate. The binding selectivity ratio decreased when the OD405 of the negative control was high (OD405 > 1).
The background signal in the negative control may be due to a certain number of the phage clones having bound to the bovine serum albumin (BSA) coated in the negative control well.
Assay on Antibacterial Activity by Selected Phage-Displayed Peptides
61 and Varma (2009) suggested that polyvalently displayed peptide on pIII may lead to steric hindrance that reduces the binding of the peptide to the bacteria. As the concentration of Tween 20 increased in subsequent rounds of biopanning, more phage-displayed peptides with low binding affinity to the bacteria would be washed away. This indicates that binding affinity of peptide displayed by phage to the bacteria does not directly correlate with the antibacterial activity (Soares et al., 2004).
This alginate slime layer can capture and reduce the number of phage-displayed peptides that bind to the bacteria during biopanning. Phage clones with high binding affinity to the bacteria membrane can be washed away as complexes with the bacteria alginate during the biopanning. In addition, the alginate acts as a sticky layer covering the outer membrane surface of the bacteria.
Therefore, it is possible that two-component regulators are activated to protect bacteria from antibacterial action.
Strong Binding Affinity of Phage-Displayed Peptides
Proteolytic degradation disrupts the conserved region of the antibacterial peptides and renders them unable to bind to the bacterial membrane thereby disabling their antibacterial activity. In this study, two phage-displayed peptides, 4PA4 and 4PA8 with the GLHTSATNLYLH peptide also possess this Asn-Leu region. Therefore, the undetected antibacterial activity of 4PA4 and 4PA8 may be due to elastase degradation in the Asn-Leu region of the peptide.
65 antibacterial peptides for bacteria can cover membrane adhesion molecules on the surface membrane of bacteria, thus blocking the adhesion and colonization of bacteria on the host cell surface (Tsai et al., 2011). In addition, antibacterial peptides have an anti-endotoxin effect by inhibiting the excessive inflammatory reaction that causes serious tissue damage. Binding of antibacterial peptides to lipopolysaccharide (LPS) can block the interaction between LPS and LPS binding protein (LBP), thereby preventing LPS-induced macrophage activation (Hancock and Scott, 2000; Scott et al., 2000).
As a result, antibacterial peptides antagonize massive cytokine release from macrophages, thereby balancing and regulating proper inflammatory response.
DNA Extraction and Sequencing
66 clone 3PA28, no oligonucleotide was found in the region encoding the phage-displayed peptide. Additionally, individual phage clones were amplified on a small scale for 4½ hours for stock production and amplified for another 4½ hours for DNA extraction resulting in 9 hours of incubation time in total. According to New England Biolabs, long incubation times may result in deletion of the inserted oligonucleotide of some phage clones.
In contrast, clone 4PA8 showed a weak and noisy sequence in the DNA sequencing electropherogram, which may be due to insufficient DNA concentration or presence of contaminants from the surrounding environment.
Evaluation of Peptide Sequence
67 possible amino acid residues indicates the probability that these amino acid residues contribute to the strong binding to the bacteria. In addition, diversity of the two peptide sequences suggested that not all amino acid residues were involved in bacterial binding. Hydrophobic amino acids are essential for nonpolar interaction with the hydrophobic core of the lipid bilayer of a bacterial plasma membrane to drive the biological activity of the peptide (Oren et al., 2002).
In addition, a relatively low hydrophobicity of the peptide may prevent the self-association of the peptide, impeding the passage of the peptide across the membrane (Chen et al., 2007). Similarly, both peptides GPVNKSSTILRM and GLHTSATNLYLH also consist of a glycine residue at the peptide N-terminus. In addition, Lee et al. 2002) also suggested that glycine incorporation at the N-terminus may protect the peptide against loss of helicity.
Therefore, both peptides GPVNKSSTILRM and GLHTSATNLYLH with N-terminal glycine residues may be the potential antibacterial peptides against P.
Future Studies
In this study, selected phage-displayed peptides showed high binding selectivity to Pseudomonas aeruginosa. Activity of de novo designed antimicrobial peptide WLBU2 against Pseudomonas aeruginosa in human serum and whole blood: implications for systemic applications. Adaptive resistance to the "last hope" antibiotics polymyxin B and colistin in Pseudomonas aeruginosa is mediated by the novel ParR-ParS two-component regulatory system.
Antibiotic susceptibility of Pseudomonas aeruginosa isolates from patients with cystic fibrosis under aerobic, anaerobic and biofilm conditions. Penicillin-binding proteins, porins and outer membrane permeability of carbenicillin-resistant and susceptible strains of Pseudomonas aeruginosa. PmrAB, a two-component regulatory system of Pseudomonas aeruginosa that modulates resistance to cationic antimicrobial peptides and the addition of aminoarabinose to lipid A.
National surveillance of antimicrobial resistance in Pseudomonas aeruginosa isolates obtained from intensive care unit patients from 1993 to 2002.
