CHAPTER 3: CASSAVA MOSAIC GEMINIVIRUSES OCCURRING IN LUAPULA PROVINCE
3.2 Materials and methods
The survey was carried out in Luapula province, Zambia, which borders with Democratic Republic of Congo (DRC) in the west. The province lies between latitude 8 to 12o south of the equator and 28 to 30o east of Greenwich Mean Time (GMT). Luapula province is situated in high rainfall agroecological zone (AEZ III) receiving >1 000 mm of rainfall per year. Annual minimum and maximum temperature in the province range between 10 to 31 oC. The altitudes vary from 900 m above sea level in the lower Luapula valley to over 1 300 m at Kawambwa. The province experiences monomodal rainfall from November to April and does not experience drought. It also has savannah type of vegetation interspersed with trees.
3.2.2 Field sampling and mapping
The study was carried out between April and May 2009. Fifty-two cassava fields were sampled at average intervals of 5-10 km along the high-way (main road). Occasionally fields closer to the main road were also sampled. In areas where the fields were far apart (>5-10 km), the sampling intervals were made further apart. To gather information regarding the cassava plants, the farmers growing cassava were interviewed on cultivars grown, age of the cassava plants and what they thought about CMD. Sampling was done in Samfya, Mansa, Mwense, Kawambwa and Nchelenge districts (Figure 3.1). Sampling was done by walking through cassava fields in a
‘Z’ configuration, two sides on either side and along the diagonal. In each field 10 plants per transect were sampled from the predominant cultivar to give a composite sample of 30 plants per field. The plants were sampled at approximately the same distance between one another within the transect.
Kilometres
i 0 0 4 0
0 2 0
0 0 2
N
Figure 3.1: Districts in Zambia surveyed for cassava mosaic disease incidence and severity
The total length of a transect varied depending on the field size. In this survey cassava fields which were 3 to 6 months after planting were targeted. The 3 to 6 months old plants allowed for distinguishing plants that were either infected by whiteflies or through the cuttings (Sseruwagi et al., 2004). The type of CMD infection was examined by observing the whole plant. Plants with symptoms on only the upper most leaves were considered as whitefly infected, whereas those with disease symptoms occurring throughout the plant were regarded as having been infected from the cutting.
The coordinates (latitude, and longitude) including altitude for each sampled field were recorded using global positioning system (GPS) equipment (Garmin GPS, model etrex summit HC). The
Viruses ACMV EACMV
EACMV + ACMV
Tanzania DRC
Angola
Districts
Mwense Nchelenge Kawambwa
Mansa Samfya
distribution of cassava geminiviruses were mapped using Arcview software (Environmental Systems Research Institute, Inc., Redlands, CA, USA). Other information related to the CMD survey was collected and recorded on a sample record sheet (Appendix 1). In addition, photographs and symptoms of cassava plants from the field were also described and recorded.
3.2.3 Cassava mosaic disease incidence, severity and adult whitefly population
Disease incidence was determined by assessing the visibly diseased plants (with CMD symptoms) in relation to the total number of assessed plants in each field. Disease severity was recorded for each sampled whole plant using the five point rating scale (Hahn et al., 1980) (Table 3.1).
Table 3.1: Cassava mosaic disease severity rating (scale 1-5) Scale Symptom description
1 No symptoms observed
2 Mild chlorotic pattern over entire leaflets or mild distortion at the base of leaflets only with the remainder of the leaflets appearing green and healthy
3 Moderate mosaic pattern throughout the leaf, narrowing and distortion of the lower one- third of leaflets
4 Severe mosaic, distortion of two thirds of the leaflets and general reduction of leaf size 5 Severe mosaic distortion of the entire leaf
Source: Hahn et al. (1980)
The number of whiteflies was counted on the five youngest leaves of individual plants. The leaves were held gently and turned to count the whiteflies. Counting of whiteflies was done from the same plants that were examined for CMD incidence and severity.
3.2.4 Sample collection
In each field, two young leaves were sampled from plants with CMD symptoms for deoxyribonucleic acid (DNA) extraction. One sample was collected from a plant with severe symptoms and the other sample was from a plant with mild symptoms. The reason for sampling from plants with mild and severe symptoms was to determine whether different virus strains occurred in the same field. In some cases three samples were taken from a field with a third sample taken from a plant exhibiting peculiar symptoms. Young leaves with symptoms were removed from the infected plants and placed in 1.5 ml eppendorf tubes and placed in a cool box containing ice blocks for preservation purposes until DNA was extracted. Each eppendorf tube was labelled indicating the location from where the sample was collected. Furthermore, cuttings
from each field where the young leaves had been sampled were collected, labelled and planted in the screenhouse. This was done to check for symptom variation from the planted cuttings and to guarantee the availability of viral DNA from the sampled fields in case DNA from leaf samples was not recovered. In addition, diseased cuttings were later taken from plants that had grown from the planted diseased cuttings for grafting onto the F1 progeny (clonal evaluation trial). The planted cuttings were inspected twice weekly and disease symptoms recorded and described.
3.2.5 Viral genomic deoxyribonucleic acid isolation
The genomic DNA was recovered directly from the samples using the method described by Dellaporta et al. (1983). The leaf samples collected from the field were crushed with a mortar and pestle in 500 µl of extraction buffer [100 mM Trizma base, 8.5 mM ethyl- enediaminetetraacetic acid (EDTA), 500 mM NaCl, and 10 mM β-mercaptoethanol in 100ml of double distilled water at pH 8.0]. A volume of 33 µl of 20% lauryl sulphate solution was added to each sample, mixed and the tube with contents was then incubated at 65oC in a water bath for 10 min. A volume of 160 µl of 5 M potassium acetate solution was then added to each tube, mixed thoroughly and incubated in an icebox for 10 minutes and tubes centrifuged in a microfuge at 11 600 rpm for 10 minutes. A volume of 450 µl of the resultant supernatant was removed and transferred into a new 1.5 ml microfuge tube to which 450 µl of ice-cold isopropanol was added, mixed by inverting and centrifuging at 13000 rpm for 10 min to precipitate the DNA. The supernatant was then removed and the remaining DNA air dried at room temperature for 1 h after removing the ethanol and thereafter suspended in 300 µl of distilled water and stored at 4oC until used.
3.2.6 Amplification and differentiation of cassava viruses and associated satellites Amplification of viral DNA and satellites was performed using the Polymerase chain reaction (PCR) machine (Techne – TC500) for each sample. The reaction mixture for the PCR was carried out in 0.5 ml microfuge tubes. The total reaction mixture was 50 µl and was made up of:
41.0 µl, distilled water; 2.5µl, PCR buffer (10X); 1.5 µl, magnesium chloride; 0.5 µl, dNTPs (10mM); 1.0 µl, forward (10mM) and reverse primers (10mM); 0.5 µl, Taq polymerase; and 2.0 µl DNA template. A drop of oil was added to each tube to prevent evaporation.
Universal and satellite primers were used in the amplification of near full length fragments of DNA-A and DNA-β of total DNA. In the PCR assay, differential primers amplifying specific virus species or different strains were also used (Table 3.2).
Table 3.2: Primers used to detect cassava viruses in leaf samples collected from Samfya, Mansa, Mwense, Kawambwa and districts
Primer pairs Sequences (5’-3’) Specificity Target
JSP00/F ATGTCGAAGCGACCAGGAGAT ACMV AV1/CP
JSP00/R TGTTTATTAATTGCCAATACT ACMV AV1/CP
EAB555/F TACATCGGCCTTTGAGTCGCATGG EACMV DNA-B
EAB555/R CTTATTAACGCCTATATAAACACC EACMV DNA-B
SatIIF GCCGCACCACTGGATCTC Satellite II DNA-II
SatIIR CAGCAGCCAGTCAGGAAGTT Satellite II DNA-II
SatIIIF AGGCCTCGTTACTAAAAGTGC Satellite III DNA-III
SatIIIR ACCTGACGGCAGAAGGAAT Satellite III DNA-III
F, forward primers; R, reverse primers; sat, satellite
The viral DNA was amplified using the following PCR stages; first cycle of 1 minute at 94oC, followed by 30 amplification cycles of 1 minute at 94oC, 1 minute of primer annealing at 58oC, 2 minutes for strand extension at 72oC and then finally for 10 minutes at 72oC (final extension).
The samples were held at 4oC before being loaded into the gel apparatus. Before loading the gel apparatus, the amplified DNA was mixed with 1 µl of loading dye. After carrying out PCR analysis, the reaction was subjected to gel electrophoresis in Tris Acetate EDTA (TAE) buffer.
The gel was visualized using the bench top single UV transilluminator and photographed with the gel documentation system (Gel Doc XR: Universal Hood-S.N 765/03363, Bio-rad).
3.2.7 Data analysis
The data were analysed using Genstat version 14 (Payne et al., 2008) based on the following statistical model
Yij = µ + di + fj + d i /f j +
ε
ijWhere:
Yij is the CMD score observed at the ijth location
µ is the overall mean recorded for the disease symptom di is the CMD score observed in the ith district
fj is the CMD score observed in the jth field
d/fij is the CMD score observed in the jth field nested in the ith district εij is the error term associated with each observation