Bacterial Growth Curve - screening and isolation of antibacterial peptide

Bacterial growth curve for P. aeruginosa was constructed based on the OD₆₀₀ reading and bacterial titer in CFU/ml. The OD600 and bacterial titer (CFU/ml) of P. aeruginosa at various time intervals were tabulated in Table 4.1 and the growth curves were plotted as shown in Figure 4.1. The curve in blue line shows the increment of OD600 reading over the time. The bacteria grew exponentially from the first hour to the third hour, and growth of the bacteria was reduced from the fourth hour. On the other hand, the growth curve in bacterial titer (CFU/ml) is represented by the red line in Figure 4.1. The growth trend in bacterial titer was not coincided with the trend in OD600 where lag phase was presented in the first two hours and exponential phase happened from the second to the fourth hour. Nevertheless, both results showed that the bacteria reached to titer of 10⁹ CFU/ml after 4½ hours, which is the sufficient titer for biopanning.

33 Table 4.1: The OD₆₀₀ reading and bacterial titer (CFU/ml) of P. aeruginosa at various time intervals.

Time (hours) OD600 Bacteria Titer (CFU/ml)

1 0.218 1.19 x 10⁸

2 0.689 1.33 x 10⁸

3 1.266 9.80 x10⁸

4 1.438 3.70 x 10⁹

4.5 1.502 4.10 x 10⁹

34 Figure 4.1: Growth curve of P. aeruginosa throughout 4½ hours as measured in OD600 and bacterial titer (CFU/ml).

0 0.5 1 1.5 2 2.5 3 3.5 4 4.5

0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6

0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 5

OD600 Bacteria Titer (CFU/ml)

OD₆₀₀ Bacteria Titer

(x 10⁹cfu/ml)

Time (Hours) OD₆₀₀

35 4.2 Selection of Phage-Displayed Peptides Binding to Pseudomonas

aeruginosa

Figure 4.2 shows the titer of eluted phage from the biopanning. The blue plaque forming units indicate that the affinity-selected phages from the biopanning were derived from the library with special lac Z α gene insertion.

At the same time, the titer plate suggested that the phage eluate had no contaminant as no colourless plaque was seen.

According to Table 4.2, the ouput titer, which was also the phage eluate titer, was ranged in between 10⁵-10⁶ PFU/ml over the four rounds of biopanning.

The eluted phage from the first round of biopanning had the lowest input titer with 1.23 x 10⁵ PFU/ml while the eluted phage from the third round of biopanning had the highest output titer which is 1.6 x 10⁶PFU/ml. This indicated that the output titer was increased from the first round to the third round of biopanning and decreased in the fourth round of biopanning. On the other hand, input titer was maintained at 10¹¹-10¹² PFU/ml throughout the four rounds of biopanning.

The yield of selection (Table 4.2) of phages for each round of biopanning was calculated as the percentage of the output titer divided by the input titer. It was maintained in between the percentage of 10^-6 and 10^-7. This indicated that only certain numbers of the input phage was being selected in the biopanning. The yield of selection was increased from the first round (1.23 x 10^-7%) to the third round (1.86 x 10^-6%) of biopanning and then decreased at the fourth round (4.2 x 10^-8%) of biopanning. Lastly, a total of 70 individual phage clones were

36 randomly selected from the third and the fourth round of biopanning for subsequent assays.

Figure 4.2: Phage titer of eluted phage on IPTG/Xgal plate. Figure (A) shows the phage titer with 10^-1dilution, and Figure (B) shows the phage titer with 10^-2dilution where the phage titer was 10⁵ PFU/ml.

Table 4.2: Yield of selection for four rounds of biopanning.

Rounds of biopanning

Input titer (PFU/ml)

Output titer (PFU/ml)

Yield of Selection^a (%)

1 1 x 10¹² 1.23 x 10⁵ 1.23 x 10^-7

2 4.9 x 10¹¹ 4.6 x 10⁵ 9.39 x 10^-7

3 8.6 x 10¹¹ 1.6 x 10⁶ 1.86 x 10^-6

4 8.3 x 10¹² 3.5 x 10⁵ 4.2 x 10^-8

aYield of Selection (%) was calculated by the formula: [(Output titer / Input titer) x 100%].

(B) (A)

37 4.3 Determination of Binding Selectivity of Phage-Displayed Peptide to

Pseudomonas aeruginosa

Figure 4.3 shows the colour development in negative control and sample well after 20 minutes of incubation with ABTS substrate. The negative control wells were in very light green colour while the sample wells were in green colour with varying intensities. This indicated that greater numbers of phage displaying peptides bound to the sample well that were coated with the target bacteria compared to the negative control well that only filled with bovine serum albumin (BSA) blocking buffer. The binding of phage-displayed peptides toward the target bacteria was indicated by OD₄₀₅ reading which is shown in Figure 4.4 and 4.5. All of the samples showed higher OD405 compare to their corresponding negative control. The OD405 reading of all the negative controls was less than 0.2. Phage clone 3PA34 demonstrated the highest OD₄₀₅ reading at 2.5338 while phage clone 4PA13 had the lowest OD405 reading at 0.8021. The binding selectivity of phage displaying peptides to the bacteria was calculated based on the ratio of the sample OD405 to the negative control OD405 reading. Phage clone 3PA26 showed the highest binding selectivity ratio of 29.13 among the 40 clones selected from the third round of biopanning.

Additionally, phage clone 4PA4 showed the highest binding selectivity ratio of 22.84 compare to other selected clones from the fourth round of biopanning. In contrast, phage clone 4PA24 demonstrated the lowest binding selectivity ratio of 5.47. Nevertheless, most of the clones showed a relatively high binding selectivity towards P. aeruginosa with the ratio ranging from 10 to 20.

38 Figure 4.3: Development of colour in negative control and sample wells after 20 minutes ABTS substrate incubation. Row A shows negative control wells while Row B shows sample wells.

Row B Row A

Figure 4.4: Bar chart of ELISA reactivity for the selected phage-displayed peptides of phage clones 3PA1 to 3PA40. Negative control represents the wells coated with BSA while sample represents the wells coated with bacteria.

0 0.5 1 1.5 2 2.5 3

3PA1 3PA2 3PA3 3PA4 3PA5 3PA6 3PA7 3PA8 3PA9 3PA10 3PA11 3PA12 3PA13 3PA14 3PA15 3PA16 3PA17 3PA18 3PA19 3PA20 3PA21 3PA22 3PA23 3PA24 3PA25 3PA26 3PA27 3PA28 3PA29 3PA30 3PA31 3PA32 3PA33 3PA34 3PA35 3PA36 3PA37 3PA38 3PA39 3PA40

OD₄₀₅

Phage Clones

Negative Control Sample

Figure 4.5: Bar chart of ELISA reactivity for the selected phage-displayed peptides of phage clones 4PA1 to 4PA30. Negative control represents the wells coated with BSA while sample represents the wells coated with bacteria.

0 0.5 1 1.5 2 2.5

OD₄₀₅

Phage Clones

Negative Control Sample

41 Table 4.3: OD₄₀₅ reading of ELISA reactivity for the selected phage-

displayed peptides and their corresponding ratio of binding selectivity.

aNegative control represents the well coated with BSA.

bSample represents the well coated with bacteria.

cBinding selectivity ratio was calculated by the formula of : (Sample/Negative control).

Phage Clone Negative Control^a (OD405)

Sample^b (OD405)

Binding Selectivity Ratio^c

3PA1 0.1081 1.2663 11.71

3PA2 0.1416 1.5239 10.76

3PA3 0.1287 1.3803 10.72

3PA4 0.1474 1.6736 11.35

3PA5 0.0987 1.0127 10.26

3PA6 0.1118 1.9734 17.65

3PA7 0.1325 1.6958 12.80

3PA8 0.0838 1.596 19.05

3PA9 0.1337 1.7173 12.84

3PA10 0.1354 1.8229 13.46

3PA11 0.0974 1.2591 12.9

3PA12 0.1161 1.9451 16.75

3PA13 0.0983 1.1653 11.85

3PA14 0.1231 1.959 15.91

3PA15 0.0826 1.3174 15.95

3PA16 0.1052 1.7165 16.32

3PA17 0.1361 1.7343 12.74

3PA18 0.1119 2.0089 17.95

3PA19 0.0809 1.7012 21.03

3PA20 0.1628 2.2694 13.94

42 Table 4.3 Continued:

aNegative control represents the well coated with BSA.

bSample represents the well coated with bacteria.

cBinding selectivity ratio was calculated by the formula of : (Sample/Negative control).

Phage Clone Negative Control^a (OD405)

Sample^b (OD405)

Binding Selectivity Ratio^c

3PA21 0.0998 2.2287 22.33

3PA22 0.1117 2.1888 19.60

3PA23 0.1476 1.9952 13.52

3PA24 0.1104 2.2158 20.07

3PA25 0.1091 1.9661 18.02

3PA26 0.0536 1.5612 29.13

3PA27 0.0882 2.1211 24.05

3PA28 0.0524 1.4247 27.19

3PA29 0.0598 1.2562 21.01

3PA30 0.0934 1.9746 21.14

3PA31 0.1592 2.0892 13.12

3PA32 0.1335 2.0899 15.65

3PA33 0.1475 2.3422 15.88

3PA34 0.1237 2.5338 20.48

3PA35 0.0739 1.655 22.40

3PA36 0.0783 1.7885 22.84

3PA37 0.1359 2.1679 15.95

3PA38 0.0996 1.9586 19.66

3PA39 0.1129 1.8445 16.34

3PA40 0.1439 2.3783 16.53

43 Table 4.3 continued:

aNegative control represents the well coated with BSA.

bSample represents the well coated with bacteria.

cBinding selectivity ratio was calculated by the formula of : (Sample/Negative control).

Phage Clone Negative control^a (OD₄₀₅)

Sample^b (OD₄₀₅)

Binding Selectivity Ratio^c

4PA1 0.0959 1.7589 18.34

4PA2 0.0931 1.8637 20.02

4PA3 0.0881 1.8672 21.19

4PA4 0.0786 1.7765 22.60

4PA5 0.0786 1.7516 22.28

4PA6 0.0798 1.6239 20.34

4PA7 0.0779 1.4804 19.00

4PA8 0.0885 1.9642 22.19

4PA9 0.082 1.5394 18.77

4PA10 0.1269 1.9959 15.73

4PA11 0.0766 0.9845 12.85

4PA12 0.0735 1.1419 15.54

4PA13 0.0743 0.8021 10.79

4PA14 0.0776 1.2531 16.15

4PA15 0.0722 1.1111 15.39

4PA16 0.0733 1.1824 16.13

4PA17 0.0727 1.0782 14.83

4PA18 0.0877 1.5374 17.53

4PA19 0.114 1.0721 9.04

4PA20 0.0885 1.5878 17.94

44 Table 4.3 continued:

aNegative control represents the well coated with BSA.

bSample represents the well coated with bacteria.

cBinding selectivity ratio was calculated by the formula of : (Sample/Negative control).

Phage Clone Negative control^a (OD₄₀₅)

Sample^b (OD₄₀₅)

Binding Selectivity Ratio^c

4PA21 0.0863 1.8447 21.38

4PA22 0.0854 0.8821 10.33

4PA23 0.0788 0.8725 11.07

4PA24 0.1965 1.0739 5.47

4PA25 0.077 0.724 9.40

4PA26 0.0794 0.8456 10.65

4PA27 0.0847 1.0479 12.37

4PA28 0.0833 0.8936 10.72

4PA29 0.079 1.1429 14.47

4PA30 0.0825 0.9315 11.29

45 4.4 Antibacterial Activity of Phage-Displayed Peptides

The antibacterial activity of individual phage-displayed peptides was indicated by the lower OD₆₀₀in the sample that harbored the mixture of phage-displayed peptides and P. aeruginosa than the negative control that only harbored the target bacteria only where the OD600 is a measurement of the amount of the bacteria. All of the 70 selected clones of phage-displayed peptides did not exhibit any antibacterial activity towards P. aeruginosa as demonstrated by the higher optical density of the sample than the negative control (Figure 4.6 and 4.7). Although there were a few clones of sample that had an OD600 reading lower than the negative control, but the degree of inhibition were very low.

These clones were 3PA35, 4PA10 and 4PA12 which exhibited the degree of inhibition of 1.67%, 0.88% and 2.30%, respectively (Table 4.4). The low degree of inhibition shown by these clones was insufficient to be concluded as positive antibacterial activity. Therefore, there was no isolation of phage- displayed peptides with antibacterial effect in this study.

Figure 4.6: Bar chart of antibacterial activity of phage clones 3PA1 to 3PA40. Negative control represents the well with only the target bacteria while sample represents the well with phage and bacteria.

0 0.05 0.1 0.15 0.2 0.25 0.3 0.35 0.4 0.45 0.5

OD₆₀₀

Phage Clones

Negative Control Sample

Figure 4.7: Bar chart of antibacterial activity of phage clones 4PA1 to 4PA30. Negative control represents the well with only the target bacteria while sample represents the well with phage and bacteria.

0 0.1 0.2 0.3 0.4 0.5 0.6 0.7

OD₆₀₀

Phage Clones

Negative Control Sample

48 Table 4.4: OD₆₀₀ reading of bacterial culture for selected clones with low degree of inhibition in antibacterial assay.

aNegative control represents the well with only bacteria.

bSample represents the well with bacteria and phage

cDegree of inhibition in percentage was calculated by the formula:[100-{( Sample/Negative control) x 100}].

Phage clone Negative control^a OD600

Sample^b OD600

Degree of Inhibition^c (%)

3PA35 0.3172 0.3119 1.67

4PA10 0.4534 0.4494 0.88

4PA12 0.4328 0.4229 2.29

49 4.5 Purity of the Extracted Phage Genomic DNA

Phage genomic DNA was extracted from five phage clones 3PA26, 3PA28, 4PA44, 4PA45 and 4PA48 which showed the highest binding selectivity ratio towards P. aeruginosa as determined in section 4.3. The concentrations of the five DNA samples were varied from each other as shown in Table 4.5, with the lowest concentration at 18.9 ng/µl and the highest concentration at 218.2 ng/µl.

The five extracted genomic ssDNAs (L1 to L5 which represents 3PA26, 3PA28, 4PA44, 4PA45 and 4PA 48, respectively), together with 1kb DNA ladder (lane M), were examined by 1% of agarose gel electrophoresis as shown in Figure 4.8. Single clear band was observed at the lanes labeled as L1, L2, L3, L4 and L5, indicating that the DNAs were extracted. All of the five DNAs were positioned at 6,000 bp. However, DNA of M13 phage from the library comprises of approximately 7,250 nucleotides which were not lined up with the double-stranded DNA ladder of the same length.

50 Figure 4.8: Agarose gel electrophoresis analysis of phage genomic DNAs.

Lane M shows the 1kb DNA ladder. L1 to L5 show the genomic DNAs from the phage clone 3PA26, 3PA28, 4PA44, 4PA45 and 4PA 48, respectively.

Table 4.5: Concentration of extracted ssDNAs from selected phage clones.

Phage Clone DNA Concentration (ng/µl)

3PA26 18.9

3PA28 23.2

4PA44 33.0

4PA45 56.1

4PA48 218.2

M L1 L2 L3 L4 L5

51 4.6 Peptide Sequence Analysis

Five DNAs from the clones mentioned in section 4.5 were sequenced for the inserted oligonucleotide. However, only three oligonucleotides from clones 3PA26, 4PA4 and 4PA5 were successfully sequenced. Figure 4.9(a), (c) and (d) show a good quality of DNA sequencing for clones 3PA26, 4PA4 and 4PA5, respectively. DNA of clone 4PA8 was poorly sequenced as shown in Figure 4.9(e), resulted in unsuccessful identification of the oligonucleotide insert region. Clone 3PA28 showed a good DNA sequencing signal [(Figure 4.9(b)].

However, the DNA sequence possessed a deletion of the library insert nucleotides (ACCTCCACC) and the oligonucleotides located at the peptide insert region which is indicated by dashes in the sequence alignment as shown in Figure 4.10. Therefore, peptide sequence of clone 3PA28 and 4PA8 were failed to be revealed. The conserved region of

“ATGGGATTTTGCTAAACAACTTTCAACAGTTTCGGCCGA” which is part of the phage genome located before the insert of interest is highlighted in yellow in the sequences alignment (Figure 4.10). The 36-nucleotides region located right after the yellow DNA region and conserved region ACCTCCACC is the insert region that encodes for the displayed peptide. The reverse complement sequence (Table 4.6) of the oligonucleotide is determined through reverse complement tool. The sequences were translated into peptide sequence as tabulated in Table 4.7.

Peptides of clones 4PA4 and 4PA5 are identical, which is GLHTSATNLYLH.

On the other hand, peptide of clone 3PA26 is GPVNKSSTILRM. The net ionic charge and hydrophobicity of the peptides are listed in Table 4.7, where

52 GPVNKSSTILRM is a positively charged peptide while GLHTSATNLYLH is a zwitterionic peptide. Peptide GPVNKSSTILRM showed the common features to the typical antimicrobial peptide where it consists of a net positive charge (+2). In addition, the peptide consists of a 33.33% of total residue hydrophobicity. Besides, the peptide GLHTSATNLYLH showed a total hydrophobicity of 41.67%. A consensus motif of –Ser-X-Thr-X-Leu- , where

‘X’ can be any amino acid residues, was revealed in peptides GPVNKSSTILRM and GLHTSATNLYLH as shown in Figure 4.11. The physiochemical properties of the peptides were summarized in Figure 4.12.

Hydrophobic amino acids are conserved at position 2, 3, 10 and 12 while small amino acids are conserved at position 4, 7, and 8. In addition, polar amino acid is conserved at position 5 of both the peptides. However, no matches were found when GLHTSATNLYLH and GPVNKSSTILRM were blasted against Collections of Antimicrobial Peptides (CAMP) and NCBI protein database.

53 Figure 4.9: DNA sequence electropherogram of the phage inserted oligonucleotides (yellow region) encoding the displayed peptides. The alphabet represents the selected clones respectively, (a) 3PA26, (b) 3PA28, (c) 4PA4, (d) 4PA5 and (d) 4PA8.

(a)

(b)

(d) (c)

(e)

54 Figure 4.10: Alignment of the DNA sequences using ClustalW.

Figure 4.11: Alignment of the peptide sequences using ClustalW. Peptide sequences alignment revealed a consensus sequence of Ser-X-Thr-X-Leu (X= any amino acid residues).

Figure 4.12: Alignment of peptide sequences in GeneDoc. The peptide sequences of clones 3PA26, 4PA4 and 4PA5 were aligned. The physical-chemical mode of GeneDoc was used to assign columns of alignment to one of the 12 pre-defined groups of physiochemical properties. White writing on a black background indicates hydrophobic amino acids; green writing on a yellow background indicates small amino acids; black writing on a green background indicates polar amino acids.

3PA26 =

4PA4 =

4PA5 =

55 Table 4.6: Reverse complement sequence of the 36 nucleotides insert

region.

Phage Clone Reverse complement sequence

3PA26 GGTCCGGTGAATAAGTCTTCGACGATTCTTCGTATG

4PA4 GGTTTGCATACTTCGGCTACTAATCTGTATTTGCAT

4PA5 GGTTTGCATACTTCGGCTACTAATCTGTATTTGCAT

Table 4.7: Sequence and physiochemical properties of the isolated phage- displayed peptide.

Phage Clone Peptide Sequence Net Charges Hydrophobicity

3PA26 G P V N K S S T I L R M +2 33.33%

4PA4 G L H T S A T N L Y L H 0 41.67%

4PA5 G L H T S A T N L Y L H 0 41.67%

56 CHAPTER 5

DISCUSSION

Emergence of multi-drug resistant strain of P. aeruginosa threatens the effectiveness of antibiotics in infection treatment. Therefore, alternative treatments have to be discovered to complement with the antibiotic treatment.

Antibacterial peptides may be a potential alternative antibacterial agent. In this study, a phage-displayed peptide library was used to screen for peptides with antibacterial properties. Phage display technology has been successfully used in antibacterial peptides isolation over the years (Bishop-Hurley et al., 2005;

Pini et al., 2005; Bishop-Hurley et al., 2010). It is fast and cost-effective by allowing the screening of large numbers of peptides at once. Thus, it is reasonable to use phage display as the tool for screening and isolation of antibacterial peptide against P. aeruginosa.

57 5.1 Selection of Phage-Displayed Peptides Binding to Pseudomonas

aeruginosa

Dodecapeptide-bearing phage display library was panned against the whole bacterial cells of Pseudomonas aeruginosa. Bacterial cell membrane surface possesses diverse epitopes that might be bound by various types of phage- displayed peptides. Hence, panning with whole bacterial cells probably may isolate as many types of phage-displayed peptides as possible especially in the first round of biopanning. Solution biopanning approach was chosen so that the entire bacterial cell membrane surface was exposed to phage-displayed peptides in all dimensions during the biopanning. Thus, this might increase the probability of selecting different types of antibacterial peptides which target at various surface molecules of the bacteria.

Selection of target-specific phage-displayed peptides was optimized by washing away weak binding phage-displayed peptides and retained only those peptides with high affinity binding which are represented by the output phage eluate. This was achieved by stepwise increasing the concentration of Tween 20 in the washing buffer (TBST) in the subsequent round of biopanning.

Tween 20 works as a detergent to reduce non-specific hydrophobic interactions between the phage-displayed peptide and the target epitope of the bacteria (Caberoy et al., 2009). Hence, with each round of biopanning and amplification, the pool of phage was enriched in favour to the peptides that bind to the target bacteria. This was indicated by the increased percentage of phage clones yield from the first round to the third round of biopanning. The number of phage clone that bind selectively toward the bacteria increases after every round of the biopanning. However, in the fourth round of biopanning, the percentage of

58 phage clones yield was decreased. This might be due to the greater input phage titer compare to the second and the third round of biopanning (refer to Table 4.2). Furthermore, output titer of the biopanning was limited to the range of between 10⁵ and 10⁶ PFU/ml which is similar to the result of the study of Abi- Ghanem et al. (2008). This might be due to the saturation of phage clones enrichment after four rounds of biopanning. As the result, increasing input titer did not increase the output titer in the last round of biopanning.

5.2 Binding Selectivity of Phage-Displayed Peptide to Pseudomonas

Dalam dokumen screening and isolation of antibacterial peptide (Halaman 47-73)