The Arabidopsis Diacylglycerol Kinase 4 is involved in nitric oxide-dependent pollen tube guidance and fertilization
Item Type Preprint
Authors Wong, Aloysius Tze;Donaldson, Lara;Portes, Maria Teresa;Eppinger, Jörg;Feijó, José;Gehring, Christoph A Citation Wong, A., Donaldson, L., Portes, M. T., Eppinger, J., Feijó, J.,
& Gehring, C. (2019). The Arabidopsis Diacylglycerol Kinase 4 is involved in nitric oxide-dependent pollen tube guidance and fertilization. doi:10.1101/665810
Eprint version Pre-print
DOI 10.1101/665810
Publisher Cold Spring Harbor Laboratory
Rights The copyright holder for this preprint is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
It is made available under a CC-BY-NC 4.0 International license.
Download date 2023-12-03 18:27:04
Item License https://creativecommons.org/licenses/by-nc/4.0/
Link to Item http://hdl.handle.net/10754/656585
1 Supplemental Information
1 2
Figure S1 3
Characterization of dgk4 T-DNA insertion mutant plants 4
Figure S2 5
Homozygous dgk4-2 PT has slower growth rate and reduced NO-dependent growth 6
response 7
Figure S3 8
DGK4 harboring point mutation at the H-NOX-like center yields spectral behavior similar 9
to WT 10
Figure S4 11
Kinase activities of DGK4 and mutant dgk4 harboring point mutations at the H-NOX-like 12
center were inhibited by NO 13
Table S1 14
UV-Vis spectroscopic data of selected heme proteins 15
Table S2 16
Primers for cloning of DGK4 and characterization of dgk4-1 and dgk4-2 plants 17
Movie S1 18
PT re-orientation responses of Col-0 and dgk4-1 to NO 19
20
Supplemental Experimental Procedures 21
22
Supplemental References 23
2 Figure S1. Characterization of dgk4 T-DNA insertion mutant plants
24 25 A 26
27 28
29 30
B 31
32 33 34
35
(A) Schematic view of T-DNA insertion sites of dgk4 mutants. Location and content of 36
SALK T-DNA insertions are labelled. LB and RB indicate Left Border and Right Border 37
of the T-DNA respectively. Inset: Green arrows indicate the position and direction of 38
primers (see also Table S2) used in RT-PCR to determine DGK4 expression levels. (B) 39
dgk4-1 pollen has reduced DGK4 mRNA levels as estimated by semi-quantitative RT- 40
PCR. * = P < 0.05 compared to DGK4 mRNA levels of Col-0 pollen and gel pictures are 41
representative of three independently derived biological replicates.
42
Legend:
SALK_151239 is designated as dgk4-1 SALK_145081 is designated as dgk4-2
3 Figure S2. Homozygous dgk4-2 PT has slower growth rate and reduced NO-
43
dependent growth response 44
45
46 47
48 49
50 51 52 53
NO-dependent inhibition of dgk4-2 PT growth is reduced compared to that of Col-0. NO 54
was provided by either SNP. In vitro pollen germination was performed as detailed 55
previously [1, 2] and PT length was analyzed by capturing images covering the entire 56
growth area of the culture dish that is mounted on an automated stage using the Nikon 57
Eclipse TE2000-S inverted microscope equipped with a Hamamatsu Flash28s CMOS 58
camera. The pollen tube lengths were then measured using NeuronJ[3]. Error bars 59
represent standard error of the mean (n > 150).
60 61 62 63
0 50 100 150 200 250
0 10 25 50 100 200
PT length (µm)
SNP (nM)
Col-0 dgk4-2
4 DEA NONOate 0.00 mM 0.25 mM 0.50 mM 0.75 mM 1.00 mM 1.25 mM
0.0 0.5 1.0 1.5 2.0 2.5
0.0 1.0 2.0 3.0 4.0 5.0 6.0
360 440 520 600
Relative absorbance
Wavelength (nm)
Time exposed to air after addition of Na2S2O4
0 min 5 min 10 min 15 min 20 min 25 min 30 min 35 min 40 min 45 min 0.0
0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0
0.0 1.0 2.0 3.0 4.0 5.0 6.0 7.0 8.0
360 440 520 600
Relative absorbance
Wavelength (nm)
Figure S3. DGK4 harboring point mutation at the H-NOX-like center yields spectral 64
behavior similar to WT 65
A 66 67 68 69 70 71 72 73
74 B 75 76 77 78 79 80 81 82 83
(A) UV-vis characterization reveals that the Soret peaks (410 nm) of 80 µg DGK4 WT and 84
H250L dgk4 mutant proteins were both red-shifted to 424 nm accompanied by the 85
emergence of distinct 𝛼 (558 nm) and 𝛽 (526 nm) bands when reduced with sodium 86
dithionite. The oxidized Soret peaks (410 nm) (red arrows) of both DGK4 WT and H250L 87
0.0 0.5 1.0 1.5 2.0 2.5
0.0 1.0 2.0 3.0 4.0 5.0 6.0
360 440 520 600 Wavelength (nm) DGK4 WT
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0
0.0 1.0 2.0 3.0 4.0 5.0 6.0 7.0 8.0
360 440 520 600 Wavelength (nm)
H250L dgk4
DGK4 WT H250L dgk4
5 dgk4 mutant were fully recovered after 20 and 25 min of exposure to air respectively. (B) 88
Addition of DEA NONOate to reduced DGK4 and H250L dgk4 attenuates the Soret 89
absorption (424 nm) in a concentration dependent manner where the Soret, β- and α- 90
peaks vanish with increasing concentration of the NO donor. H250L dgk4 mutant 91
recorded a much larger decrease in reduced Soret bands than that observed with DGK4 92
WT at low NO donor concentration (0.25 mM DEA NONOate) (black arrows) while also 93
requiring a slightly longer time (⁓ 5 min more than DGK4 WT) (red arrows) to recover its 94
oxidized Soret peak (410 nm) when exposed to air.
95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110
6 Figure S4. Kinase activities of DGK4 and mutant dgk4 harboring point mutations 111
at the H-NOX-like center were inhibited by NO 112
113 114 115 116 117 118 119 120 121 122 123
The kinase activities of dgk4 mutants H350L and Y379L were unaffected by the point 124
mutations at the H-NOX-like center and were inhibited by NO to comparable degree as 125
the WT. Kinase assay was done in reaction mixtures containing 40 mM Bis-Tris (pH 126
7.5), 5 mM MgCl2, 0.1 mM EDTA, 1 mM spermine, 0.5 mM dithiothreitol, 1 mM sodium 127
deoxycholate, 0.02% (v/v) Triton X-100, 500 μM 1,2-DOG and 1 mM ATP, with or 128
without 0.65 mM DEA NONOate (see Experimental Procedures for details). Black solid 129
bars represent kinase reactions performed in the absence of NO while grey solid bars 130
represent kinase reactions performed in the presence of NO (n = 6).
131 132 133
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0
DGK4 WT H350L dgk4 Y379L dgk4
PA (µM/µg protein)
0 mM DEA NONOate 0.65 mM DEA NONOate
7 Table S1. UV-Vis spectroscopic data of selected heme proteins
134
Soret / 𝛽 / 𝛼 ; max. absorption / nm Source Protein (sp.) ferric ferrous ferrous-NO
DGK4 (At) 410 / 𝛼 + 𝛽 534 424 / 526 / 558 418 / - / - This work H-NOX (So) 403 / - / - 430 / 𝛼 + 𝛽 560 399 / 543 / 572 [4]
Cyt b5 (Gl) 411 / 𝛼 + 𝛽 532 423 / 526 / 558 [5]
Z-ISO (At) 414 / 𝛼 + 𝛽 531 414 / 529 / 559 [6]
Legend: At: Arabidopsis thaliana, So: Shiwanella oneidensis, Gl: Giardia lamblia.
135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150
8 Table S2. Primers for cloning of DGK4 and characterization of dgk4-1 and dgk4-2 151
plants 152
Primer name Sequence (5’ – 3’)
DGK4 cloning
DGK4 F DGK4 R DGK4 H-L F DGK4 H-L R DGK4 Y-L F DGK4 Y-L R
ATGGAATCACCGTCGATTGG TCAATCTCCTTTGACGACCAA
TTATGACATTGCTTATAAAAAAGTTGG CAACTTTTTTATAAGCAATGTCATAAA ATCTACATAGCTTAGGAAGTGGAAGAA TCTTCCACTTCCTAAGCTATGTAGATT
Screening for homozygous dgk4-1 and dgk4-2 plants
DGK4 promoter forward DGK4 reverse
T-DNA
TGTTTCTGACATCTGAGAACTTTT GATTGCATTCTTCGTAAAGACG GTTCACGTAGTGGGCCATCG
Expression of DGK4
DGK4 qPCR forward DGK4 qPCR reverse PP2AA3 qPCR forward PP2AA3 qPCR reverse
CGTCGATTGGTGATTCATTG TTGCAATGCGGAGATATTGA GCGGTTGTGGAGAACATGATACG GAACCAAACACAATTCGTTGCTG
Note: The underlined nucleotides incorporate the mutations changing histidine or 153
tyrosine residues at positions 350 and 379 to leucine.
154
9 Movie S1. PT re-orientation responses of Col-0 and dgk4-1 to NO
155
Movie file attached separately.
156 157 158
Supplemental Experimental Procedures 159
160
PT growth in planta 161
PT growth in the pistil of hand pollinated WT and dgk4-1 plants was examined by 162
collecting the pistils at different time points (3 – 8 hours) after pollination. Aniline blue 163
staining of PTs in the pistil was performed as described previously [7] and PT length in 164
the pistil was measured using ImageJ [8].
165 166
Protein expression and purification 167
A Gateway compatible clone (DKLAT5G57690.1) containing the full-length coding 168
sequence of DGK4 was purchased from Arabidopsis Biological Resource Center 169
(ABRC). The DGK4 sequence was recombined into the pDEST17 His-tagged 170
expression vector and transformed into E. coli BL21 A1 (Invitrogen, USA). Expression of 171
recombinant DGK4 was induced with 0.2% (w/v) L-arabinose. Cells were lysed in a 172
guanidium lysis buffer and the supernatant loaded onto a Ni-NTA agarose column for 173
affinity purification under denaturing conditions using urea-containing buffers.
174
Denatured recombinant DGK4 was re-folded by gradual dilution of urea in a linear 175
gradient using an AKTA FPLC (GE Healthcare, UK). Hemin (30 µg/mL) was added to 176
the re-folding buffers to allow for incorporation of heme into DGK4 as it assumes native 177
10 conformation. Excess hemin was removed by size exclusion and recombinant DGK4 178
stored in ‘Buffer’ containing 20 mM Na2H2PO4, 500 mM NaCl, 500 mM sucrose, 100 179
mM non-detergent sulfobetaines (NDSB), 0.05% (w/v) polyethylene glycol (PEG), 4 mM 180
reduced glutathione, 0.04 mM oxidized glutathione and SIGMAFAST protease inhibitor 181
cocktail (1 tablet per 100 mL solution).
182
Two single dgk4 mutants (H350L and Y379L) were constructed using site directed 183
mutagenesis by PCR [9]. To construct the H350L dgk4 mutant, two overlapping 184
fragments of the DGK4 coding sequence both incorporating the mutation, were 185
amplified from the pDEST17-DGK4 plasmid using the respective DGK4 F and DGK4 H- 186
L R (for 1st fragment amplification), and DGK4 H-L F and DGK4 R (for 2nd fragment 187
amplification) primer pairs (Table S2).The two overlapping fragments both incorporating 188
the mutations were then used as templates for a PCR reaction using the full-length 189
DGK4 F and DGK4 R primer pairs (Table S2) which generated a full-length dgk4 H350L 190
mutant sequence. The dgk4 Y379L mutant was generated using the same method but 191
with the following mutagenic primers pairs, DGK4 F and DGK4 Y-L R, and DGK4 Y-L F 192
and DGK4 R (Table S2). The DGK4 mutant PCR products were inserted into the 193
PCR8/GW/TOPO vector (Invitrogen, USA) by TA cloning, recombined into the 194
pDEST17 His-tagged expression vector and transformed into E. coli BL21 A1 195
(Invitrogen, USA). Mutant dgk4 was expressed and affinity purified in the same manner 196
as DGK4.
197 198 199 200
11 Supplemental References
201 202
1. Prado, A.M.,Colaco, R., Moreno, N., Silva, A.C., and Feijo, J.A. (2008).
203
Targeting of pollen tubes to ovules is dependent on nitric oxide (NO) signaling.
204
Mol. Plant 1, 703-714.
205
2. Prado, A.M., Porterfield, D.M., and Feijo, J.A. (2004). Nitric oxide is involved in 206
growth regulation and re-orientation of pollen tubes. Development 131, 2707- 207
2714.
208
3. Meijering, E., Jacob, M., Sarria, J.C., Steiner, P., Hirling, H., and Unser, M.
209
(2004). Design and validation of a tool for neurite tracing and analysis in 210
fluorescence microscopy images. Cytometry A 58, 167-176.
211
4. Herzik, M.A., Jonnalagadda, R., Kuriyan, J., and Marletta, M.A. (2014). Structural 212
insights into the role of iron–histidine bond cleavage in nitric oxide-induced 213
activation of H-NOX gas sensor proteins. Proc. Natl. Acad. Sci. U.S.A. 111, 214
E4156-E4164.
215
5. Alam, S., Yee, J., Couture, M., Takayama, S.J., Tseng, W.H., Mauk, A.G., and 216
Rafferty, S. (2012). Cytochrome b5 from Giardia lamblia. Metallomics 4, 1255- 217
1261.
218
6. Beltran, J., Kloss, B., Hosler, J.P., Geng, J., Liu, A., Modi, A., Dawson, J.H., 219
Sono, M., Shumskaya, M., Ampomah-Dwamena, C., et al. (2015). Control of 220
carotenoid biosynthesis through a heme-based cis-trans isomerase. Nat. Chem.
221
Biol. 11, 598-605.
222
12 7. Mori, T., Kuroiwa, H., Higashiyama, T., and Kuroiwa, T. (2006). GENERATIVE 223
CELL SPECIFIC 1 is essential for angiosperm fertilization. Nat. Cell Biol. 8, 64- 224
71.
225
8. Schneider, C.A., Rasband, W.S., and Eliceiri, K.W. (2012). NIH Image to ImageJ:
226
25 years of image analysis. Nat. Meth. 9, 671-675.
227
9. Ho, S.N., Hunt, H.D., Horton, R.M., Pullen, J.K., and Pease, L.R. (1989). Site- 228
directed mutagenesis by overlap extension using the polymerase chain reaction.
229
Gene 77, 51-59.
230 231
