Optimization of Saanen sperm genes amplification - Springer

(1)

ORIGINAL RESEARCH

Optimization of Saanen sperm genes amplification: evaluation of standardized protocols in genetically uncharacterized rural goats reared under a subtropical environment

Elie K. Barbour_&Maya F. Saade_&Fawwak T. Sleiman_&

Shady K. Hamadeh_&Youssef Mouneimne_&

Zeina Kassaifi&Ghazi Kayali&Steve Harakeh&

Lina S. Jaber&Houssam A. Shaib

Accepted: 27 January 2012 / Published online: 18 February 2012

#Springer Science+Business Media B.V. 2012

Abstract The purpose of this research is to optimize quantitatively the amplification of specific sperm genes in reference genomically characterized Saanen goat and to evaluate the standardized protocols applicability on sperms of uncharacterized genome of rural goats reared under subtropical environment for inclusion in future selection programs. The optimization of the protocols in Saanen sperms included three production genes (growth hormone (GH) exons 2, 3, and 4, αS1-casein (CSN1S1), and α-lactalbumin) and two health genes (MHC class II DRB and prion (PrP)). The optimization was based on varying the primers concentrations and the inclusion of a PCR cosolvent (Triton X). The impact of the studied variables on statistically significant increase in the

yield of amplicons was noticed in four out of five (80%) optimized protocols, namely in those related to GH, CSN1S1, α-lactalbumin, and PrP genes (P<0.05). There was no significant difference in the yield of amplicons related to MHC class II DRB gene, regardless of the variables used (P>0.05). The applicability of the optimized protocols of Saanen sperm genes on amplification of uncharacterized rural goat sperms revealed a 100% success in tested individuals for amplification of GH, CSN1S1,α-lactalbumin, and MHC class II DRB genes and a 75% success for the PrP gene. The significant success in applicability of the Saanen quantitatively optimized protocols to other uncharacterized genome of rural goats allows for their inclusion in future selection, targeting the sustainability of this farming system in a subtropical environment and the improvement of the farmers livelihood.

Keywords Sperm . Gene amplification . Optimization . Applicability . Rural goats

Introduction

The rural fertile area in this planet is estimated at 38% (World Bank2007), having a great potential for goat farming, hoping to provide food security and better livelihood to their poor communities that add up to around 3.35 billion (World Bank 2009). Most of the rural goat herds are genetically uncharacterized, hindering the selection programs based on specific production and health gene markers (Fontanesi et al. 2010).

The Saanen goat is highly productive (Norris et al.2010) and most of its genetic makeup is characterized (de Araújo et al.

2006), thus allowing for its use as a reference genetic material for developing protocols of genetic characterization that could E. K. Barbour (*)

:

M. F. Saade

:

F. T. Sleiman

:

S. K. Hamadeh

:

L. S. Jaber

:

H. A. Shaib

Animal and Veterinary Sciences Department, Faculty of Agricultural and Food Sciences (FAFS), American University of Beirut (AUB),

P.O.Box 11-0236, Beirut, Lebanon e-mail: [email protected] Y. Mouneimne

Physics Department, Faculty of Arts and Sciences, AUB, Beirut, Lebanon

Z. Kassaifi

Nutrition and Food Sciences, FAFS, AUB, Beirut, Lebanon

G. Kayali

World Health Organization Laboratory, St. Jude Children Research Hospital, Memphis, TN, USA

S. Harakeh

King Fahad Medical Research Center, King Abdul Aziz University, Jeddah 21589, Saudi Arabia

(2)

be applicable to program implementation on genetically uncharacterized herds of the subtropical environment. This preparation for future selection will help in sustainability and expansion of this agriculture system, providing better livelihood to the poor by providing food security in rural areas and preventing the migration to overcrowded cities (Dubeuf and Boyazoglu2009).

Important genes that could be characterized include those related to production and health. The production genes of paramount importance include the growth hormone (GH), αS1-casein (CSN1S1), and α-lactalbumin. The selection based on certain polymorphism in GH (Hua et al. 2009), CSN1S1 (Pagano et al.2010), andα-lactalbumin (Jain et al.

2009) is well documented; moreover, the selection based on specific polymorphism in MHC class II DRB (Mainguy et al.2007) and prion (PrP) (Papasavva-Stylianou et al.2007) helps in selecting goats with respective high immunity potential (Mainguy et al.2007) and resistance to scrapie prions involved in zoonoses (Collinge2010).

The prerequisite for detection of such polymorphism is to optimize the amplification procedures for these gene markers in a reference genetic material that is already characterized (Fontanesi et al.2010; Phua et al.2003) and well known to the goat industry around the world (Food and Agriculture Organization2008). Another prerequisite is to have a pilot evaluation of the applicability of such protocols, which are optimized in sperm genes of Saanen, to sperms of genetically uncharacterized rural goats (Rahman et al.

2008). The success of such applicability will yield enough amplicons quantities needed for determination of polymorphism types, upon which the selection program for rural goats will rely on.

The purpose of this research is to quantitatively optimize five protocols for amplification of productive (GH, CSN1S1, andα-lactalbumin) and health (MHC class II DRB and PrP) genes in reference sperms of Saanen goats, whose country of origin is in a continental transition type of climate (46°29′N latitude and 0°02′E longitude), and to evaluate their applicability in uncharacterized genomes of rural goats, reared in a subtropical zone of the earth (33°00′N latitude and 35°50′E longitude).

Materials and methods

The accomplishment of this research required the availabil- ity of a reference male Saanen goat, imported from Curzay- sur-Vonne in France. The sperms of this goat were used for optimization of the five amplification procedures related to three production and two health genes. In addition, male rural goats with unidentified genome were included in the evaluation of the applicability of the optimized protocols.

Details of this design and analysis are described below.

Animals and semen collection

The age of the reference male Saanen goat and the male rural goats ranged between 1.5–3 years. The rearing of these goats was at a latitude and longitudinal location of the planet equivalent to 33° 32′07″N and 35° 33′04″E, respectively.

The semen samples were collected in situ, using an electro- ejaculator (Standard Precision Electronics, Inc., Denver, CO, USA) (Souza et al. 2009). The semen samples were collected in sterile cups, transported over ice, and subjected to DNA extraction of its spermatozoa.

DNA extraction from spermatozoa

The DNA extraction from spermatozoa present in semen samples was accomplished by the QIAamp® DNA mini kit (QIAGEN Gmbh, D-40724 Hilden, Germany), following the manual instructions of the manufacturer. Briefly, a vol- ume of 200 μl of semen is used in the first reaction with 20μl of proteinase K, followed by vortexing with 200μl of buffer AL (provided by the kit), and another reaction with 200μl of pure ethanol. The DNA of sperms was eluted from QIAamp mini spin by 200μl of buffer AE (provided also by the kit). The eluted DNA was stored at−20°C for quantitative optimization of the five genes amplifications.

Quantitative optimization of amplification

The quantitative optimization of the amplification of the three production and two health-related genes of the extracted goat sperm DNA was accomplished, due to the fact that there is no single set of conditions that is optimal for all amplifications (Grunenwald2003). Optimization of a conventional polymerase chain reaction (PCR) involves various parameters, among which are mainly the template DNA and primers concentrations, PCR cosolvents such as Triton X, and the PCR cycling conditions. The optimization of such protocols will help successors to avoid repeating such a lengthy standardization, thus enhancing the implementation of programs related to goat selection. The following are the quantitative optimization steps for each of the five genes.

Growth hormone gene amplification

The quantitative optimization of the amplification of exons 2, 3, and 4 of the Saanen sperm GH gene was done by varying the concentrations of the primers, while keeping the sperm DNA and cycling conditions constant. The constants in the 50-μl PCR reaction were: DNA (93.0 ng/2μl), the 25μl of REDTaq® Ready Mixture™ (Sigma-Aldrich, Inc. 3050 Spruce Street, Saint Louis, MO, 63103 USA), and the iCycler thermal conditions of 94°C for 5 min, 35 cycles of 95°C for

(3)

30s, 59°C for 30 s, 72°C for 45 s, a final extension at 72°C for 7 min, and a holding time of 16 h at 4°C. The variable was the primers used at 0, 10, and 20 pmol/50μl of reaction mixtures.

The primers were GH1F (5’CTCTGCCTGCCCTGGACT3’), GH1R (5’GGAGGAGCAGAAGGCAACC3’), GH2F (5’TCAGCAGAGTCTTCACCAAC3’), a n d G H 2 R (5’CAACAACGCCATCCTCAC3’), reported previously by Hua et al. (2009). The PCR amplicons were banded on 2% agarose gel (100 V, 500 mA, 50 min) in TAE buffer, stained with ethidium bromide (0.5 μg/ml) for 30 min, visualized under UV light, using GelDoc system, and the image of the banded amplicons was saved on the computer, integrated to the GelDoc system, for later quantitative analysis of the mean intensity scores of the banded amplicons and statistical comparison of the means of amplicons resulting from varying the primers concentrations.

αS1-casein gene amplification

The quantitative optimization of the amplification of the Saanen sperm CSN1S1 gene was done by varying the concentrations of the primers too. The constants in the 50-μl PCR reaction mixture were: DNA (93.0 ng/2μl), the 25μl of the REDTaq® Ready Mixture^TM, and the cycling conditions of initial cycle at 97°C for 2 min, 60°C for 45 s, 72°C for 2 min and 30 s, 30 cycles of 94°C for 45 s, 60°C for 45 s, 72°C for 2 min and 30 s, and an extension step at 72°C for 10 min. The variable was the primers used at 0-, 50-, 100-, and 150-pmol/

50μl mixtures. The primers were S1F (5′TTCTAAAAGTCT CAGAGGCAG3′) and S1R (5′GGGTTGATAGCCTTG TATGT3′), previously reported by Ramunno et al. (2000).

The banding, visualization, and quantitative analysis procedures for amplicons were similar to those described under GH gene amplification.

α-Lactalbumin gene amplification

The quantitative optimization of the amplification of exon I of the Saanen spermα-lactalbumin gene was done by inclusion or exclusion of Triton X (10% level) and varying the primers concentrations, while keeping the sperm DNA, and cycling conditions constant. The constants in the 50-μl PCR reaction mixture were: DNA (93.0 ng/2μl), the 25 μl of REDTaq®

Ready Mixture™, and the iCycler thermal conditions of an initial denaturation at 95°C for 5 min, 40 cycles of 95°C for 30 s, 62°C for 30 s, 72°C for 30 s, a final extension at 72°C for 5 min, and a holding time of 16 h at 4°C. The primers concentrations of 0, 80, 120, and 160 pmol were evaluated in the PCR reactions. The primers were the LacF (5′CTCTTGCTGGATG TAAGGCTT3′) and LacR (5′AGCCTGGGTGGCATG GAATA3′), previously described by Kumar et al. (2006). The banding, visualization, and quantitative analysis procedures for

amplicons were similar to those described under GH gene amplification.

MHC class II DRB gene amplification

The quantitative optimization of the amplification of the second exon of the Saanen sperm MHC class II DRB gene was done by varying the primers concentration, while keeping the sperm DNA, and cycling conditions constant. The constants in the 50-μl PCR reaction were: DNA (93.0 ng/2μl), the 25 μl of the REDTaq® ready Mixture^TM, and the iCycler thermal conditions at 30 cycles of 94°C for 1 min, 60°C for 1 min and 30 s, and 72°C for 2 min, and a holding time of 16 h at 4°C. The primers concentration variable was set at 0, 20, 40, and 50 pmol. The primers were the DRB1: 5′

TATCCCGTCTCTGCAGCACATTTC3′ and DRB2: 5′ TCGCCGCTGCACACTGAAACTCTC3′, previously described by Ahmed and Othman (2006). The banding, visualization, and quantitative analysis procedures for amplicons were similar to those described under GH gene amplification.

PrP prion gene amplification

The quantitative optimization of the amplification of the Saanen sperm PrP gene was done by varying the primers concentration, while keeping the sperm DNA, and cycling conditions constant. The constants in the 50-μl PCR reaction mixture were the DNA (93.0 ng/2μl), the 25μl of the REDTaq® Ready Mixture™, and the iCycler thermal conditions of 95°C for 5 min, 40 cycles at 96°C for 2 min, 60°C for 2 min, 72°C for 3 min, and final extension of 72°C for 7 min, and holding at 4°C for 16 h. The primers variable was set at 0, 10, 20, and 40 pmol. The primers were G1 (5′

ATGGTGAAAAGCCACATAGGCAGT3′) and G2 (5′

CTATCCTACTATGAGAAAAATGAG3′), previously reported by Billinis et al. (2002). The banding, visualization, and quantitative analysis procedure for amplicons were similar to those described under“GH gene amplification”.

Quantitative analysis of amplicons yield

The intensity of each banded amplicon saved in the computer was read in optical density (OD) units at five randomly chosen areas of the band, with constant pixels number/band area equivalent to 6 pixels (Quantity One, Bio-Rad Labora- tories, 1000 Alfred Nobel Drive Hercules, CA 94547, USA). The intensity score at each of the five points was calculated by the following transformation formula: intensity score0100−(OD×100/negative control OD). The negative control is always included in the PCR trials, using the same components of the reactants in the PCR mixture, while ex- cluding the primers from the reaction. The mean intensity

(4)

score is calculated from the sum of the five intensity scores of a band and divided by 5.

Statistics

The comparison of mean intensity scores of banded amplicons resulting from the variables used in each optimization of gene amplification is performed by one-way ANOVA, and significant differences were reported atP<0.05.

Applicability of optimized amplifications

The applicability of the five optimized amplifications, using Saanen sperm GH, CSN1S1,α-lactalbumin, MHC class II DRB, and PrP, on rural goat sperm genes, with a previous history of uncharacterized genome, was performed. Four main rural breeder male goats were chosen, and their semen and DNA extracts were collected according to the protocol described for the Saanen goat. Protocols for amplification were adopted according to maximum quantities of amplicon yields, deduced from the statistically analyzed mean intensity score. The percent success in applicability of the reference Saanen goat-optimized protocols to rural goat sperms was deduced from the frequency of individual rural goats manifesting amplicon size bands similar to those obtained from the Saanen sperms.

Results and discussion

The optimization of sperm genes amplification in Saanen goats, imported from a continental—transition type of climate and its possible applicability on uncharacterized genome of rural goats, reared in a subtropical zone of our planet—will help in future selection programs for better goat production and protection and in improving the livelihoods of goat farmers in hot climates. The data for the quantitative optimization of the amplification of GH, CSN1S1, α-lactalbumin, MHC class II DRB, and PrP genes are demonstrated in Tables 1, 2, 3, 4, and 5, respectively. The variation in the primers used for exons 2, 3, and 4 of sperm GH gene of reference Saanen (10 and 20 pmol) resulted in significant differences of the exon 4 band yield (P< 0.05) but not the exons 2 and 3 (P> 0.05) (Table 1); the optimized protocol is adopted, according to the maximum band amplification, obtained at primers concentration of 20-pmol/50 μl PCR mixture.

This data agrees with previous reports related to variations in amplification yield of different exons within the same gene (Hua et al. 2009).

The use of different primers concentrations (50, 100, and 150 pmol) for the CSN1S1 gene amplification of Saanen sperms resulted in significant differences of the band yield

(P<0.05) (Table 2), with a maximum quantity obtained at primers concentration of 50 pmol, a value that is going to be adopted for the optimized protocol. It is worth noting that the relationship between primers concentrations and the band yield of CSN1S1 is not a linear one, an observation that is previously reported in certain instances in other gene amplification standardization (Pellestor2006).

The impact of varying the primers concentration (8, 120, and 160 pmol), in presence and absence of Triton X, on increasing the yield in amplicons of Saanen α-lactalbumin was linear (Table 3). There were significant yield differences, in absence of Triton X, at primers concentrations of 120 and 160 pmol, compared to the yield obtained by the 80 pmol (P<0.05); however, the presence of Triton X at primers concentrations of 160 pmol had higher yields compared to lower primers concentrations (P< 0.05). The Table 1 Quantitative optimization of GH gene amplification in reference Saanen goat sperms with variable primers concentrations Primers^aconcentrations

(pmol/50μl PCR mixture) Mean intensity score^bof GH amplicon band

Exons 2 and 3 Exon 4

0 2.32a 2.32a

10 13.92b 30.09b

20 14.23b 44.01c

Mean intensity score in a column followed by different lowercase letters are significantly different (P<0.05)

aPrimers GH1F and GH1R were used in PCR of exons 2 and 3, while the GH2F and GH2R were used for exon 4

bMean intensity score is calculated from the relationship of 100−

(OD×100/OD of negative control). The negative control included in the PCR reaction has all reactants except the primers. The intensity of five randomly chosen areas on each band (6 pixels/area) was recorded, and their mean was calculated

Table 2 Quantitative optimization of CSN1S1 gene amplification in reference Saanen goat sperms with variable primers concentrations Primers^aconcentrations

(pmol/50μl PCR mixture) Mean intensity score^bof CSN1S1 amplicon band

0 1.90a

50 71.62b

100 61.56c

150 69.72b

aPrimers S1F and S1R were used in amplification

bMean intensity score is calculated from the relationship of 100− (OD×100/OD of negative control). The negative control included in the PCR reaction has all reactants except the primers. The intensity of five randomly chosen areas on each band (6 pixels/area) was recorded, and their mean was calculated

(5)

highest band yield was obtained at primers level of 160 pmol in presence of Triton X. The amplification of theα- lactalbumin gene seems to be affected with the increase in the primers concentration and the inclusion of the Triton X.

Previous works demonstrated a better amplicon yield for other genes in presence of Triton X, due to its role in improving the enzymatic reactions on the DNA substrate (Grunenwald2003).

The amplicon yield of Saanen sperm MHC class II DRB gene was not affected significantly by the variation

of the primers concentrations set at 20, 40, and 50 pmol (P> 0.05) (Table 4); however, the yield in all primers concentrations was acceptable, ranging in mean intensity from 54.1 to 57.5. The lowest primers concentration of 20 pmol is adopted in the optimized protocol for economizing.

The amplicon yield of Saanen sperm PrP gene was affected significantly by the variation of the primers concentrations (10, 20, and 40 pmol), with the highest yield obtained at 20 pmol compared to the 10 and 40 pmol (P<

0.05) (Table5). The 20 pmol of the primers is adopted in the optimized protocol.

The constant level of the reactants and the optimized primers concentrations deduced from Tables 1, 2, 3, 4, and 5 resulting in the highest amplicon yields of the five genes are compiled in Table 6. This table clearly shows the variation in primers concentrations for optimal amplification of the five genes, and it shows differences in the thermal conditions that were chosen based on a previous experience with the standardization of mammalian genes amplification.

The evaluation of the applicability of the Saanen- optimized protocols on amplification of the five genes in rural goats, with uncharacterized genomes, is shown in Fig. 1. A 100% success in applicability of the four optimized Saanen protocols for sperm GH, CSN1S1, α- lactalbumin, and MHC class II DRB genes was obtained in the randomly chosen rural goat breeders sperms, revealing the same size of banded amplicons, as that obtained by the Saanen sperms (Fig.1a–d).

Moreover, the optimized Saanen protocol for sperm PrP gene had a 75% success in applicability on rural goats, revealing the same amplicon sizes of their sperms in three out of four tested rural goats (Fig1e, lanes 3, 4, and 6). The optimized protocol for PrP gene failed in the amplification Table 5 Quantitative optimization of PrP gene amplification in reference Saanen goat sperms with variable primers concentrations Primers^aconcentrations

(pmol/50μl PCR mixture) Mean intensity score^bof PrP amplicon band

0 1.2a

10 78.6b

20 98.5c

40 24.4d

aPrimers G1 and G2 were used in the amplification

Table 4 Quantitative optimization of exon 2 of MHC class II DRB gene amplification in reference Saanen goat sperms with variable primers concentrations

Primers^aconcentrations

(pmol/50μl PCR mixture) Mean intensity score^bof exon 2-MHC class II DRB amplicon band

0 3.0a

20 56.2b

40 54.1b

50 57.5b

aPrimers DRB1 and DRB2 were used in the amplification

Table 3 Quantitative optimization ofα-lactalbumin gene amplification in reference Saanen goat sperms with variable primers concentrations and Triton X inclusion or exclusion

Primers^aconcentrations

(pmol/50μl PCR mixture) Mean intensity score^bofα-lactalbumin amplicon band in presence or absence of Triton X^c

Presence Absence

0 2.52a, 1 2.61a, 1

80 56.87b, 1 39.47b, 2

120 57.04b, 1 47.54c, 1

160 68.35c, 1 51.63c, 1

Mean intensity score in a column followed by different lowercase letters are significantly different (P<0.05). Mean intensity score in a row followed by different numbers (1, 2) are significantly different (P<0.05)

aPrimers LacF and LacR were used in amplification

cThe Triton X addition was 0.5μl of 10% solution in 50μl PCR mixture

(6)

of the PrP gene in one rural goat breeder (Fig.1e, lane 5), which could be due to significant difference in PrP gene sequence, not allowing the primers to complement (Hussain et al.2011).

In conclusion, the optimization resulted in different protocols of amplification for the five genes. The quantitative nature of the optimization helped in establishing the protocols that result with the maximum amplicons yield, which led to 100% success in applicability on four genes and a

75% success in applicability on the PrP gene of the rural goat sperms.

These established protocols will be indispensable for future determination of polymorphism types in these marker genes that will be used in selection of rural goats for better production, immunity, and resistance to scrapie prions, targeting the sustainability of this rural farming system, and the improvement of the farmers’livelihood in this part of the subtropical zone of our planet.

Fig. 1 Evaluation of the applicability of the Saanen-optimized protocols in amplification of the five genes in rural goats sperms with uncharacterized genome. The five parts of the figure (a–e) represent respectively the banded amplicons of sperm- GH, CSN1S1,α-lactalbumin, MHC class II DRB, and PrP genes.Lane 1ina–eis for the 100-bp marker;

lane 2inb,c, ande, andlane 7inaanddare for the negative control;lane 6inaanddandlane 7inb,c, andeare for the reference Saanen sperm gene amplification;lanes 2,3,4, and5inaanddandlanes 3,4,5, and6 inb,c, andeare for individual rural goats sperm gene amplification Table 6 Optimized protocols for amplification of the five genes in reference Saanen goat sperms DNA

Gene Concentration of primers per 50μl of PCR mixture Primers

(pmol)

Presence of Triton X

Thermal conditions

GH 20 − 94°C/15 min; 35 cycles: 95°C/30 s, 59°C/30 s, 72°C/45 s; 72°C/7 min;

4°C/16 h

CSN1S1 50 − 97°C/2 min, 60°C/45 s, 72°C/2.5 min; 30 cycles: 94°C/45 s, 60°C/45 s,

72°C/2.5 min; 72°C/10 min

α-Lactalbumin 160 + 95°C/5 min; 40 cycles: 95°C/30 s, 62°C/30 s, 72°C/30 s; 72°C/5 min;

4°C/16 h

MHC class II DRB 20 − 30 cycles: 94°C/1 min, 60°C/1.5 min, 72°C/2 min; 4°C/16 h

PrP 20 − 95°C/5 min; 40 cycles: 96°C/2 min, 60°C/2 min, 72°C/3 min; 72°C/7 min;

4°C/16 h DNA level used in all protocols was constant (93.0 ng/50μl reaction mix) (+) presence of Triton X, (−) absence of Triton X

(7)

References

Ahmed, S. and Othman, O.E., 2006. A PCR-RFLP Method for the Analysis of Egyptian Goat MHC Class II DRB Gene, Biotech- nology, 5(1), 58–61.

de Araújo, A.M., Guimarães, S.E.F., Machado, T.M.M., Lopes, P.S., Pereira, C.S., da Silva, F.L.R., Rodrigues, M.T., Columbiano, V.de S. and da Fonseca, C.G., 2006. Genetic diversity between herds of Alpine and Saanen dairy goats and the naturalized Brazilian Moxotó breed, Genetics and Molecular Biology, 29 (1), 67–74.

Billinis, C., Panagiotidis, C.H., Psychas, V., Argyroudis, S., Nicolaou, A., Leontides, S., Papadopoulos, O. and Sklaviadis, T., 2002.

Prion protein gene polymorphisms in natural goat scrapie, Journal of General Virology, 83, 713–721.

Collinge, J., 2010. Prion Strain Mutation and Selection, Science, 328,1111–1112.

Dubeuf, J.-P., and Boyazoglu, J., 2009. An international panorama of goat selection and breeds, Livestock Science, 120, 225–231.

Fontanesi, L., Martelli, P.L., Beretti, F., Riggio, V., Dall’Olio, S., Colombo, M., Casadio, R., Russo, V., and Portolano, B., 2010.

An initial comparative map of copy number variations in the goat (Capra hircus) genome, BMC Genomics, 11, 639.

Food and Agriculture Organization, 2008. The State of the World’s Animal Genetic Resources for Food and Agriculture, B. Rischkowsky and D.

Pilling (eds.), Rome, Italy. pp. 1–512.

Grunenwald, H., 2003. Optimization of Polymerase Chain Reaction.

In: M.S. John Bartlett and D. Stirling (eds), Methods in Molecular Biology: PCR Protocols, second edition, (Humana Press, Totowa, New Jersey, USA), 226, 89–99.

Hua, G.H., Chen, S.L., Yu, J.N., Cai, K.L., Wu, C.J., Li, Q.L., Zhang, C.Y., Liang, A.X., Han, L., Geng, L.Y., Shen, Z., Xu, D.Q. and Yang, L.G., 2009. Polymorphism of the growth hormone gene and its association with growth traits in Boer goat bucks, Meat Science, 81(2), 391–395.

Hussain A., Babar, M.E., Imran, M., Haq, I.U., Javed, M.M., 2011.

Detection of four novel polymorphisms in PrP gene of Pakistani sheep (Damani and Hashtnagri) and goats (Kamori and local hairy) breeds, Virology Journal, 8, 246–254.

Jain, A., Gour, D.S., Bisen, P.S., Prashant, Dubey, P.P., Sharma, D.K., Joshi, B.K., and Dinesh, K., 2009. Single nucleotide polymorphism (SNP) in alpha-lactalbumin gene of Indian Jamunapari breed ofCapra hircus,Small Ruminant Research, 82, 156–160.

Kumar, D., Gupta, N., Ahlawat, S.P.S., Satyanarayana, R., Sunder, S., and Gupta, S.C., 2006. Single strand confirmation polymorphism (SSCP) detection in exon I of theα-lactalbumin gene of Indian Jamunapari milk goats (Capra hircus), Genetics and Molecular Biology, 29(2), 287–289.

Mainguy, J., Worley, K., Côté, S., and Coltman, D., 2007. Low MHC DRB class II diversity in the mountain goat: past bottlenecks and possible role of pathogens and parasites, Conservation Genetics, 8, 885–891.

Norris, D., Ngambi, J.W., Bengi, K., Mbajiorou, C.A., 2010. Milk production of three exotic dairy goat genotypes in Limpopo province, South Africa, Asian Journal of Animal and Veterinary Advances, 6, 274–81.

Pagano, R.I., Pennisi, P., Valenti, B., Lanza, M., Di Trana, A., Di Gregorio, P., De Angelis, A. and Avondo, M., 2010. Effect of CSN1S1 genotype and its interaction with diet energy level on milk production and quality in Girgentana goats fed ad libitum, Journal of Dairy Research, 77, 245–251.

Papasavva-Stylianou, P., Kleanthous, M., Toumazos, P., Mavrikiou, P.

and Loucaides, P., 2007. Novel polymorphisms at codons 146 and 151 in the prion protein gene of Cyprus goats, and their association with natural scrapie, The Veterinary Journal, 173 (2), 459–462.

Pellestor, F., 2006. Methods in Molecular Biology—Prins and In Situ PCR protocols, 2nd ed., (Humana Press Inc., Totowa, New Jersey, USA), pp. 1–243.

Phua, A.C.Y., Abdullah, R.B. and Mohamed, Z., 2003. A PCR-based sex determination method for possible application in caprine gender selection by simultaneous amplification of the Sry and Aml-X genes, Journal of Reproduction and Development, 49(4), 307–311.

Rahman Abu Nasar, Md.A., Bin Abdullah, R., and Wan Khadijah, W.

E., 2008. A review of reproductive biotechnologies and their application in goat, Biotechnology, 7(2), 371–384.

Ramunno, L., Cosenza, G., Pappalardo, M., Pastore, N., Gallo, D., Di Gregorio, P. and Masina, P., 2000. Identification of the goat CSN1S1^F allele by means of PCR-RFLP method, Animal Genetics, 31, 333–346.

Souza, A.L., Castello, T.S., Queiroz, J.P., Barros, I.O., Paula, V.V., Oliviera, M.F., Silva, A.R., 2009. Evaluation of anesthetic protocol for the collection of semen from captive collared peccaries (Tayassu tajacu) by electroejaculation, Animal Reproduction Science, 116, 370–375.

World Bank, 2009. Available online:http://data.worldbank.org/indicator/

SP.RUR.TOTL

World Bank, 2007. Available online: http://data.worldbank.org/topic/

agriculture-and-rural-development