2.2 Materials and methods
2.3.1 Extraction of deoxyribonuclease (DNA) and polymerase chain reaction (PCR)
The eggs and/or J2 of the Meloidogyne populations obtained from each field were isolated with a micro pipette (eggs) or fished out with a fine-tip needle (J2) from the respective samples after counting. Isolation of these life stages was done using a stereo-microscope (40 ˟ magnification). The eggs and/or J2 from each individual sample were transferred to a 1.5 ml Eppendorf tube containing approximately 20 µl, double-distilled water. The DNA of the eggs/J2 from each field was extracted seperately using the following procedure: First, the nematodes were crushed using a melted, glass pipette tip. After this a 20 µl chelex®100 (5 %) solution and 3 µl proteinase K (20 mg/ ml) was added to each sample. The J2 homogenate was then centrifuged at 12 000 rpm for 20 seconds and incubated at 56 °C for 2 hours. It was then further incubated at 95 °C for 10 minutes to deactivate the proteinase K and stored at -20 °C until it was used for the polymerase chain reaction (PCR).
Two approaches was used to identify Meloidogyne spp. present in each sample which included the amplification and sequencing of the mitochondrial DNA (mtDNA), NADH dehydrogenase subunit 5 gene (NADH5) and amplification of a specific region of ribosomal DNA (rDNA) with species-specific primers in SCAR-PCR. The techniques are described in Paragraphs 2.3.1.1 and 2.3.1.2, respectively.
2.3.1.1 NADH dehydrogenase subunit 5 (NADH5) technique and deoxyribonuclease (DNA) sequencing
The DNA homogenate of eggs/J2 from each field that were contained in individual PCR tubes were prepared for sequencing by adding 12.5 µl Master mix, 8 µl nuclease-free water, 1 µl forward primer, 1 µl reverse primer and 8 µl template DNA. The primers were diluted to 10 p.mol before use. All samples were centrifuged for 10 seconds and placed in the C1000™ Thermal Cycler (BioRad) under the conditions described in Table 2.3. The PCR product was then analyzed by electrophoresis on a 1.5 % agarose gel with 1x TAE buffer.
An O’GeneRuler™ 1kb DNA Ladder was loaded in the first well to establish the size of the DNA bands for the eggs/J2 present in each sample. Next, 4 µl template DNA of the eggs/J2 from each field was mixed with 2 µl GelRed and added to individual wells in the agarose gel.
The gels were then ran for 30 minutes at 120 V in an electrophoresis chamber and visualised with ultraviolet (UV) illumination. The size of the NADH5 band was visible at the 610 bp fragment length. The remaining DNA template of eggs/J2 from each field was sent to
57 the South African sequencing company, inqababiotecTM (http://www.inqababiotec.co.za) in Pretoria, for sequencing. Phylogenetic analysis was done by aligning the sequences with Clustal Wusing the Maximum Likelihood method (1 000 bootstrap values) as implemented in Mega7 software (Kumar et al., 2016). Aphelenchoides besseyi (Accession no. KJ739799) was selected from Genbank and used as the outgroup.
2.3.1.2 Sequence-derived amplified region – polymerase chain reaction (SCAR-PCR)
Specific primers are commercially available to amplify the DNA of Meloidogyne spp. life stages. Primer sets are available for species such as M. arenaria, Meloidogyne chitwoodi Golden, O’Banon, Santo & Finley, 1980, Meloidogyne enterolobii Yang & Eisenbach, 1983, Meloidogyne fallax Karssen, 1996, Meloidogyne hapla Chitwood, 1949, M. incognita and M.
javanica. The primers each constitute of eight to ten nucleotides (Table 2.3) (Blok & Powers, 2009). For this specific study, SCAR-PCR assays were done only to determine the presence of M. arenaria, M. enterolobii, M. incognita and M. javanica since NADH5 analyses was done first and indicated the presence of only these species. The egg/J2 DNA from each respective field were subjected to the following protocol: each PCR tube contained 12.5 µl Master mix, 8.5 µl nuclease-free water, 1 µl forward primer, 1 µl reverse primer and 2 µl template DNA. The primers were diluted to 10 p.mol before use. A ‘no template’ control (NT- no DNA, only containing nuclease free water) and a known reference sample containing DNA of monoculture populations of each Meloidogyne spp. were also included in the SCAR- PCR amplification process (see Table 2.4). The content of the PCR tubes were then centrifuged and placed in the C1000™ Thermal Cycler (BioRad) under the conditions described in Table 2.3. The products were then analysed through electrophoresis as described in paragraph 2.3.1.1.
The reference M. incognita and M. javanica monoculture populations used in this study were reared in vivo at the Nematology Laboratory of the North-West University, Potchefstroom.
These reference species populations were earlier identified with the SCAR-PCR technique (Fourie et al., 2012). Life stages of the other reference species used, viz. M. arenaria and M.
enterolobii, were obtained from Prof. Gerrit Karssen from the Netherlands, Food and Consumer Product Safety Authority, Ministry of Economic Affairs, Hc Wageningen. The DNA from 100 J2 from these respective populations was extracted to confirm the identity of these species should they be present in the samples (See table 2.4).
58 Table2.2 Primer codes used for the identification of Meloidogyne spp. for both NADH5 and SCAR-PCR.
Code Primer sequence 5’-3’ Specificity and reference source
1FNAD5 TATTTTTTGTTTGAGATATATTAG Meloidogyne spp. identification (mtDNA gene) Janssen et al.(2016)
2RNAD5 CGTGAATCTTGATTTTCCATTTTT
1Far TCGGCGATAGAGGTAAATGAC Meloidogyne arenaria-specific SCAR;
Zijlstra et al. (2000)
2Rar TCGGCGATAGACACTACAACT
1Finc CTCTGCCCAATGAGCTGTCC Meloidogyne incognita-specific SCAR;
Zijlstra et al. (2000)
2Rinc CTCTGCCCTCACATTAGG
1Fjav GGTGCGCGATTGAACTGAGC Meloidogyne javanica-specific SCAR;
Zijlstra et al. (2000)
2Rjav CAGGCCCTTCAGTGGAACTATAC
1Fent AACTTTTGTGAAAGTGCCGCTG Meloidogyne enterolobii-specific SCAR; Long et al. (2006)
2Rent TCAGTTCAGGCAGGATCAACC
1F=Forward primer, 2R=Reverse primer
Table 2.3 The profiles for the polymerase chain reaction (PCR) used during this study with different primers for identification of Meloidogyne spp. (Zijlstra et al., 2000; Long et al., 2006).
Amplification
conditions M. arenaria M. enterolobii M. incognita M. javanica NADH5 Denaturation
temperature 94 °C, 2’ 94 °C, 2’ 94 °C, 2’ 94 °C, 2’ 94 °C, 2’
No. of cycles 35 35 35 35 40
Denaturation
temperature 94 °C, 30” 94 °C, 30” 94 °C, 30” 94 °C, 30” 94 °C, 60”
Annealing
temperatures 61 °C, 30” 64 °C, 30” 55 °C, 30” 64 °C, 30” 45 °C, 60”
Extension
temperatures 72 °C, 60” 72 °C, 60” 72 °C, 60” 72 °C, 60” 72 °C, 180”
Final extension temperatures
72 °C, 5’ 72 °C, 5’ 72 °C, 5’ 72 °C, 5’ 72 °C, 10’
59 Table 2.4 Meloidogyne spp. populations used as references during the identification of root- knot nematode species contained in maize roots sampled from 78 fields during 2013/14.
Meloidogyne spp. and life stage Host and country of origin
DNA fragment
size (bp) Meloidogyne arenaria; second-
stage juveniles (J2)
Echinocactus grusonni (Golden Barrel Cactus);
The Netherlands 420
Meloidogyne enterolobii second stage juveniles
Psidium guajava (Guava), Mbombela,
Mpumalanga Province, South Africa 200 Meloidogyne incognita; mature
females
Zea mays (maize); Vryburg Northern-Cape
Province, South Africa 1 200 Meloidogyne javanica; mature
females
Cucurbita pepo (Pumpkin); Kuruman Correctional
Center, Northern Cape Province, South Africa 670