2.4 BLOOD ANALYSIS
2.4.4 Sequence Diversity Analyses
2.4.1 Measurement of plasma viral load and CD4+ T cell counts:
PBMC and plasma were isolated by density gradient centrifugation at 1000 rpm (Heraeus Megafuge 1.0R) for 10 min at room temperature.
42 i) Viral load - Quantification of plasma HIV-1 RNA was made by using the automated ultrasensitive (lower detection limit 50 copies/ml) COBAS Amplicor/Ampli Prep HIV-1 Monitor Test V1.5 (Roche Molecular Systems Inc., New Jersey, USA) as per manufacturer’s instructions.
ii) CD4+ T cell - A cluster of differentiation (CD) cells from PBMCs were enumerated by using the Multi-test kit (CD4/CD3/CD8/CD45) on a four parameter FACS Calibre flow cytometer (Becton Dickinson, New Jersey, USA).
2.4.2 Blood DNA extraction
DNA was extracted from buffy coats using the QIAamp DNA Mini kit (Qiagen, Santa Clarita, CA, USA) according to the manufacturer’s instructions (Figure 2.1). DNA was quantified on the spectrophotometer NanoDrop 2000 (Thermo Scientific, Fermentas Canada Inc., Burlington, Ontario) to determine the quantity and quality of extracted DNA.
43
Figure 2.1: An overview of the QIAGEN QIAamp DNA Blood Mini Spin kit procedure for DNA extraction from buffy coat samples (Adapted from QIAGEN, 2003).
Sample
Lyse: 200µl of the lysed sample was loaded on the column membrane.
Bind
Wash (Buffer AW2): Protein and other contaminants will not bind to the membrane, due to the salt and pH conditions of the lysate buffer, and will therefore prevent downstream inhibition of PCR.
Wash (Buffer AW1): The column was then washed which allowed the DNA to bind in during centrifugation.
Elute: Finally purified DNA was eluted.
44 2.4.3 HIV Proviral DNA Quantification
A modified method of Desire et al., (2001) involving real time PCR technology was used for proviral load quantification. The LightCycler® 480 (Roche Molecular Systems, New Jersey, USA) was used for PCR amplification, acquisition and data analysis.
The PCR primers were selected to optimize HIV-1 subtype C gag sequence amplification, following earlier studies that suggest that this genetic subtype is the predominant virus in Southern Africa (Novitsky et al., 2001). The sequence of the forward and reverse primers
were p24-F1 (5’-CAAGCAGCCATGCAAATGTT-3’) and 330L (5'-
GGTACTAGTAGTTCCTGC TAT-3’) respectively. The primers ALB-S (5’-
GCTGTCATCTCTCTTGTGGGCTGT-3’) and ALB-AS (5’-
AAACTCATGGGAGCTGCTGGTT-3’) were used to quantify the human albumin gene.
All samples, controls and standards were run in duplicate and the average value was used to compute HIV and albumin copy number. A standard curve for HIV and albumin was accepted with slopes ranging between -4.52 and -3.91 and when the coefficient of correlation (r2) was >0.986.
Albumin DNA was quantified to determine the level of DNA input, to normalize for variation in buffy coat cell differences and for differences in DNA extraction. The normalized value of HIV proviral load was calculated as HIV DNA copy number/albumin DNA copy number multiplied by 2X106 cells. The 8E5 cell line (American Type Culture Collection., Manassas, USA), was cultured by incubation horizontally at 37ºC in a 5% CO2
in air atmosphere using RPMI-1640 medium (Sigma-Aldrich Corporation, MO) with 10%
fetal bovine serum. The 8E5 cell line, a T lymphoblastoid cell line that contained a single
45 defective genome copy of HIV-LAV (lymphadenopathy-associated virus) per cell, was used as a positive control for each run and for the generation of a standard curve.
2.4.4 Sequence Diversity Analyses
Genomic DNA was extracted directly from PBMCs and kidney biopsy cells using the QIAamp Blood kit (Qiagen, Chatsworth, CA). Thereafter, the Expand High Fidelity PCR kit (Roche Molecular Systems, New Jersey, USA) was used to amplify a 957 base pair (bp) C2-C5 fragment of the env gene by using a nested PCR reaction protocol. In the first round reaction the forward primers was vpu232 (TGCTCCTTGGGATATTGATGA) while the reverse primers was p131 (AGCCAGGACTCTTGCCTGGAGCT). Five µL of the first round reaction product was subjected to a second round of amplification, with
primers Bstq2+ (CCAATTCCTATACATTATTGTGC) and 1556
(CCATAGTGCTTCCTGCTGCTCCTAAGAACCCAA). Ten picomoles of each primer were used per PCR reaction. The cycling conditions for both amplifications consisted of initial activation at 95°C for 10 mins, followed by 39 cycles of 95°C for 15 sec, 58°C for 30 sec and 72°C for 1 min with a final extension at 72°C for 7 mins. To minimize re- sampling bias and to gain an understanding of the extent of diversity within the samples, three independent PCR reactions were performed for each sample at each time point (pre and post-HAART in PBMCs and kidney tissue) using identical PCR conditions. These PCR products were run on a 1% agarose gel at 100 Volts for 2 h to confirm the amplification of the 957 bp C2-C5 fragment by electrophoresis on an Enduro-power supplier (Labnet International Inc, New Jersey, USA). The desired band was then cut from the gel to ensure a greater probability that no other products were carried onto sequencing.
The gel purification was performed utilizing the GE Healthcare kit (Table 2.1; GE Healthcare Life Sciences, Buckinghamshire, UK).
46 Table 2.1: Procedure for gel purification.
STEPS METHOD TEMP TIME
1 PCR products run on a 1% gel at 100 Volts 24°C 2 h
2 Excise band of interest 24°C
3 500µl Capture buffer type 3 60°C 5 mins
4 Add sample mix to GFX MicroSpinTM column and collection tube 24°C 1 min
5 Centrifuge @ 10000rpm (discarded flow through) 24°C 30 sec
6 500 µl wash buffer type 1 24°C 30 sec
7 Centrifuge @ 10000rpm (discarded flow collection tube) 24°C 30 sec
8 20µl elution buffer type 4 24°C 1 min
9 Centrifuge @ 12000rpm (retain flow through) 24°C 1 min
10
Run on a gel with a low DNA mass ladder (Invitrogen Corporation, Carlsbad, California, USA) and Molecular Weight Marker (1kb O’gene ruler, Thermo Scientific, Fermentas Canada Inc. Canada, Ontario)
24°C 2 h
2.4.5 Sequencing and Sequence Analysis