The immunomodulatory effects of probiotics and azithromycin in dextran sodium sulfate-induced ulcerative colitis in rats via TLR4-NF-κB and p38-MAPK pathway

(1)

The immunomodulatory effects of probiotics and

azithromycin in dextran sodium sulfate-induced ulcerative colitis in rats via TLR4-NF-κB and p38-MAPK pathway

Item Type Article

Authors Elkholy, Shereen E; Maher, Shymaa Ahmad; Abd El-Hamid, Noura R; Elsayed, Heba A; Hassan, Wael Abdou; Abdelmaogood, Asmaa K K; Hussein, Samar M; Jaremko, Mariusz; Alshawwa, Samar Zuhair; Alharbi, Hanan M; Imbaby, Samar

Citation Elkholy, S. E., Maher, S. A., Abd el-hamid, N. R., Elsayed, H. A., Hassan, W. A., Abdelmaogood, A. K. K., Hussein, S. M., Jaremko, M., Alshawwa, S. Z., Alharbi, H. M., & Imbaby, S. (2023). The immunomodulatory effects of probiotics and azithromycin in dextran sodium sulfate-induced ulcerative colitis in rats via TLR4- NF-κB and p38-MAPK pathway. Biomedicine & Pharmacotherapy, 165, 115005. https://doi.org/10.1016/j.biopha.2023.115005

Eprint version Publisher's Version/PDF

DOI 10.1016/j.biopha.2023.115005

Publisher Elsevier BV

Journal Biomedicine & pharmacotherapy = Biomedecine &

pharmacotherapie

Rights Archived with thanks to Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie under a Creative Commons license, details at: http://creativecommons.org/licenses/by-nc- nd/4.0/

Download date 21/06/2023 07:37:00

(2)

Item License http://creativecommons.org/licenses/by-nc-nd/4.0/

Link to Item http://hdl.handle.net/10754/692653

(3)

Biomedicine & Pharmacotherapy 165 (2023) 115005

Available online 14 June 2023

The immunomodulatory effects of probiotics and azithromycin in dextran sodium sulfate-induced ulcerative colitis in rats via TLR4-NF- κ B and p38-MAPK pathway

Shereen E. Elkholy

^a

, Shymaa Ahmad Maher

^b^,^c

, Noura R. Abd el-hamid

^c^,^d

, Heba A. Elsayed

^e

, Wael Abdou Hassan

^f^,^m

, Asmaa K.K. Abdelmaogood

^g

, Samar M. Hussein

^h

, Mariusz Jaremko

ⁱ

, Samar Zuhair Alshawwa

^j

, Hanan M. Alharbi

^k

, Samar Imbaby

^l^,^*^,¹

aClinical Pharmacology Department, Faculty of Medicine, Port Said University, Port Said, Egypt

bMedical Biochemistry and Molecular Biology Department, Faculty of Medicine, Suez Canal University, Ismailia, Egypt

cCenter of Excellence in Molecular and Cellular Medicine (CEMCM), Faculty of Medicine, Suez Canal University, Ismailia 41522, Egypt

dGenetics unit, Histology and cell biology department, Faculty of Medicine, Suez Canal University, Ismailia, Egypt

eMicrobiology Department, Faculty of Medicine, Port Said University, Port Said, Egypt

fPathology Department, Faculty of Medicine, Suez Canal University, Ismailia, Egypt

gClinical Pathology Department, Faculty of medicine, Suez Canal University, Ismailia, Egypt

hPhysiology Department, Faculty of medicine, Suez Canal University, Ismailia, Egypt

iSmart-Health Initiative and Red Sea Research Center, Division of Biological and Environmental Sciences and Engineering, King Abdullah University of Science and Technology, Thuwal 23955, Saudi Arabia

jDepartment of Pharmaceutical Sciences, College of Pharmacy, Princess Nourah bint Abdulrahman University, P.O. Box 84428, Riyadh 11671, Saudi Arabia

kDepartment of Biology, College of Science, Princess Nourah Bint Abdulrahman University, Riyadh, Saudi Arabia

lClinical Pharmacology Department, Faculty of Medicine, Suez Canal University, Ismailia, Egypt

mDepartment of Basic Sciences, College of Medicine, Sulaiman Alrajhi University, Al Bukayriyah 52726, Saudi Arabia

A R T I C L E I N F O Keywords:

Ulcerative colitis Azithromycin Probiotics

Dextran sodium sulphate (DSS) model P-38 MAPK

Toll-Like Receptor (TLR4)

A B S T R A C T

Ulcerative colitis (UC), a chronic autoimmune disease of the gut with a relapsing and remitting nature, considers a major health-care problem. DSS is a well-studied pharmacologically-induced model for UC. Toll-Like Receptor 4 (TLR4) and its close association with p-38-Mitogen-Activated Protein Kinase (p-38 MAPK) and nuclear factor kappa B (NF-κB) has important regulatory roles in inflammation and developing UC. Probiotics are gaining popularity for their potential in UC therapy. The immunomodulatory and anti-inflammatory role of azithromycin in UC remains a knowledge need. In the present rats-established UC, the therapeutic roles of oral probiotics (60 billion probiotic bacteria per kg per day) and azithromycin (40 mg per kg per day) regimens were evaluated by measuring changes in disease activity index, macroscopic damage index, oxidative stress markers, TLR4, p-38 MAPK, NF-κB signaling pathway in addition to their molecular downstream; tumor necrosis factor alpha (TNFα_), interleukin (IL)1β, IL6, IL10 and inducible nitric oxide synthase (iNOS). After individual and combination therapy with probiotics and azithromycin regimens, the histological architecture of the UC improved with restoration of intestinal tissue normal architecture. These findings were consistent with the histopathological score of colon tissues. Each separate regimen lowered the remarkable TLR4, p-38 MAPK, iNOS, NF-κB as well as TNFα, IL1β, IL6 and MDA expressions and elevated the low IL10, glutathione and superoxide dismutase expressions in UC tissues. The combination regimen possesses the most synergistic beneficial effects in UC that, following thorough research, should be incorporated into the therapeutic approach in UC to boost the patients’ quality of life.

* Correspondence to: Department of Clinical Pharmacology, Faculty of Medicine, Suez Canal University, 41522 Ismailia, Egypt.

E-mail addresses: samar_imbaby@med.suez.edu, samar_imbaby99@yahoo.com (S. Imbaby).

1 https://orcid.org/0000–0002-2130–2724

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy

journal homepage: www.elsevier.com/locate/biopha

https://doi.org/10.1016/j.biopha.2023.115005

Received 26 April 2023; Received in revised form 7 June 2023; Accepted 8 June 2023

(4)

1. Introduction

Ulcerative colitis (UC), a category of inflammatory bowel disease (IBD), a chronic autoimmune disease of the colon with a relapsing and remitting nature. It can result in ulcers, bleeding, severe diarrhea, and abdominal pain with higher risk of colorectal carcinoma [1,2]. This serious health-care issue imped a high cost burden on the healthcare system, with an increasing incidence among all ages, particularly the young and middle-aged, and substantial morbidity affecting patient quality of life, necessitating lifelong treatment [2,3].

IBD was assessed in several animal models to evaluate the molecular signaling mechanisms participated in the pathogenesis of colitis. The chemical dextran sodium sulphate (DSS)-induced colitis is the well- studied model [4]. This model is a reliable inducible model for study- ing intestinal inflammatory responses that mimics the human UC morphologically and clinically, including such losing weight, diarrhea, rectal bleeding, colon shrinking, goblet cell biodiversity loss, and ul- cerations, revealing new insights into IBD pathogenesis[5,6].

The precise pathogenesis of IBD is complex and not completely assumed. While, the multifactorial interaction between genetics, environmental factors, microbial dysbiosis of gut, altered barrier integrity, oxidative stress, defective immune response and pro-inflammatory cytokine induction were demonstrated and playing a role in IBD development and pathogenesis [7,8]. The most widely accepted theory is that genetically vulnerable subjects have an overactive immune response to environmental factors and resident microbiota [9].

Toll-Like Receptor (TLR) 4, is expressed in many cell types such as immune and epithelial cells, one of the widely characterized TLRs that represent vanguard molecules of innate defense by identifying signals released by injured tissue [10]. TLR4 activation by lipopolysaccharide (LPS) results in stimulation of the nuclear factor kappa B (NF-kB) signaling pathway, resulting in production and release of several inflammatory cytokines such as tumor necrosis factor (TNF)α, interleukin (IL)6, and IL1, with subsequent injury to the intestinal epithelial barrier [11].

Cytokines released by aberrant inflammatory responses have a fundamental role in the pathogenesis of UC beside their stimulatory effect on production of nitric oxide (NO) and generation of reactive oxygen species (ROS) inducing intense and prolonged inflammation [12, 13]. Upregulation of inducible NO synthase (iNOS) by LPS and NF-κB produces substantial amounts of NO causing cell and tissue injury in IBD [14].

The p38 mitogen-activated protein kinase (p38-MAPK) is an essen- tial MAPK signaling pathways member that regulate inflammation and proliferation, differentiation, and apoptosis of cell and development of UC. This pathway upregulates TNFα, IL6, and interferon γ (IFNγ) expression, downstream targets and may be activated in UC [15,16].

Although p38-MAPK could be mandatory for intestinal inflammation regulation and cytokine production, its function in IBD is still unknown [17].

Despite the fact that anti-TNF drugs have greatly improved clinical outcomes, most of patients fail to respond with intolerance or lose response to therapy [18]. There are many treatment options available, including 5-aminosalicylic acid (5-ASA), immunosuppressant, and cor- ticosteroids are accessible. However, these available therapies are associated with adverse effects including nausea, fever, loss of appetite and long term complications including kidney disorder, vascular disease, and hepatotoxicity [10,19]. Additionally, the highly variable relapse rates and low patient compliance were reported [10,19]. All of these factors limited their use necessitating the crucial need for new therapies with lower side effects and complications. Actually, a better understanding of the disease as well as novel therapeutic approaches are needed. Understanding of targeted therapies that can selectively interact with key mediators of the inflammatory path is imperative for UC patients[20].

Using probiotics to modulate the gut bacterial flora, becomes emerging as a therapeutic alternative option in UC and chronic chole- static liver disease with general well tolerability and compliance of patients [10,21]. Probiotics are living microorganisms, bind with the host epithelium, adjust and regulate the microbiota in the intestine. A probiotic blend of Lactobacillus, Bifidobacterium and Streptococcus has effectively suppressed the UC onset and exacerbations in chronic forms [22].

Macrolides and their derived products, azalides, are broad spectrum antibiotics with bacteriostatic properties. They also appear to have anti- inflammatory and immunomodulatory properties that are impartial of their antibacterial properties[23]. Azithromycin polarizes macrophage precursors to an anti-inflammatory phenotype through elevating the release of anti-inflammatory cytokine such as IL10 (immune-inhibitory cytokine) and decreasing the production of IL6 and TNFα [24]. More- over, it reduces the degranulation of neutrophils and induces their apoptosis [25]. Furthermore, azithromycin has been shown to inhibit p38-MAPK activation and deoxyribonucleic acid (DNA) binding of NF-κB transcription factors in cystic fibrosis cell lines, leading to downregulation and reduction of pro-inflammatory cytokines secretion by non-antimicrobial activities of macrolides [26].

As a result, the goal of this study is to examine the clinical, patho- logic, and immunomodulatory outcomes of probiotics and azithromycin in the DSS-induced colitis rat model, as well as to highlight the possible biochemical and molecular therapeutic mechanisms underlying the effects of probiotics and azithromycin alone or in combination on TLR4, p- 38 MAPK, iNOS, and NF-κB. Probiotics and azithromycin could be promising options for the rapid and good recovery of UC patients, with good tolerability, compliance, and the prevention of UC complications.

2. Materials and methods 2.1. Experimental animals

From the Faculty of Veterinary Medicine, Suez Canal University (SCU), Egypt, sixty-four adult male albino Wistar rats (weighing 180–200 g) were obtained. Rats were put in the animal house (Faculty of Medicine, SCU), in sterile cages made of plastic polyethylene (eight animals in each cage). Conditions of animal house were fitted to a 12 h alternating light-dark cycle at 25 ^◦C ±2 ^◦C with unlimited access to standard rat diet and tap water. They were exposed for two weeks to acclimate prior to the starting of the experiment. Data were assessed in a blinded fashion.

2.2. Drugs used in the study

DSS 5%, from Sigma Company, Cairo, Egypt, as a white odorless powder of a molecular weight (MW) 40,000 Da, was utilized for induction of UC in animals. Its solution was provided by mixing the DSS powder (25 g) with distilled water (500 mL) as a stock solution at 4ºC. 5- ASA, from Sigma Company, Cairo, Egypt, as a white powder that was dissolved in distilled water. While, Lact´eol® Fort was obtained, from ADARE Pharmaceuticals SAS, France, which consisted of lyophilized Lactobacillus Lb corresponding to Lactobacillus delbrueckil and Lactoba- cillus fermentum, and was dissolved in distilled water. Azithromycin was supplied as a parenteral infusion powder product (Zithromax 500 mg;

Pfizer, USA), that was dissolved in distilled water.

3. Modelling of Ulcerative colitis with DSS

Rats received distilled water for seven days after that, the 5% DSS;

MW 40 kDa, that was dissolved in distilled water in the drinking water, for seven days from the 8th day till the end of experiment [27].

(5)

Biomedicine & Pharmacotherapy 165 (2023) 115005

3 4. Animal groups

▪ Animals were weighed and randomly allocated into eight groups. They were permitted unrestricted access to drinking water. The 1st day after acclimatization was assigned as a day zero. Fig. 1 demonstrated the diagrammatic presentation of the experimental protocol.

▪ Group 1 (Control-untreated group): Normal animals in this group received distilled drinking water and didn’t receive any medications for 14 days.

▪ Group 2 (Probiotics-control group): Rats received probiotics (60 billion probiotic bacteria/kg, once every day) orally as a gavage for 14 days [28].

▪ Group 3 (Azithromycin-control group): Rats received distilled water for seven days followed by azithromycin (40 mg/kg, once every day) orally as a gavage for seven days beginning from 8th day until the end of experiment [29].

▪ Group 4 (DSS-control group): Rats received distilled water for seven days followed by 5% DSS in the drinking water for seven days beginning from 8th day until the end of experiment [27].

▪ Group 5 (DSSþ 5-ASA-treated group): Animals received distilled water for seven days followed by 5% DSS in the drinking water and 5-ASA (100 mg/kg, once every day) orally as a gavage for seven days beginning from 8th day [30] until the end of experiment.

▪ Group 6 (DSSþ Probiotics-treated group): Rats received probiotics (60 billion probiotic bacteria/kg, once every day) orally as a gavage for fourteen days and received 5% DSS in the drinking water for seven days beginning from 8th day until the end of the experiment.

▪ Group 7 (DSSþ Azithromycin-treated group): Animals received distilled water for seven days followed by 5% DSS in the drinking water and azithromycin (40 mg/kg, once every day) orally as a gavage for seven days beginning from 8th day until the end of experiment.

▪ Group 8 (DSSþ Probiotics and Azithromycin-treated group): Rats received 60 billion probiotic bacteria/kg, once every day) orally as a gavage for 14 days, 5% DSS in the drinking water and azithromycin (40 mg/kg, once every day)

orally as a gavage for seven days beginning from 8th day until the end of experiment. azithromycin was given three hours after oral probiotic administration to avoid the interaction between them.

5. Disease activity index (DAI) assessment

General clinical observations (body weight (BW), food intake, consistency of stool, and the appearance of gross bleeding) were evaluated for every rat in all groups. All assessments were done in a blinded fashion. The percentage change of BW was enumerated utilizing the formula (final BW-initial BW/initial BW) X 100 and weight loss was calculated [31].

DAI assessment is the score of combination of weight loss, both consistency, and bleeding of stool [32,33]. Scores were assigned as:

weight loss: 0 (no loss), 1 (1–5%), 2 (6–10%), 3 (11–20%), and 4 (more than 20%); stool consistency: 0–1 (normal, well-formed pellets), 1 (soft but formed stools), 2 (pasty and semi-formed stools), and 3 (liquid stools that remained adhesive to the anus); and bleeding: 0 (no blood in hemoccult), 1 (hemoccult positive), 2 (gross bleeding in facet), and 3 (gross bleeding from the rectum). After that, the sum of these three parameters leading to overall clinical score (0− 10), from 0 (healthy) to 10 (maximum UC). Assessment was done in a blinded manner.

6. Sample collection and preparation

All rats in all groups were sacrificed by cervical decapitation in the presence of thiopental sodium (40 mg/kg, intraperitoneally) [34]. Colon was harvested from every animal, washed with cold phosphate buffered saline (PBS), weighted and the colon index was counted utilizing the formula (colon weight /final BW) X 100 [31]. The weight of damaged colon and its length are indirect markers of the extent and severity of inflammatory response [35].

Colon was measured and then cut into three portions, one part for further histopathological and immunohistochemical evaluation. While, other two parts of colonic tissue samples were homogenized utilizing Teflon pestle homogenizer (Glas-Col homogenizer system) from Vernon Hills (USA). Centrifuge of homogenate suspension at 12,000 rpm at 4^◦C for fifteen minutes and freezing of the supernatant at − 80^oC for further

Fig. 1. The diagrammatic presentation of the study protocol including colon samples of different study groups after sacrification of rats.

S.E. Elkholy et al.

(6)

biochemical assessment (gene expression and western blotting) according to manufacturer’s protocols.

7. Macroscopic damage index (MDI) assessment

Colon specimens were opened and scored (0− 4) for the MDI as reported previously [36].

7.1. Colonic TNFα, IL1β, IL6, and IL10 expressions using reverse transcriptase-polymerase chain reaction (RT-PCR) quantitative evaluation

By Direct-zol RNA Miniprep Plus (Cat, R2072) from ZYMO research CORP (USA), extraction of total ribonucleic acid (RNA) from homogenized tissues was performed in consistent with the company’s manual. While, RT of extracted RNA was by RevertAid first strand cDNA synthesis kit (Cat, K1622) from Thermo Fisher Scientific (USA) that followed by PCR in consistent with the manufacturer’s manual. Data were normalized to the housekeeping gene β-actin in parallel with the company’s protocol. The primers sequence for TNFα; Forward 5’ GTGTGGCTGTAAGGAGAACCAG 3’ Reverse 5’ CACACGGTGTTCTGAGTCTCCT 3’for IL1β; Forward 5’

TGGACCTTCCAGGATGAGGACA3’ Reverse 5’GTTCATCTCGGAGCCTG- TAGTG3’, for IL6 gene; forward 5^′- CCTGAGCTGACCTTGGAGCA − 3^′, and reverse 5՝- GGTGGTTGCCCTTTTCTACT − 3^′, IL10; forward 5’- CCTCGTCTCATAGACAAGATGGT − 3’ and reverse 5’- GGGTAGAGTCA- TACTGGAACATG-3’ and for β-actin Forward 5’TCCTCCTGAGCGCAAG- TACTCT3’and Reverse 5’GCTCAGTAACAGTCCGCCTAGAA3’. Using the 2^-

ΔΔCt method for analysis of data as described by[37,38].

7.2. Colonic expression of total p-38 MAPK, phospho-p-38 MAPK and iNOS using Western blot analysis

Extraction of proteins by the ReadyPrepTM protein extraction kit (Catalog #163–2086) from (Bio-Rad Inc) and Bradford Protein Assay Kit (SK3041, Bio basic inc, Markham Ontario L3R 8T4 Canada) for quantitative analysis of protein in consistent with the company’s protocols.

20–30 microgram of samples were separated on a polyacrylamide gel utilizing TGX Stain-Free™ FastCast™ Acrylamide Kit (SDS-PAGE) from (Bio-Rad Laboratories inc,) Cat # 161–0181). The gel was transferred to membrane via utilizing BioRad Trans-Blot Turbo and then blocked for one hour at room ambient temperature in tris-buffered saline with tween twenty (TBST) buffer dissolved in three percent bovine serum albumin (BSA). The membrane was incubated at 4^oC overnight with primary antibody. The utilized primary antibodies: anti-human Phospho p38- MAPK (Thr180/Tyr182) (D3F9) XP rabbit monoclonal antibody (1:1000; Cell Signaling, Danvers, MA), anti-human p38-MAPK poly- clonal antibody (1:1000; Cell Signaling, Danvers, MA) and anti-mouse iNOS (NOS2 (C-11)) monoclonal antibody (1:500; Santa Cruz Biotech- nology, Santa Cruz, CA, USA). Detection of these antibodies was by HRP- conjugated secondary antibody (Goat anti-rabbit IgG- HRP-1 mg Goat mab -Novus Biologicals). The membrane was supplied with chemiluminescent substrate (ClarityTM Western ECL substrate from Bio-Rad (cat. 170–5060) in consistent with the company’s protocols. By a CCD camera-based imager, the signals of chemiluminescent were taken. To calculate the intensity of the bands of target proteins against the control β-actin samples (housekeeping protein) by protein normalization, image analysis software was utilized on the ChemiDoc MP imager [39,40].

7.3. Colonic MDA, GSH and SOD levels using Enzyme linked immunoassays (ELISA)

Malondialdehyde (MDA), glutathione (GSH) and superoxide dismutase (SOD) as indicators of oxidative stress in colonic tissue homogenates were evaluated utilizing a colorimetric assay (BioVision’, Milpitas, USA) with these kits: MDA kit (cat. K739–100), GSH (cat.

K464–100) and SOD (cat. K335–100) in consistent with the manufacturer’s manual.

8. Colon histopathological examination

The samples were put in ten percent formalin and embedded in paraffin. Three-micron thickness of paraffin embedded blocks were submitted, stained by hematoxylin and eosin (H and E) and evaluated.by an independent pathologist. By using ImageJ scanner and viewer software (from LOCI, University of Wisconsin, US), scanning of slides and processing of images were performed. From each animal in each study groups, ten serial sections were taken to evaluate five high-power fields (x400) [38,41]. An independent, blinded observer determined and evaluated all of the histopathlogical differences for each change in each of the studied groups.

8.1. Histopathological evaluation

Colonic tissue sections were examined and scored for pathological findings as the following: Inflammation:0 (none), 1 (slight), 2 (moderate), and 3 (severe); inflamed area/extent: 1 (mucosa), 2 (mucosa and submucosa), and 3 (transmural); crypt damage: 0 (none), 1 (basal 1/3 damaged), 2 (basal 2/3 damaged), 3 (only the surface epithelium is intact), and 4 (entire crypt and epithelium are lost), and involvement percentage: 1 (1–25%), 2 (26–50%), 3 (51–75%), and 4 (76–100%) [42].

9. Colon Immunohistochemical examination

Sections from the selected paraffin blocks were submitted for immunohistochemical staining. Incubating slides with primary antibodies (ab13556 for TLR4 and ab32536 for NF-kB, Abcam; Cambridge, UK) that was followed by incubation with the goat anti-Rabbit IgG secondary antibody ((H+L), HRP, ThermoFisher Scientific, Massachu- setts, US). Before dehydration and mounting, each slide was lightly counterstained with hematoxylin for thirty seconds.

9.1. Immunohistochemical evaluation

Cells with cytoplasmic reaction to TLR4 and NF-kB antibodies were considered positive. ×400 magnifications of 5 fields were randomly chosen from each section. Positive tissue reaction was evaluated and presented as percentage of positive area of the whole examined colonic tissues. Moreover, intensity of expression was recorded [43]. The immunoreaction for TLR4 and NF-kB were all quantified utilizing the Image J software.

10. Statistical analysis

Data of the experiment were demonstrated in the form of means and standard error means (SEM). Prism software was utilized for analysis of all data (ver.8; GraphPad Software Inc., San Diego, CA, USA). A One- way analysis of variance (ANOVA) was utilized to evaluate means’

statistical variations and a Tukey test for multiple comparisons. The p value lower than 0.05 was assigned for statistically significant.

11. Results

11.1. Probiotics and azithromycin could ameliorate the DSS-Induced ulcerative colitis by their effects on disease activity index, colon weight ratio, colon length, and macroscopic damage index

Assessment of the overall clinical score of DAI (in the form of weight loss, stools consistency, and bleeding) and MDI were noticed in (Fig. 2).

Regarding the DAI total score, the DSS-treated group exhibited a significant increase of DAI including its parameters (extensive weight loss percentage with diarrhea and bloody stool), contrary to the control group (P<0.001; Fig. 2 A-D). While, administration of various treatment modalities of 5-ASA, probiotics, azithromycin and combination of

(7)

5 probiotic and azithromycin significantly reduced the DAI with lowering the weight loss percentage, diarrhea and bloody stool contrary to DSS- colitis model group (P<0.001). In addition, the combination group displayed the highest improvement in DAI compared to the individual usage of probiotics or azithromycin.

The weight of damaged colon and its length are indirect markers of

the extent and severity of inflammatory response [35], the colon index and length were measured. There was a non-significant variation in probiotics, and azithromycin control groups versus the control group (P>0.05; Fig. 2E, F). The administration of DSS strikingly elevated the colon index with shortening of the colon contrary to with the control group suggesting the severity of inflammation. However, treatment with Fig. 2. Probiotics and azithromycin could ameliorate the DSS-Induced ulcerative colitis by their effects on disease activity index, colon weight ratio, colon length, and macroscopic damage index. (A) Disease activity index. (B) Percentage change of body weight. (C) Stool consistency score. (D) Stool bleeding score. (E) Colon index. (F) Colon length. (G) Macroscopic damage index. One-way ANOVA analysis (n=8). * P<0.05, ** P<0.01 and

*** P<0.001 contrary to the control group,

###P<0.001 contrary to DSS group^{, $}P<0.05, and ^$$$P<0.001 contrary to DSS+Probiotics- treated group^, ⁺P<0.05, ⁺⁺P<0.01, and

+++P<0.001 contrary to DSS+Azithromycin- treated group. Pro^: Probiotics, Aza: azithromycin. DSS: Dextran sodium sulfate.

(8)

5-ASA, probiotics, azithromycin and combination of probiotic and azithromycin exhibited significant comparable reduction in colon index and improvement of colon length versus DSS-treated group (P<0.001;

Fig. 2E, F).

In parallel to DAI, administration of DSS markedly enhanced MDI revealing the severity of colitis contrary to the control group (P<0.001;

Fig. 2G) which was evidently inhibited by treatment of DSS rats with various treatment regimens. On the other hand, concurrent use of probiotic and azithromycin displayed higher improvement in MDI compared to each individual therapeutic groups (P<0.001; Fig. 2G).

11.2. Probiotics and azithromycin could modulate the colonic mRNA expressions of TNFα, IL1β, and IL6 and IL10 in colonic tissues

Following DSS challenging, the pro-inflammatory cytokines mRNA

expressional levels of (TNFα, IL1β and IL6) in colonic tissues were significantly upregulated in comparison to normal control groups (P<0.001; Fig. 3A-C). In contrast, administration of 5-ASA, probiotics, azithromycin and combination of probiotic and azithromycin strikingly downregulated these higher pro-inflammatory cytokines levels compared to DSS-treated group. The combination therapy resulted in more significant downregulation of pro-inflammatory cytokine expressional levels compared to each individual monotherapy (P<0.001;

Fig. 3A-C).

On the other hand, the anti-inflammatory IL10 gene expression levels were significantly downregulated in colon of DSS-induced colitis group versus the control groups (P<0.001; Fig. 3D). A marked upregulated IL10 expression was revealed with the individual monotherapy of 5-ASA, probiotics, azithromycin and the combination group contrary to DSS group (P<0.001; Fig. 3D). Moreover, the combination therapy

Fig. 3. Probiotics and azithromycin could modulate the colonic mRNA expressions of TNFα, IL1β, IL6 and IL10 and protein expression levels of p-38 MAPK and iNOS. (A-D) Transcription mRNA expressional levels of TNFα, IL1β, IL6, and IL10 in colon issues (n=8). (E-F) p p38-MAPK and iNOS protein levels in colon tissues (n=3). One-way ANOVA analysis. * P<0.05, ** P<0.01 and

*** P<0.001 contrary to the control group,

###P<0.001 contrary to DSS group^{, $}P<0.05, and ^$$$P<0.001 contrary to DSS+Probiotics- treated group^,and ⁺⁺⁺P<0.001 contrary to DSS+Azithromycin-treated group. Pro^: Pro- biotics, Aza: azithromycin. DSS: Dextran sodium sulfate, IL: interleukin, p p38-MAPK:

phospho p38- mitogen-activated protein kinase and iNOS: inducible NO synthase.

(9)

7 has the highest IL-10 mRNA expressional levels.

11.3. Probiotics and azithromycin could attenuate the DSS-induced activation of p-38 MAPK and iNOS colonic protein expressional levels in colonic tissues

Both p-38 MAPK and iNOS have important role as upstream regu- lators for activation and upregulation of pro-inflammatory cytokine in ulcerative colitis. Therefore, we examined their protein expression levels in colonic tissues using western blotting, in which β-Actin was utilized as the loading control to demonstrate that the loaded protein was similar across the gel (Fig. 3E, F, supplementary Figure.S1).

The control groups demonstrated undetectable or marginal colonic protein expression levels of p-38 MAPK (Fig. 3E). The activation of p-38 MAPK following DSS administration was assessed by its phosphorylation in colon. p-p-38 MAPK were significantly elevated after DSS challenging compared to control groups (P<0.001; Fig. 3E). Whereas, those elevated phosphorylated levels of p-38 MAPK were strikingly declined with the individual monotherapy groups especially with the DSS+Azithromycin, and the combination-treated groups versus DSS- colitis group (P<0.001; Fig. 3E).

The control groups revealed undetectable or marginal colonic protein expression levels of iNOS (Fig. 3F). iNOS activation profoundly increased after DSS challenging contrary to control groups (P<0.001;

Fig. 3F). In contrast, the increase in iNOS activation was nearly elimi- nated with the individual monotherapy groups especially with the DSS+Azithromycin, and combination of probiotic and azithromycin -treated groups contrary to DSS-colitis group (P<0.001; Fig. 3F).

11.4. Probiotics and azithromycin could modulate the colonic oxidative stress markers

The levels of oxidative stress markers including a marker for lipid peroxidation (MDA), and antioxidant enzymes (GSH and SOD) in colonic homogenates were assessed.

The DSS colitis group exhibited a profound elevation of MDA concentration contrary to the control groups (P<0.001; Fig. 4A). While, probiotics, azithromycin alone or combined and 5-ASA post-treatment remarkably declined these elevated levels compared to DSS group.

Furthermore, the concurrent usage of probiotics and azithromycin had the lowest levels of MDA compared to each individual monotherapy of probiotics or azithromycin (P<0.001, P<0.05 orderly; Fig. 4A).

In parallel, GSH and SOD levels were significantly declined after DSS challenging contrary to the control groups (P<0.001; Fig. 4B, C).

Meanwhile, those lower GSH and SOD levels by DSS were strikingly enhanced by administration of each individual monotherapy and the combination therapy in comparison to DSS-colitis group.

11.5. Probiotics and azithromycin could reduce the DSS-induced histopathological colonic alterations

Hematoxylin and Eosin colon tissues of the three control groups revealed normal colon architecture in the form of uniform colonic tissue, regular epithelial cell covering, and overlying lamina propria that demonstrated few chronic inflammatory cell infiltrates and uniform mucous secreting colonic glands (Fig. 5A).

Meanwhile, administration of DSS-induced colitis that manifested in the form of areas of complete drop out glands, and areas of edema. There was dense chronic lympho-plasmacytic infiltrate involving the whole colonic wall, filling the whole lamina propria and extending through musclaris mucosa into submucosa and downwards. Some inflammatory cells are attacking glands in addition to prominent crypt distortion.

These histopathological changes were strikingly displayed in DSS group contrary to the control groups (Fig. 5A, B). However, administration of various therapeutic regimens of 5-ASA, probiotics, azithromycin and their combination significantly inhibited these histological damages versus DSS group. Notably, histological grading showed that the various treatment modalities significantly ameliorated the overall colitis score in comparison with the scores of the DSS group (P<0.001; Fig. 5A, B).

In addition, the concurrent usage of probiotics and azithromycin Fig. 4. Probiotics and azithromycin could modulate colonic oxidative stress markers. (A) Malondialdehyde (MDA), (B) Glutathione (GSH), and (C) Super oxide dismutase (SOD) concentration levels were measured by using of ELISA. One-way ANOVA analysis (n=8).

* P<0.05, ** P<0.01 and *** P<0.001 contrary to the control group, ^###P<0.001 contrary to DSS group^{, $$$}P<0.001 contrary to DSS+Probiotics-treated group, ⁺P<0.05, and

++P<0.01 contrary to DSS+Azithromycin- treated group. Pro: Probiotics, Aza: azithromycin. DSS: Dextran sodium sulfate.

(10)

restored the normal architecture of intestinal tissue, with reduction in inflammation and edema in mucosa, confirming the most significant improvement of colonic histological damage.

11.6. Probiotics and azithromycin could suppress the DSS-induced immunohistochemical changes (TLR4 and NF-κB expression) in colonic tissue

Immunohistochemical analysis of the normal control group revealed a negative expression of TLR4 and NF-κB in colonic tissue (Fig. 6A).

Also, probiotic and azithromycin control groups exhibited a localized very faint pattern of TLR4 and NF-κB positive staining in colonic surface epithelium of some glands that wasn’t significant versus the control group (Fig. 6B, C, 6I, J). On the other hand, the DSS challenging resulted in a marked enhancement of both TLR4 and NF-κB activities manifested by a strong prominent positive staining reaction to TLR4 and NF-κB in both mucosal glands and inflammatory cells in lamina propria with generalized glandular distributions contrary to the control group (P<0.001; Fig. 6D, 6I, 6J). Whereas, there is a marked decline in the expression and extent of positive reaction to TLR4 and NF-κB activities in tissues were achieved by probiotics and azithromycin separately or combined and 5-ASA (P<0.001; Fig. 6E-J). In addition, the combined group displayed the most significant improvement with the lowest TLR4 and NF-κB activities compared to each monotherapy (P<0.001;

Fig. 6H–J).

12. Discussion

The global prevalence of UC is estimated to be approximately 224 patients per 100,000 individuals per year, with a 2% annual increase

[44]. The exact cause of UC is still ambiguous and under investigation, same as many autoimmune diseases. One of the most studied and observed etiologies in most UC patients is the alteration of gut microbiota in the form of diminished diversity or dysbiosis which can induce and maintain the ongoing inflammatory process through continuous introduction of antigens or co-stimulatory molecules leading to an inflammatory cascade [45,46]. However, standard UC therapies revealed many side effects that limit their usage, necessitating the development of effective therapeutic agents with lower side effects and complications that could modulate the inflammatory and immunological responses.

Probiotics are gaining popularity especially in the last decade as a beneficial measure that boost the wellbeing of our alimentary tract and immune system. Many mechanisms have been postulated including improved membrane integrity and hydration, prevention of Leaky gut, modulation of immunological milieu, interaction with the resident microbiota, and the production fatty acids, enzymes and antimicrobial substances [47].

Lact´eol® is a commercially engineered formula made up of combination of Lactobacillus and fermented culture medium. Lactobacillus has demonstrated superiority in maintenance of gut integrity and restoration of the immunological balance [48]. It has also shown promising results in reducing the incidence of pouchitis in UC patients versus a placebo group, and it is frequently used as an adjunctive post diarrheal treatment [49,50].

The adjunct use of probiotics, regardless of the exact genera and combination, is beneficial if added to the standard treatment, mainly 5- ASA. According to a Cochrane review postulated that probiotics can maintain remission of UC with above average quality of evidence. This opens up the possibility of expanding future research and utilizing up to date laboratory investigations [51].

Fig. 5. Probiotics and azithromycin could reduce the DSS-induced histopathological changes. (A) Histological examination of colon tissues in different study groups. Normal control group: uniform colonic tissue, showing regular epithelial cell covering (Black arrow), overlying lamina propria displaying few chronic inflammatory cell infiltrates (Arrow- heads) with uniform mucous secreting colonic glands (Red arrows). Probiotic and azithromycin control groups: uniform mucous secreting colonic glands (Red arrowheads).

DSS-colitis group: there is dense chronic lympho-plasmacytic infiltrate involving the whole colonic wall, filling the whole lamina propria (Black arrows) and extending through musclaris mucosa (Red arrowhead) into submucosa (Red arrows) and downwards. There are areas of complete drop out glands. Some inflammatory cells are attacking glands (Arrowhead) and areas of edema (Dark blue arrows). 5-ASA, probiotics, azithromycin and combination of probiotic and azithromycin treatment groups: there is restoration of intestinal tissue normal architecture, with mild to less inflammation and edema in mucosa (Black arrows), mild or no crypt irregularity is seen (Red arrows); (200x). (B) Histopathological score of colon tissues as explained in methods.

One-way ANOVA analysis (n=8). * P<0.05,

** P<0.01 and *** P<0.001 contrary to the control group, ^###P<0.001 contrary to DSS group, and ^$$$P<0.001 contrary to DSS+Probiotics-treated group. Pro: Probiotics, Aza: azithromycin. DSS: Dextran sodium sulfate.

(11)

9

Fig. 6. Probiotics and azithromycin could minimize TLR4 and NF-κB expression immunohistochemically in colonic tissue. (A) Normal control group: Negative expression of TLR4 and NF-κB. (B-C) Probiotic and azithromycin control groups: Weak focal expression of TLR4 and NF-κB in colonic surface epithelium (Black arrows) and some glandular epithelium (Red arrows), as well as lamina propria inflammatory cells (Arrowheads). (D) DSS-colitis group: there is strong positive reaction to TLR4 and NF- κB in both mucosal glands (Black arrows) and inflammatory cells in lamina propria (Red arrows). (E) 5-ASA- treated group: There is mild to moderate positive reaction to TLR4 and NF-κB in surface epithelium (Black arrows), mucosal glands (red arrows) and inflammatory cells in lamina propria (Arrowheads). (F) Probiotics-treated group: there is focal mild to moderate expression of TLR4 and NF-κB. (G) Azithromycin-treated group: there is focal mild to moderate expression of TLR4 and NF-κB in surface epithelial cells (Black arrows) and mucosal inflammatory cells (Arrowheads). However, its expression in glandular epithelial cells is weak (Red arrow). (H) Com- bination of probiotic and azithromycin-treated group:

there is very weak expression of TLR4 and NF-κB; (400x).

(I-J) TLR4 and NF-κB positive cells percentage in colonic tissues. One-way ANOVA analysis (n=8). * P<0.05,

** P<0.01 and *** P<0.001 contrary to the control group, ^###P<0.001 contrary to DSS group^{, $$$}P<0.001 contrary to DSS+Probiotics-treated group, and

+++P<0.001 contrary to DSS+Azithromycin-treated group. Pro: Probiotics, Aza: azithromycin. DSS: Dextran sodium sulfate, TLR4: Toll-Like Receptor 4 and NF-κB:

nuclear factor kappa B.

(12)

Bacterial load and metabolism are often presented in the context of explaining the pathogenesis of UC. Therefore, it’s reasonable to adopt the fact that antibiotics might have a role in alleviating mucosal inflammation in UC. Despite that, antibiotics usage in the treatment of IBD in general and UC in particular; have not been popular due to the fear of development of dysbiosis or the emergence of antibiotic resis- tance. Their use has been limited to the treatment of complications such as pouchitis, post-operative recurrence, or presurgical prophylaxis [52].

Azithromycin is a well characterized macrolide antibiotic that is mainly used to treat bacterial respiratory infections. Nonetheless, numerous experimental studies have demonstrated its immunomodulatory and anti-inflammatory activities [53,54].

As a result, we aimed to evaluate and explain the potentially beneficial roles of probiotics and azithromycin on the clinical course of DSS- induced colitis, both as standalone treatments and in combination.

Administration of DSS in our study induced changes in intestinal flora with invasion of the submucosa and stimulated the immunological and inflammatory responses of the colonic tissue-inducing colitis. DSS- induced TLR4 activation with subsequent NF-κB activation, leading to upregulation of pro-inflammatory cytokines and iNOS with exaggerated production of ROS. Subsequently, these alterations could induce intense and prolonged inflammation with further cell and tissue injury and damage that was confirmed by histopathological and immunohistochemical results. These effects of DSS were reversed by oral monotherapy with probiotics or azithromycin and their combined therapy.

The results displayed that both probiotics and azithromycin could remarkably alleviate colonic damage in the form of improved DAI, MDI and the colon length as well as a decrease in stool consistency and bleeding scores. A marked decline in the percentage change of BW and the colon index with were also noted. Amelioration of the pro- inflammatory milieu was presented as significant downregulation of TNFα, IL1β, IL6 but upregulation of the anti-inflammatory IL10 suggesting a strong shift toward the anti-inflammatory state. Moreover, significant relief of the oxidative stress injury was manifested by a decline in MDA with an exaggerated elevation in oxidative stress pro- tectors, GSH and SOD, as well as inactivation of iNOS expression. These previous beneficial effects of probiotics and azithromycin could be due to their inhibitory effects of TLR4-NF-κB and p38-MAPK signal pathway.

These results suggest multifactorial synergistic approach of the concurrent usage of probiotics and azithromycin in UC.

What was interesting is that the aforementioned changes were observed upon administration of each agent alone, and they were similar to the effects seen with the standard treatment, 5-ASA. While, the effects of azithromycin alone were highly comparable to 5-ASA treatment.

Moreover, these beneficial effects of probiotics and azithromycin were significantly amplified when they were both combined, exceeding the pharmacological effects of 5-ASA. The combination of both agents had a synergistic effect that could be attributed to their quite similar molecular mechanisms. That’s why their effect is augmented when they are used together that even surpluses the standard treatment i.e. 5-ASA. This offers a new insight into the usage of the probiotics and/or Azithromycin either as maintenance or adjuvant therapy in UC and opens a new ho- rizon for investigating the underlying mechanisms, which ultimately offers a better quality of care to UC patients in the near future.

In agreement with our results, oral administration of different preparations of probiotics, such as Lactobacillus plantarum, fermentum, and bifidobacterium, revealed a remarkable decline in DAI and in the production of pro-inflammatory cytokines and iNOS, together with significant histological improvement and reshaping of the gut [55,56].

In addition to modulation of oxidative stress markers with a remarkable suppression of the TLR4/NF-κB pathway by probiotics administration [57,58]. A comparable study emphasized that the usage of Lactobacillus improved trinitrobenzene sulfonic acid (TNBS)-induced UC to an extent similar to that seen with 5-ASA administration [59].

As emphasized in our study, azithromycin has immunomodulatory and anti-inflammatory actions that are mainly achieved through

suppression of pro-inflammatory milieu as IL1, 6 and 8 and TNFα and controlling the neutrophil and monocyte activity via inhibiting nuclear translocation of NF-κβ subunits [53,54]. Moreover, azithromycin administration resulted in the alleviation of the inflammatory status in systemic lupus erythematous (SLE), a chronic inflammatory disease with an autoimmune background similar to UC. Azithromycin therapy significantly reduced inflammatory milieu, iNOS, and TLR4 expression in a lupus mouse model [60].

P38-MAPK is activated in the DSS-induced colitis rats through DSS- induced phosphorylation of p38-MAPK. This phosphorylation regu- lates the inflammatory outcome by exaggerated production and release of inflammatory and oxidative stress markers via activating NF-κB.

These effects were antagonized by the oral administration of probiotics and azithromycin alone or in combination.

In agreement with our trail, the usage of Lactobacillus plantarum and delbrueckii lowered the inflammatory outcome-induced by E. coli by modulating the TLR, NF-κB, and MAPK pathways [61]. Next generation probiotics also operate in a similar way, mainly by inhibiting NF-κB pathway which in turn suppresses TNFα production [62]. This supports the fact that these agents primarily target this pathway, regardless of the exact molecular events to alleviate intestinal immunopathology in UC.

In addition, recent studies have shown that azithromycin and other macrolides can inhibit the MAPK pathway to ameliorate cellular stress and protect cellular barriers by reducing the inflammatory response and modulating the NF-κB signal pathway [63–65].

CSY0073, a macrolide mimetic lacking antimicrobial effect, attenu- ated nuclear translocation of NF-κB and prevented its isomerization with its canonical subunits, which eventually mitigated its signaling pathway both in DSS and TNBS-induced colitis. This was by a reduction of the inflammatory response with a noticeable improvement in microscopic and macroscopic activity scores by a remarkable 50–70%. This collec- tive effect is well comparable to standard treatment as 5-ASA, steroids and sulfasalazine’s [66].

A recent clinical trial was conducted on mild to moderately affected UC patients who were followed up for twelve weeks after administration of probiotics in addition to a health management system. Body mass index was increased in the treated versus the placebo group. A similar improvement in the nutritional status was noticed in the form of increased levels of albumin, total protein, and haemoglobin. Inflam- matory markers were significantly declined. Also, the quality-of-life scores were also considerably improved. This is a real world example of the beneficial role of probiotics in ameliorating the clinical status of UC patients [67].

A systematic review recently highlighted the concurrent usage of azithromycin in combination with metronidazole for stimulating remission in mild to moderate Crohn’s disease versus solely using metronidazole [68]. In consistent with our findings, recent report demonstrated that the combined probiotics and amoxicillin therapy could prevent the DSS/LPS-induced acute diverticulitis with more pro- tective effects versus the amoxicillin therapy [69].

In conclusion, we are aware of no other study that has examined the interaction between probiotics and antibiotics, namely azithromycin, in alleviation of UC. Our results showed a synergistic effect of using both agents in improving DSS induced colitis in rats. The previous reports suggest that their molecular mechanisms are quite similar. That’s why their effect is augmented when they are used together that even surpluses the standard treatment i.e. 5-ASA. Both agents illustrated anti- inflammatory, antioxidant, and immunomodulatory properties. More- over, the outcome of azithromycin on p-38 MAPK signaling in UC is scarcely studied. This practice needs more evidence prior to accepting its implementation. Our research adds some experimental evidence that probiotics and antibiotics can be used as a maintenance or curative agent in the treatment of UC. Adding those agents separately or in combination to standardized regimens augments their action and en- riches the mechanisms that help equilibration between the pro- inflammatory and the anti-inflammatory agents. This serves as an

(13)

11 alternate preventive strategy for UC and boost the quality of life of their patients.

Ethics approval and consent to participate

All the experiments of this study were licensed by the Institutional Ethical Animal Care and Use Committee at Faculty of Medicine, SCU, Egypt (Research 4675 #). The committee regulations are compatible with the Guide for the Care and Use of Laboratory Animals by the Na- tional Institutes of Health (USA).

Funding statement

This work is funded by all authors of Faculty of Medicine, Suez Canal University, Ismailia, Egypt. Also, funded by Princess Nourah bint Abdulrahman University by Supporting Project number (PNURSP2023R165), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia.

CRediT authorship contribution statement

Shereen E. Elkholy: Conceptualization, Methodology, Validation, Formal analysis, Investigation, Resources, Visualization, Funding acquisition, Writing – original draft, Writing – review & editing. Shy- maa Ahmad Maher: Methodology, Validation, Resources, Investiga- tion, Funding acquisition, Writing – review & editing. Noura R. Abd el- hamid: Methodology, Validation, Resources, Investigation, Funding acquisition, Writing – original draft, Writing – review & editing. Heba A.

Elsayed: Validation, Resources, Funding acquisition, Writing – original draft, Writing – review & editing. Wael Abdou Hassan: Validation, Resources, Visualization, Funding acquisition, Writing – review &

editing. Asmaa K.K. Abdelmaogood: Validation, Resources, Funding acquisition, Writing – original draft, Writing – review & editing. Samar M. Hussein: Validation, Resources, Formal analysis, Funding acquisition, Writing – original draft, Writing – review & editing. Mariusz Jaremko: Funding acquisition, Writing – review & editing. Samar Zuhair Alshawwa: Funding acquisition, Writing – review & editing.

Hanan M. Alharbi: Funding acquisition, Writing – review & editing.

Samar Imbaby: Conceptualization, Methodology, Validation, Formal analysis, Investigation, Resources, Visualization, Funding acquisition, Writing – original draft, Writing – review & editing.

Declaration of Competing Interest The authors declare no conflict of interest.

Data Availability

Data will be made available on request.

Acknowledgments

The authors extend their appreciation to Faculty of Medicine, Suez Canal University, Ismailia, Egypt and Princess Nourah bint Abdulrah- man University for funding this work through Researchers Supporting Project number (PNURSP2023R165), Princess Nourah bint Abdulrah- man University, Riyadh, Saudi Arabia.

Appendix A. Supporting information

Supplementary data associated with this article can be found in the online version at doi:10.1016/j.biopha.2023.115005.

References

[1] L. Aldars-García, A.C. Marin, M. Chaparro, J.P. Gisbert, The interplay between immune system and microbiota in inflammatory bowel disease: a narrative review, Int. J. Mol. Sci. 22 (2021) 3076, https://doi.org/10.3390/ijms22063076.

[2] Y. Li, M. Zhang, H. Xiao, H. Fu, A. Ho, C. Lin, Y. Huang, G. Lin, Z. Bian, Addition of berberine to 5-aminosalicylic acid for treatment of dextran sulfate sodium-induced chronic colitis in C57BL/6 mice, PLOS ONE 10 (2015), e0144101, https://doi.org/

10.1371/journal.pone.0144101.

[3] F.S. Samman, S.M. Elaidy, S.S. Essawy, M.S. Hassan, New insights on the modulatory roles of metformin or alpha-lipoic acid versus their combination in dextran sulfate sodium-induced chronic colitis in rats, Pharmacol. Rep. 70 (2018) 488–496, https://doi.org/10.1016/j.pharep.2017.11.015.

[4] Y. Chen, J. Si, W. Liu, J. Cai, Q. Du, L. Wang, M. Gao, Induction of experimental acute ulcerative colitis in rats by administration of dextran sulfate sodium at low concentration followed by intracolonic administration of 30% ethanol, J. Zhejiang Univ. Sci. B 8 (2007) 632–637, https://doi.org/10.1631/jzus.2007.B0632.

[5] B. Chassaing, J.D. Aitken, M. Malleshappa, M. Vijay-Kumar, Dextran sulfate sodium (DSS)-induced colitis in mice, Curr. Protoc. Immunol. 104 (2014), https://

doi.org/10.1002/0471142735.im1525s104.

[6] D.D. Eichele, K.K. Kharbanda, Dextran sodium sulfate colitis murine model: an indispensable tool for advancing our understanding of inflammatory bowel diseases pathogenesis, World J. Gastroenterol. 23 (2017) 6016–6029, https://doi.

org/10.3748/wjg.v23.i33.6016.

[7] R. Atreya, M.F. Neurath, Molecular pathways controlling barrier function in IBD, Nat. Rev. Gastroenterol. Hepatol. 12 (2015) 67–68, https://doi.org/10.1038/

nrgastro.2014.201.

[8] H.S.P. de Souza, C. Fiocchi, Immunopathogenesis of IBD: current state of the art, Nat. Rev. Gastroenterol. Hepatol. 13 (2016) 13–27, https://doi.org/10.1038/

nrgastro.2015.186.

[9] A. Kałuzna, P. Olczyk, K. Komosi˙ ´nska-Vassev, The role of innate and adaptive immune cells in the pathogenesis and development of the inflammatory response in ulcerative colitis, J. Clin. Med. 11 (2022) 400, https://doi.org/10.3390/

jcm11020400.

[10] R. Toumi, I. Soufli, H. Rafa, M. Belkhelfa, A. Biad, C. Touil-Boukoffa, Probiotic bacteria Lactobacillus and Bifidobacterium attenuate inflammation in dextran sulfate sodium-induced experimental colitis in mice, Int. J. Immunopathol. Pharmacol. 27 (2014) 615–627, https://doi.org/10.1177/039463201402700418.

[11] N. Tatiya-aphiradee, W. Chatuphonprasert, K. Jarukamjorn, Immune response and inflammatory pathway of ulcerative colitis, J. Basic Clin. Physiol. Pharmacol. 30 (2018) 1–10, https://doi.org/10.1515/jbcpp-2018-0036.

[12] M.P. Espaillat, R.R. Kew, L.M. Obeid, Sphingolipids in neutrophil function and inflammatory responses: Mechanisms and implications for intestinal immunity and inflammation in ulcerative colitis, Adv. Biol. Regul. 63 (2017) 140–155, https://

doi.org/10.1016/j.jbior.2016.11.001.

[13] K. Sverrisson, J. Axelsson, A. Rippe, D. Asgeirsson, B. Rippe, Acute reactive oxygen species (ROS)-dependent effects of IL-1β, TNF-α, and IL-6 on the glomerular filtration barrier (GFB) in vivo, Am. J. Physiol. -Ren. Physiol. 309 (2015) F800–F806, https://doi.org/10.1152/ajprenal.00111.2015.

[14] H. Rafa, H. Saoula, M. Belkhelfa, O. Medjeber, I. Soufli, R. Toumi, Y. de Launoit, O. Moral`es, M. Nakmouche, N. Delhem, C. Touil-Boukoffa, IL-23/IL-17A axis correlates with the nitric oxide pathway in inflammatory bowel disease:

immunomodulatory effect of retinoic acid, J. Interferon Cytokine Res. 33 (2013) 355–368, https://doi.org/10.1089/jir.2012.0063.

[15] Y. Ishiguro, T. Ohkawara, H. Sakuraba, K. Yamagata, H. Hiraga, S. Yamaguchi, S. Fukuda, A. Munakata, A. Nakane, J. Nishihira, Macrophage migration inhibitory factor has a proinflammatory activity via the p38 pathway in glucocorticoid- resistant ulcerative colitis, Clin. Immunol. 120 (2006) 335–341, https://doi.org/

10.1016/j.clim.2006.05.010.

[16] A.A. Soubh, D.M. Abdallah, H.S. El-Abhar, Geraniol ameliorates TNBS-induced colitis: involvement of Wnt/β-catenin, p38MAPK, NFκB, and PPARγ signaling pathways, Life Sci. 136 (2015) 142–150, https://doi.org/10.1016/j.

lfs.2015.07.004.

[17] O.J. Broom, B. Widjaya, J. Troelsen, J. Olsen, O.H. Nielsen, Mitogen activated protein kinases: a role in inflammatory bowel disease, Clin. Exp. Immunol. 158 (2009) 272–280, https://doi.org/10.1111/j.1365-2249.2009.04033.x.

[18] L.F. Iannone, L. Bennardo, C. Palleria, R. Roberti, C. De Sarro, M.D. Naturale, S. Dastoli, L. Donato, A. Manti, G. Valenti, D. D’Amico, S. D’Attola, A.E. De Francesco, V. Bosco, E. Donato Di Paola, S.P. Nistico, R. Citraro, E. Russo, G. De ` Sarro, Safety profile of biologic drugs for psoriasis in clinical practice: an Italian prospective pharmacovigilance study, PLOS ONE 15 (2020), e0241575, https://

doi.org/10.1371/journal.pone.0241575.

[19] S. Katz, G.R. Lichtenstein, M.A. Safdi, 5-ASA dose-response, Gastroenterol.

Hepatol. 6 (2010) 1–16.

[20] Y.R. Yu, J.R. Rodriguez, Clinical presentation of Crohn’s, ulcerative colitis, and indeterminate colitis: Symptoms, extraintestinal manifestations, and disease phenotypes, Semin. Pediatr. Surg. 26 (2017) 349–355, https://doi.org/10.1053/j.

sempedsurg.2017.10.003.

[21] D.H. Ziada, H.H. Soliman, S.A. El Yamany, M.F. Hamisa, A.M. Hasan, Can Lactobacillus acidophilus improve minimal hepatic encephalopathy? A neurometabolite study using magnetic resonance spectroscopy, Arab J.

Gastroenterol. 14 (2013) 116–122, https://doi.org/10.1016/j.ajg.2013.08.002.

[22] F. Ferretti, R. Cannatelli, M.C. Monico, G. Maconi, S. Ardizzone, An update on current pharmacotherapeutic options for the treatment of ulcerative colitis, J. Clin.

Med. 11 (2022) 2302, https://doi.org/10.3390/jcm11092302.