• Tidak ada hasil yang ditemukan

Directory UMM :Data Elmu:jurnal:P:PlantScience:PlantScience_Elsevier:Vol155.Issue1.2000:

N/A
N/A
Protected

Academic year: 2017

Membagikan "Directory UMM :Data Elmu:jurnal:P:PlantScience:PlantScience_Elsevier:Vol155.Issue1.2000:"

Copied!
16
0
0

Teks penuh

(1)

Xylem-specific expression of wound-inducible rice peroxidase genes

in transgenic plants

Hiroyuki Ito

a,

*, Susumu Hiraga

a,b

, Hidehito Tsugawa

c

, Hirokazu Matsui

a

,

Mamoru Honma

a

, Yoshiaki Otsuki

d

, Taka Murakami

e

, Yuko Ohashi

b,e

aDepartment of Applied Bioscience,Graduate School of Agriculture,Hokkaido Uni6ersity,Sapporo060-8589, Japan bCore Research for E6olutional Science and Technology (CREST),Chiyoda-ku,Tokyo 101-0062, Japan

cAomori Green BioCenter,Aomori 030-0142, Japan

dDepartment of Tea Agronomy,National Research Institute of Vegetables,Ornamental Plants and Tea,Kanaya 2769, Shizuoka 428-8501, Japan

eDepartment of Molecular Genetics,National Institute of Agrobiological Resources,Tsukuba,Ibaraki 305-8602, Japan

Received 6 September 1999; received in revised form 17 January 2000; accepted 19 January 2000

Abstract

A peroxidase gene, poxA, was isolated from a rice (Oryza sati6aL.) genomic library. The gene consists of four exons whose combined sequences were identical to that of the prxRPA mRNA whose levels were dramatically stimulated by wounding as well as by treatment of rice shoots with ethephon or UV irradiation [H. Ito, F. Kimizuka, A. Ohbayashi, H. Matsui, M. Honma, A. Shinmyo, Y. Ohashi, A.B. Caplan, R.L. Rodriguez, Molecular cloning and characterization of two complementary DNAs encoding putative peroxidases from rice (Oryza sati6aL.) shoots, Plant Cell Rep. 13 (1994) 361 – 366]. The temporal and spatial expression properties of thepoxAgene promoter as well as that from a second related peroxidase gene,poxN, were analyzed in transgenic tobacco and rice plants using the uidA gene as a reporter. In transgenic tobacco, UV- and wound-responsive

cis-elements were located within 144 bp from the translational start codon of thepoxAgene. ThepoxNpromoter, however, was inactive in the heterologous host as no significant GUS activity was evident. On the other hand, chimericuidAgenes containing 2.2 kb of thepoxApromoter or 1.4 kb ofpoxNpromoter were active in transgenic rice plants. Both peroxidase promoters directed GUS activities in a spatial and tissue specific manner coincident with the expression patterns exhibited by their mRNAs. Histochemical analysis of transgenic rice plants showed that both peroxidase genes are expressed in the vascular bundles of the shoot apex and lamina joint, and in xylem-parenchyma cells of the leaf blade and sheath. © 2000 Elsevier Science Ireland Ltd. All rights reserved.

Keywords:Peroxidase; Rice (Oryza sati6aL.); Wound; Transgenic plants; Tissue-specific expression

www.elsevier.com/locate/plantsci

1. Introduction

Plant peroxidases (EC 1.11.1.7; donor:hydrogen peroxide oxidoreductase) are involved in several different physiological functions including wound healing [3,4], biosynthesis of cell walls [5 – 7], growth regulation [8], and senescence [9]. In view of their diverse roles, plants contain numerous peroxidase isoforms that are encoded by different

genes that comprise a complex multigene family. For example, rice shoots contain up to 25 or more enzyme isoforms as viewed by histochemical en-zyme analysis of protein extracts resolved by elec-trophoresis on native polyacrylamide gels [10]. Despite their importance in plant growth and de-velopment there have been very few reports on the purification and properties of peroxidase isoforms from rice plants and fewer attempts to assign a function for specific isoforms [10 – 12]. Because of recent plant genome project activities, many per-oxidase gene sequences or homolog sequences

* Corresponding author. Tel.: +81-11-7062500; fax: + 81-11-7063635.

E-mail address:[email protected] (H. Ito)

(2)

have been identified particularly in rice and Ara-bidopsis [13 – 19]. The primary sequences of the coded protein share about 40 – 50% homology and contain several highly conserved regions (60 – 90%) including two conserved histidine residues

pre-dicted to play a role in acid/base catalysis and to

serve as the fifth ligand of the heme prosthetic group [20].

The expression of the peroxidase genes, as well as pathogenesis-related protein genes [21], have been shown to be activated by a variety of envi-ronmental stimuli such as wounding [22], ethylene [23] and pathogen infection [12,24,25]. Few studies have been conducted to identify the regulatory

cis-elements present in the peroxidase promoters.

Mohan et al. [22] constructed chimeric uidA

fu-sions driven by the 5% flanking regions of the

tomato anionic tap1 and tap2 peroxidase genes

and showed that wound-induced GUS expression in transgenic plants. Recently, Klotz et al. [26] also prepared a chimeric gene composed of the pro-moter for the principal peroxidase gene found in

tobacco and theuidAgene, analyzed histochemical

GUS activity in transgenic tobacco plants, and suggested that the peroxidase is important in plant

growth and development rather than in

lignification.

Some cell wall-associated peroxidases catalyze the cross-linking and polymerization of phenolic polymers; it is one of key enzymes involved in lignin synthesis via phenylpropanoid pathway [27]. We believe characterization of the gene structure and the mode of gene expression of wound-in-ducible peroxidase isozymes is important not only to understand their biological functions involved in plant defence responses but to elucidate a part of signal transduction between wounding and gene expression.

In order to understand the function of peroxi-dases in plant growth and development, we iso-lated and characterized two peroxidase cDNA clones prxRPA and prxRPN [1]. A genomic clone

for prxRPN, poxN, was isolated and analyzed at

the structural level [2]. Here, we report the isola-tion and characterizaisola-tion of a second rice

peroxi-dase gene, poxA, which corresponds to the

prxRPA cDNA. We show that expression of the

poxA and poxN promoter-uidA fusion genes are

active in transgenic rice in a spatial and temporal pattern identical to that observed for their

respec-tive mRNAs. In contrast, only thepoxA promoter

is active in transgenic tobacco, indicating that one or more transcriptional regulatory elements of the

poxN promoter are not conserved between dicot

and monocot species.

2. Materials and methods

2.1. Plant materials

Rice (Oryza sati6a L. cv. Nipponbare) was

grown as described previously [1]. Rice suspen-sion-cultured cells were raised from seeds and

maintained in AA medium [28]. Tobacco (Nico

-tiana tabacumcv. Samsun NN) was grown at 25°C in a temperature-controlled greenhouse with a photoperiod of 16 h of light and 8 h darkness.

2.2. Isolation of a genomic clone

Genomic DNA was isolated from rice shoots, 21 days after germination, by the method of Mur-ray and Thompson [29]. The DNA was partially

digested with Sau3A and fragments (10 – 20 kb in

size) were recovered and inserted into the BamHI

site of lambda EMBL3 (Stratagene Cloning Sys-tems, La Jolla, CA, USA). The recombinant DNAs were packaged into bacteriophage particles (GIGA pack Gold-II; Stratagene) and grown on Escherichia coli LE392 (P2). The genomic library

was screened with a 32P-labeled prxRPA cDNA

using a BcaBEST labeling kit (Takara Shuzo,

Ky-oto, Japan) and [a-32P]dCTP (Amersham

Interna-tional, Buckinghamshire, UK).

2.3. Nucleotide sequencing

DNA was sequenced by the dideoxy chain-ter-mination method [30] using 7-deaza-dGTP instead of dGTP. The experimental details have been de-scribed previously [1]. The nucleotide sequences of

the poxA and poxN gene fragments appear in the

DDBJ, EMBL and GenBank Nucleotide Sequence Databases under the accession numbers D84400 and D49551, respectively.

2.4. Primer extension

(3)

-GTAT-

TAAGGCACAGTACAAGAACAGAGCATAC-3%, for the poxA gene, and a 30-mer synthetic

oligonucleotide, 5%

-GAACGACGATATTGCA-GAGGAAACTCAGGC-3%, for the poxN gene

were end-labeled with [g-32P]ATP (Amersham

In-ternational) and a Megalabel kit (Takara Shuzo). The labeled primers were allowed to anneal

overnight at 30°C to 50 mg of total RNA

iso-lated from wounded shoots or healthy roots of

21-day-old rice seedlings. The shoots were

wounded by rubbing with sea sand and har-vested 2 days later. The extension reaction using reverse transcriptase RAV-2 (Takara Shuzo) was carried out at 42°C for 1.5 h. The products were analyzed on a 6% polyacrylamide sequencing gel containing 8 M urea. The same primer was used to produce a sequencing ladder of complemen-tary DNA.

2.5. Construction of promoter-uidA fusion genes

Six DNA fragments of the poxA promoter

were prepared by restriction enzyme digestions,

as follows: (i) Aa fragment, a 2204-bp KpnI –

ScaI fragment (position −2197 to +7; position

+1 is the A base of the translation start codon);

(ii) Ab fragment, a 1629-bp NotI –ScaI fragment

(−1622 to +7); (iii) Ac fragment, a 1138-bp

EcoRI –ScaI fragment (−1131 to +7); (iv) Ad

fragment, a 628-bp HindIII –ScaI fragment (−

621 to +7); (v) Ae fragment, a 355-bp P6uII –

ScaI fragment (−348 to +7); and (vi) Af

fragment, a 151-bp SphI –ScaI fragment (−144

to +7). Likewise, five DNA fragments of the

poxN promoter were prepared: (i) Nb fragment,

a 1640-bp XbaI –NheI fragment (−1425 to +

36); (ii) Nc fragment, a 1094-bp FspI –NheI

frag-ment (−1059 to +36); (iii) Nd fragment, a

801-bp NheI fragment (−766 to +36); (iv) Ne

fragment, a 410-bp HindIII –NheI fragment (−

375 to +36); and (v) Nf fragment, a 196-bp

EcoRV –NheI fragment (−161 to +36). The

termini of each DNA fragment were filled-in if

necessary and inserted into the filled-in HindIII

and XbaI sites of the pBI101 vector (Clontech

Laboratories, Palo Alto, CA, USA) [31]. The

re-sulting plasmids, designated pAa/GUS, pAb/

GUS, pAc/GUS, pAd/GUS, pAe/GUS,

pAf/GUS, pNb/GUS, pNc/GUS, pNd/GUS,

pNe/GUS, and pNf/GUS, respectively, were

grown in E. coli HB101 cells.

2.6. Transformation of tobacco plants

Plasmid DNA was introduced toAgrobacterium

tumefaciens LBA 4404 by electroporation [32].

Tobacco plants were co-cultivated with Agro

-bacterium by the leaf disc-infection method [33,34] and transformants were selected on Murashige and Skoog’s medium [35] supplemented with 100

mg/ml kanamycin and 250 mg/ml carbenicillin.

Regenerated plants were analyzed for the

integration of the promoter-uidAfusion genes into

the plant genome by the polymerase chain reaction (PCR). A sense primer sequence from the GUS

coding region (5%

-CTGCAGCGCTCACACCGA-TACC-3%) and an antisense primer sequence from

the gene for nopaline synthase terminator

(5%- ACAGGATTCAATCTTAAGAAACTTT - 3%)

were used for PCR. Primary transgenic plants and

progeny were referred to as T1 and T2

transformants, respectively.

2.7. Transformation of rice

Rice protoplasts were prepared from suspen-sion-cultured cells according to the method of

Otsuki [36]. Protoplast cells (1×106/mL) were

electroporated in a continuous flow electro-trans-fector (CET-100; JASCO, Tokyo, Japan) with 2

mg of plasmid containing the poxA or poxN

pro-moter-uidA gene and 0.4 mg of pUC19HPT

plas-mid (kindly provided by Dr A. Kato) that

included the CaMV35S promoter and

hy-gromycin phosphotransferase gene as described [37]. Formation of hygromycin-resistant calli from transformed protoplasts and regenerated plants from the calli were carried out as de-scribed [36]. Transformants were initially selected by checking roots for GUS activity. Regenerated plants were analyzed for the integration of the introduced construct into the genome by PCR. In addition, the integration of genes was also confirmed by Southern blot hybridization. Five microgrammes of total DNA from transgenic

rice plants containing the introduced the AA/

GUS or NB/GUS fusion gene was digested with

EcoRI or XbaI and SacI, respectively,

fractiona-tioned by electrophoresis on a 0.7% agarose gel, and blotted onto nylon membrane (Amersham

International plc). A 0.5-kb HincII fragment

from the uidA gene from the pBI101 plasmid

(4)

labeling kit (Takara Shuzo), and used for the hybridization.

2.8. Exposure of transgenic plants to 6arious stresses

Leaf discs (ca. 7 mm in diameter) containing a small vein from various transgenic tobacco plants were incubated in either sterile water (control treat-ment), 1 mM 2-chloroethylphosphonic acid (ethep-hon treatment), or 0.4 mM abscisic acid (ABA treatment) for 48 h. Leaf discs were also exposed to UV-C light for 30 min (15 min per side) at a distance of 30 cm from an UV lamp (sterilization lamp GL-15; Toshiba, Tokyo, Japan); before incubating in water for 48 h (UV irradiation treatment). Leaf discs from healthy untransformed tobacco plants were also treated as mentioned above and were used as controls. The 48 h incubation period consisted of two diurnal cycles of 16 h light (45 mE/s/m2)/8 h dark cycle at 25°C.

Detached leaf blades from several transgenic rice plants were cut to small pieces (about 3 cm in length) and incubated in sterile water, in ethephon, or in ABA, or treated with an UV-lamp, as described for the transgenic tobacco plants. Leaf blades were also wounded by rubbing the leaf with carborundum

(c600; Nacalai Tesque, Kyoto, Japan) before

incubating in water for 48 h. In analysis of trans-genic rice plants, the 48 h incubation was performed at 25°C in dark.

2.9. Measurement of GUS acti6ity

GUS activity was assayed by the method of Kosugi et al. [38]. Leaf discs from transgenic tobacco plants were homogenized in lysis buffer (50 mM sodium phosphate pH 6.8, 10 mM EDTA, 10 mM 2-mercaptoethanol, 0.1% Triton X-100, and 0.1% sarcosyl) in a Eppendorf tube with a glass rod

and carborundum (c600). Leaf blades from

trans-genic rice plants were homogenized in lysis buffer with carborundum by a mortar and pestle. The

homogenate was centrifuged at 10 000×g for 15

min and the supernatant was assayed for GUS enzyme in the presence of 5% methanol. Fluores-cence levels were determined using a Shimazu

RF-540 spectrofluorometer (Shimazu, Kyoto,

Japan). A unit of GUS activity is defined as 1 pmol of 4-methyl-umbelliferone (4-MU) produced per minute per milligram of protein. Protein

concentra-tions were determined by the Bradford method [39] using a commercial kit (BioRad Laboratories, Rich-mond, CA, USA) and bovine serum albumin as the standard.

2.10. Histochemical analysis

Tissue sections from transgenic rice plants were

made to 80 – 100 mm with a microslicer (model

DTK-1000, Dosaka, Kyoto, Japan). Histochemical staining for GUS activity was carried out in 50 mM sodium phosphate buffer (pH 7.0) containing 1 mM 5-bromo-4-chloro-3-indolyl glucuronide (X-Gluc) and 5% methanol as described [34,38]. For peroxi-dase activity staining, tissue sections were incubated in McIlvaine’s buffer (pH 5.0) containing 0.03%

4-chloro-1-naphtol and 0.001% H2O2for 30 min at

room temperature. The reaction was stopped by the addition of 0.2 N sodium carbonate. Lignification

was detected by staining with 8.3 mg/mL

phloroglu-cin in 50% ethanol and 0.3 N HCl.

3. Results

3.1. Isolation and characterization of the poxA gene

A genomic library consisting of approximately

3×105 recombinant phages was screened with

32P-labeled prxRPA cDNA [1] as a probe. Four

positive clones were obtained after the second screening. These clones were plaque-purified and their DNAs purified for analysis of the inserted DNA fragments. As restriction physical mapping analysis indicated that all of the phage DNAs had the same restriction pattern, only one of the four

DNAs, designatedlpoxA, was selected for further

study.

Based on hybridization studies thepoxAgene was

located on a 4237-bpKpnI/HindIII fragment which

was sequenced in both directions. Comparison of the genomic sequence with the cDNA revealed that the gene consisted of three introns and four exons (Fig. 1). The nucleotide sequences of the exons were identical to that of the cDNA. All introns contained

a high percentage of A+T residues (64 – 70%), a

feature characteristic of higher plants genes [40]. In

contrast, the four exons had a lower A+T (40 –

52%) compositions. The 5% and 3% ends of each

(5)

The poxA gene structure is similar to the

previ-ously isolated poxN gene [2] in containing three

introns and four exons (Fig. 1). Its deduced amino acid sequence shares significant homology (63% identity and 85% similarity) to the product coded

by the poxN gene. Despite this similarity in

gen-eral structural organization and coding regions,

thepoxAand poxNgenes contained unique intron

regions which differ in length and in DNA

se-quence. Moreover, the 5%-promoter and 3%

-untrans-lated regions of these genes shared very little homology.

Since our previous results had shown that mR-NAs corresponding to prxRPA and prxRPN cD-NAs accumulated at low levels in healthy rice shoots, we isolated total RNA from wound-treated shoots for a primer extension experiment. We also used total RNA from healthy rice roots, in which the transcripts accumulate to high levels. In both instances, the determined transcription

initiation site of thepoxAgene was a cytosine base

located 38 bp upstream of the AUG codon. Under the same experimental conditions, the

transcrip-tion initiatranscrip-tion site of the poxN gene was not

detected.

3.2. Characterization of the poxA and poxN promoter regions

Putative TATA boxes in the poxA and poxN

genes are located at 70 and 91 bp, respectively, upstream from the translational start. Because both of these peroxidase genes are

wound-in-ducible, the poxA and poxN promoter regions,

were scanned for sequence motifs suggested to be

cis-regulatory elements in plant defence-related

genes (Table 1). One sequence motif, 5%

-AGC-CGCC-3% (a GCC box), is conserved in the

pro-moter regions of the pathogenesis-related proteins,

b-1,3-glucanase and chitinase and is reported to be

an essential sequence for ethylene responsiveness

[42,43]. The poxA and poxN promoters contain

this sequence motif at positions −141 and −222,

respectively, from the translation start. Within both promoter regions, there are also several ho-mologs of the Box P motif found in several

phenylpropanoid gene promoters, particularly

those of phenylalanine ammonia-lyase and 4-cou-marate:CoA ligase genes. Sequences similar to the myb-related protein binding site encoded by the maize P gene [44,45] are also seen. Several

(6)

Table 1

Sequences of putativecis-elements found in thepoxAandpoxN promoters

Gene Sequence (positionb)

Element Motif or core sequencea Reference

AGCCGCC

GCC box poxA AGCCGCC (−141) [42,43]

poxN AGCCGCC (−222)

Box P ACMWAMC poxA CACACCGACCA (−2026) [44,45]

ACTAAACCAAC (−1029) CACCCACTACCAC (−338)

poxN AACCGACCTAGCC (−1253) CACCAACCA (−1075)

SBF GGTTAAWWW poxA GGTTCTATT (−877) [46]

CGTTAAAAT (−367) GGTTGGAA (−346)

poxN GGTTTATA (−938) GTTTATAAT (−880) GATTAAGTT (−541)

CCWACC

Maize P poxA CCTATC (−115) [59]

poxN CCAACC (−1073)

aW and M in the motif or core sequences indicate A or T and C or A, respectively.

bThe positions are given by the number corresponding to the 5% nucleotide in the motif from the translational start codon.

quences homologous to the silencer consensus SBF sequence, GGTTAAWWW (W is A or T), observed in the bean chalcone synthase promoter

[46] are present in both peroxidase 5% flanking

regions.

3.3. Promoter acti6ity in transgenic tobacco plants

To investigate the functional properties of the

poxA and poxN promoters using a transgenic

ap-proach, a series of 5%-promoter deletions fused to

theuidAgene were constructed as shown in Fig. 2.

Each of the DNA constructs was introduced into

tobacco leaf cells by Agrobacterium infection and

regenerated kanamycin resistant plants obtained. The presence of the introduced genes was verified by PCR analysis of genomic DNA and

stress-in-duced GUS activity assayed in leaf discs of the T1 transgenic plants.

The series of transgenic tobacco plants

contain-ing the various 5% promoter deletions of either the

poxA and poxN promoters were treated with

ei-ther ethephon, ABA, or UV light (Fig. 2). Leaf discs from all of the transgenic plants incubated in water alone for 48 h contained only low levels of GUS activity. Ethephon or ABA treatment had no effect on the level of GUS activity from plants containing any of the DNA promoter constructs when compared to the control water treatment. Likewise, all of the plants, except for one, were unaffected by UV light treatment. AF, which

con-tained the smallest promoter fragment of thepoxA

gene showed significantly elevated levels of GUS activity after UV treatment. An identical

(7)
(8)

sponse pattern of the AF plants was observed in T2 transgenic plants. These results indicate that

the poxA gene contains a UV-responsive cis

ele-ment located within −144 bp of translation start

codon that functions in tobacco plants and that a

strong silencing sequence exists between −348

and −144 bp. No induction of GUS activity was

detected for any transgenic tobacco plants

con-taining the poxN promoter.

3.4. Promoter acti6ity in transgenic rice plants

The 2.2-kb poxA and 1.5-kb poxN promoter

regions were fused to theuidAgene to generate the

plasmids, pAa/GUS and pNb/GUS, respectively

(Fig. 2). Both plasmids were introduced into rice protoplasts by electroporation and cultured for the production of transgenic plants. Since both genes were constitutively expressed in healthy roots, GUS activity in the roots of juvenile regenerated plants was assayed histochemically. Nineteen of 24

individuals containing the Aa/GUS gene and 4 of

14 individuals containing the Nb/GUS gene

exhib-ited GUS activity (data not shown). These trans-formants were named AAn – T1 or NBn – T1 plant (AA and NB refer to the introduced chimeric

gene, Aa/GUS or Nb/GUS, and n denotes an

independent line, while T1 means the primary transformed plants). Four lines of AAn plants (AA1 – AA4) and three lines of NBn plants (NB1 – NB3) were selected for further analysis because of their high GUS activities in roots. A third series of

plants containing the 0.6-kb of thepoxApromoter

region fused to the GUS gene were obtained as well. No GUS activity, however, was found in the roots from more than independent 40 transfor-mants indicating that this smaller promoter

frag-ment lacked one or more cis-regulatory elements

for root expression.

To confirm whether the Aa/GUS and Nb/GUS

chimeric genes were integrated into the plant genome, Southern blot was performed on DNAs isolated from AA1 – AA4 and NB1 – NB3 plants

(Fig. 3). The coding region (0.5 kb HincII

frag-ment) of the uidA gene was used as a probe after

digestion of genomic DNAs from AA plants with

EcoRI or from NB plants with XbaI and SacI.

The results indicate that the Aa/GUS and Nb/

GUS genes were integrated in the genomes of the transgenic plants. In addition to the intact gene insertions, rearranged gene copies were also detected.

Healthy rice shoots when subjected to wound-ing, UV irradiation, or treatment of ethephon

showed increase levels of poxA and poxN

tran-scripts [1]. We examined whether the hybrid trans-genes behaved similarly to these abiotic stresses. Fig. 4 shows the changes of GUS activities in leaf blades of the transgenic plants after the various stress treatments. A slight increase in GUS activity was observed in control leaf blades which were incubated in sterilized water for 48 h. When the isolated leaf blades were treated with ethephon, UV irradiation, and wounding, a several-fold in-duction of GUS activity was observed. In contrast, no significant increases in GUS activity over the water control was evident when the leaves were treated with ABA. These results indicate that these

poxA andpoxN promoter fragments contain all of

the cis-elements required for faithful expression

patterns as seen for the native genes.

3.5. Localization of GUS acti6ity, lignin, and peroxidase acti6ity in transgenic rice plants

To determine the spatial expression patterns of

the poxA and poxN genes, histochemical staining

of GUS activities was performed on various tis-sues of the transgenic rice plants. In AA1 – T1 plants, GUS activities were observed in the vascu-lar bundle and cylinder of the shoot apex (Fig. 5A and B), in the xylem parenchyma cells of the leaf blade, and in the root exodermis, endodermis and percycle (Fig. 5C and G). In NB1 – T1 transgenic plants, the same pattern of GUS activities as in AA1 – T1 plants was observed in the shoot apex and roots (data not shown). In addition, GUS activity was detected in xylem parenchyma cells of leaf sheath (Fig. 5H). In both plants, GUS expres-sion was found in the large vascular bundle of not only the leaf blade but also in the leaf sheath. In both AA1 – T1 and NB1 – T1 plants, GUS staining predominated in the leaf blade as compared to the sheath.

(9)

plants. GUS expression in xylem parenchyma cells coincided with or was very close to areas of lignifi-cation (Fig. 5D, E, and I). These observations suggest that both peroxidases may be involved in lignification of the large vascular bundle.

When young whole AA1 – T2 plants were stained with X-Gluc without any stress treatments, GUS was detected in roots particularly in the stele (Fig. 5K) as well as the vascular bundles of the lamina joint (Fig. 5L) and palea (Fig. 5M).

Fig. 3. Southern hybridization of AAn and NBn transgenic rice plants. Total DNA from the AAn – T1 or NBn – T1 rice plants was digested withEcoRI orXbaI/SacI, respectively, and processed for Southern blotting using standard techniques. The lane number denotes an independent transgenic line from AAn – T1 or NBn – T1 plants. Lanes C1 and C2 were applied.EcoRI and

(10)

Fig. 4. Induction of GUS activity in transgenic rice plants. Leaf blades from each transgenic rice plant were treated with 0.4 mM ABA (A), 0.1 M ethephon (E), UV irradiation (U), or wounding (W). After incubation for 48 h at 25°C, GUS activities were measured. 0 indicates the level of GUS activity of a healthy leaf blade. H depicts the level of GUS activity in leaf blades incubated in water (mock treatment). GUS activities shown are an average of six leaf blades subjected to various treatments.

4. Discussion

4.1. Gene Structure

In a previous study [2] we determined the

struc-ture of thepoxN gene which encodes a rice

perox-idase which is distinct from the enzyme encoded

by poxA. Comparison of the poxA and poxN

genes indicates that they have a similar structure of four exons and three introns. More than 50 genes for plant peroxidases have been reported in the various DNA sequence databases (GenBank, EMBL and DDBJ). About 60% of these

peroxi-dase genes, including the poxA and poxN genes,

contain an initial transcription unit of four exons interrupted by three introns. Each of the three introns is located at identical positions within the exon sequences that code for the highly conserved primary sequences of the protein. This gene ar-rangement supports the view that these genes evolved from a common ancestor.

Despite the similarity in overall gene structure,

the poxA and poxN genes encode peroxidase

en-zymes that are likely to play different roles in rice growth and development. The introns and, more importantly, promoter sequences of these genes differ considerably at the DNA sequence level. This sequence divergence in the promoter regions of these genes is likely to reflect differences in their

transcription levels, and in their temporal and spatial patterns of gene expression and, in turn, differences in their function during rice growth and development.

Our previous study [1] showed that both the

poxA andpoxNtranscripts are induced by

wound-ing, treatment with ethephon, and UV-C irradia-tion in rice plants. Consistent with the inducirradia-tion by ethephon, both promoters contain GCC box motives [2]. The GCC box is an ethylene-responsi-ble element and has been found in the promoters of ethylene-inducible PR family of genes (basic PR

genes containing chitinases, and b-1,3-glucanases)

[42,43], but not in ethylene-responsive genes in-volved in ripening and senescence [47,48]. The

presence of this cis-regulatory element and

induc-tion of gene expression by wounding supports the

possibility that the poxA and poxN gene products

belong to the PR family which are closely associ-ated with the ethylene-induced self-defence re-sponse [21,49].

4.2. The acti6ities of the poxA and poxN promoters in transgenic tobacco plants

Various deleted forms of the poxA and poxN

promoters were fused to the uidA gene and the

(11)

state levels of both transcripts were dramatically stimulated by wounding, by treatment of ethephon and by exposure to UV irradiation [1]. However, except for a small increase in promoter activity that was reproducibly observed in AF plants (Fig.

2), none of the other transgenic plants showed an increase in GUS activity by treatment with ethep-hon or by wounding in tobacco (Fig. 2). These results suggest that there is an UV responsible

element located within the −106 bp of the

(12)
(13)

scription start site of the poxA gene and one or more negative regulatory elements, located

be-tween −310 and −106 bp, which suppress the

downstream promoter activity. Two silencer-like sequences similar to that observed in the bean chalcone synthase promoter [46] are located just

upstream of the Af region, GGTTGGAA at −

308 bp and GGTTAGCAC at −265 bp.

Much different poxA and poxN gene expression

patterns to these abiotic stress conditions were seen in transgenic rice. The promoters of both genes responded to wounding and treatment with ethephon or by UV irradiation. These differences in expression patterns between rice and tobacco plants are likely to reflect differences in the tran-scriptional machinery between the monocot rice and dicot tobacco plants. There are reports that monocot genes are sometimes expressed only at low levels in a heterologous dicot plant [50,51]. Additionally, our results indicate the possibility that the two putative silencer elements found in the Ae sequences upstream of the Af region are only effective in tobacco plants but not in rice plants.

4.3. Expression of poxA and poxN promoters in transgenic rice plants

Unlike the situation in transgenic tobacco where the rice peroxidase promoters, except for one in-stance, are inactive (Fig. 2), these promoters direct the same expression patterns as the endogenous peroxidase genes in transgenic rice plants (Fig. 4). Since preparation of the tissue for histochemical staining for GUS activity treatments results in tissue wounding, it is difficult to observe xylem

parenchyma specific expression of the poxA or

poxN gene without any stress treatment. The

ex-pression and its induction of GUS activity (Fig. 4) in transgenic rice plants and northern analyses [1], however, support the view that these genes are expressed at low levels in leaf blade or sheath without stress. Treatment with ethephon or UV-C irradiation and wounding induces their expression. It should be pointed out that ethephon treatment may be not be equivalent to ethylene because ethephon degradation leads not only to the gener-ation of ethylene but also the accumulgener-ation of acids [52].

In transgenic rice plants, AA1 – T2, GUS activ-ity was observed in vascular bundles of lamina

joints and palea from unstressed plants (Fig. 5J,

K, L, and M), suggesting the poxA gene

expres-sion is specifically regulated in a spatial and devel-opmental manner. GUS was also expressed in lamina joints of NB1 – T2 plants but not in the palea (data not shown). Interestingly, lamina joints have been used for a flexuous test of gravit-ropism or phototgravit-ropism via auxin [53]. The ex-pression of these genes in this tissue supports the suggested involvement of peroxidases with auxin metabolism.

Many studies have demonstrated that plant per-oxidases are involved in IAA metabolism [54,55] and the general scheme for IAA oxidation has also been proposed [56]. Recently, Savitsky et al. [57] showed that plant peroxidases share common sub-domains including the catalytic center with plant

auxin-binding proteins. It is unclear if the poxA

peroxidase binds IAA and catalyzes their oxida-tion, but the gene expression in lamina joints suggests such a possible role. Although there are eight vascular bundles in rice caryopsis, GUS was observed in only one vascular bundle of the palea,

suggesting that the poxA gene is expressed in a

strict spatial manner.

BothpoxA andpoxN promoters contain several

Box P-like sequences (Table 1). The Box P element has been identified in the genes that code for enzymes important in the biosynthesis of lignin, lignans and phenylpropanoids including pheny-lalanine ammonia-lyases, 4-coumarate:CoA

lig-ases, and cinnamyl alcohol dehydrogenases

[44,46]. It has been reported that a parsley nuclear protein, BPF-1, binds to the Box P motif and plays an important role in plant defence responses

[44]. Hauff et al. [58] identified the cis-acting

re-gion that is critical for expression of parsley gene for a 4-coumarate:CoA ligase in vascular tissues.

This cis region contains a negative regulatory

ele-ment that suppresses expression in the phloem and a positive element that promotes expression in the

xylem. The product of the maizePgene, amyb

(14)

expres-sion of the poxA and poxN genes. Because genes involved in lignin and lignan biosynthesis are ex-pressed specifically in the xylem or vascular tissue

[45,58,61,62], the localization of poxA and poxN

encoded peroxidase to these tissues support their involvement in lignin and lignan biosynthesis. Fu-ture efforts will be directed at elucidating the specific function of these enzymes in these con-ducting tissues.

Acknowledgements

We are grateful to Dr A. Kato for providing the plasmid pUC19HPT. The authors thank Y. Gotoh for her excellent technical assistance. This work was supported in part by the fund for the En-hancement of Centers of Excellence (COE), the Special Coordination Funds for the Promotion of Science and Technology in Japan, and by Grants-in-Aid for Scientific Research (nos. 06760065 and 07760069) from the Ministry of Education, Sci-ence and Culture, Japan.

References

[1] H. Ito, F. Kimizuka, A. Ohbayashi, H. Matsui, M. Honma, A. Shinmyo, Y. Ohashi, A.B. Caplan, R.L. Rodriguez, Molecular cloning and characterization of two complementary DNAs encoding putative peroxi-dases from rice (Oryza sati6aL.) shoots, Plant Cell Rep. 13 (1994) 361 – 366.

[2] H. Ito, H. Matsui, M. Honma, Y. Ohashi, Genomic nucleotide sequence of a rice peroxidase gene, Plant Physiol. 108 (1994) 1747.

[3] L.M. Lagrimini, S. Rothstein, Tissue specificity of to-bacco peroxidase isozymes and their induction by wounding and tobacco mosaic virus infection, Plant Physiol. 84 (1987) 438 – 442.

[4] D.J. Bowles, Defense-related proteins in higher plants, Ann. Rev. Biochem. 59 (1990) 873 – 907.

[5] K.E. Espelie, P.E. Kolattukudy, Purification and charac-terization of an abscisic acid-inducible anionic peroxi-dase associated with suberization in potato (Solanum tuberosum), Arch. Biochem. Biophys. 240 (1985) 539 – 545.

[6] J. Negrel, J. Lherminier, Peroxidase-mediated integration of tyramine into xylem cell walls of tobacco leaves, Planta 172 (1987) 494 – 501.

[7] L.M. Lagrimini, Wound-induced deposition of polyphe-nols in transgenic plants overexpressing peroxidase, Plant Physiol. 96 (1991) 577 – 583.

[8] X. Zheng, R.B. van Huystee, Peroxidase-regulated elon-gation of segments from peanut hypocotyls, Plant Sci. 81 (1992) 47 – 56.

[9] F.B. Abeles, L.J. Dunn, P. Morgens, A. Callahan, R.E. Dinterman, J. Schmidt, Induction of 33-kD and 50-kD peroxidases during ethylene-induced senescence of cu-cumber cotyledons, Plant Physiol. 87 (1988) 609 – 615. [10] H. Ito, N. Hiraoka, A. Ohabayashi, Y. Ohashi,

Purifica-tion and characterizaPurifica-tion of rice peroxidases, Agric. Biol. Chem. 55 (1991) 2445 – 2454.

[11] C. Reimmann, C. Ringli, R. Dudler, Complementray DNA cloning and sequence analysis of a pathogen-in-duced putative peroxidase from rice, Plant Physiol. 100 (1992) 1611 – 1612.

[12] S.A. Young, A. Guo, J.A. Guikema, F.F. White, J.E. Leach, Rice cationic peroxidase accumulates in xylem vessels during incompatible interactions with Xan

-thomonas oryzae pv oryzae, Plant Physiol. 107 (1995) 1333 – 1341.

[13] L.M. Lagrimini, W. Burkhart, M. Moyer, S. Rothstein, Molecular cloning of complementary DNA encoding the lignin-forming peroxidase from tobacco: molecular anal-ysis and tissue-specific expression, Proc. Natl. Acad. Sci. USA 84 (1987) 7542 – 7546.

[14] K. Fujiyama, H. Takemura, S. Shibayama, K. Kobayashi, J.-K. Choi, A. Shinmyo, M. Takano, Y. Yamada, H. Okada, Structure of the horseradish peroxi-dase isozyme C genes, Eur. J. Biochem. 173 (1988) 681 – 687.

[15] E. Roberts, P.E. Kolattukudy, Molecular cloning, nucle-otide sequence, and abscisic acid induction of a suberiza-tion-associated highly anionic peroxidase, Mol. Gen. Genet. 217 (1989) 223 – 232.

[16] D. Buffard, C. Breda, R.B. van Huystee, O. Asemota, M. Pierre, D.B. Dang Ha, R. Esnault, Molecular cloning of complementary DNAs encoding two cationic peroxi-dases from cultivated peanut cells, Proc. Natl. Acad. Sci. USA 87 (1990) 8874 – 8878.

[17] C. Hertig, R. Gabriela, J. Bull, F. Mauch, R. Dudler, Sequence and tissue-specific expression of a putative peroxidase gene from wheat (Triticum aesti6umL.), Plant Mol. Biol. 16 (1990) 171 – 174.

[18] B. Theilade, S.K. Rasmussen, Structure and chromoso-mal localization of the gene encoding barley seed peroxi-dase BP 2A, Gene 118 (1992) 261 – 266.

[19] F. Ishige, H. Mori, K. Yamazaki, H. Imaseki, Identifica-tion of a basic glycoprotein induced by ethylene in primary leaves of azuki bean as a cationic peroxidase, Plant Physiol. 101 (1993) 193 – 199.

[20] K.G. Welinder, The plant peroxidase superfamily, in: J. Lobarzewski, H. Greppin, C. Penel, T.H. Gaspar (Eds.), Biochemical, Molecular, and Physiological Aspects of Plant Peroxidases, University of Geneva, Geneva, 1991, pp. 3 – 13.

[21] J.M. Zhou, Signal transduction and pathogen-induced PR gene expression, in: S.K. Datta, S. Muthukrishnan (Eds.), Pathogenesis-Related Proteins in Plants, CRC Press, Boca Raton, FL, 1999, pp. 195 – 206.

[22] R. Mohan, A.M. Bajar, P.E. Kolattukudy, Induction of a tomato anionic peroxidase gene (tap1) by wounding in transgenic tobacco and activation of tap1/GUS and

(15)

[23] P.H. Mogens, A.M. Callahan, L.J. Dunn, F.B. Abeles, Isolation and sequencing of cDNA clones encoding ethylene-induced putative peroxidases from cucumber cotyledons, Plant Mol. Biol. 14 (1990) 715 – 725. [24] G. Rebmann, C. Hertig, J. Bull, F. Mauch, R. Dudler,

Cloning and sequencing of cDNAs encoding a pathogen-induced putative peroxidase of wheat (Triticum aesti6um L.), Plant Mol. Biol. 16 (1991) 329 – 331.

[25] P.J. Reimers, A. Guo, J.E. Leach, Increased activity of a cationic peroxidase associated with an incompatible in-teraction between Xanthomonas oryzae pv. oryzae and rice (Oryza sati6a), Plant Physiol. 99 (1992) 1044 – 1050. [26] K.L. Klotz, T.T.L. Liu, L. Liu, L.M. Lagrimini, Expres-sion of the tobacco anionic peroxidase gene is tissue-spe-cific and developmentally regulated, Plant Mol. Biol. 36 (1998) 509 – 520.

[27] K. Hahlbrock, D. Scheel, Physiology and molecular biol-ogy of phenylpropanoid metabolism, Ann. Rev. Plant Physiol. Plant. Mol. Biol. 40 (1989) 347 – 369.

[28] A.J. Mu¨ller, R. Grafe, Isolation and characterization of cell lines ofNicotiana tabacumlacking nitrate reductase, Mol. Gen. Genet. 161 (1978) 67 – 76.

[29] M.G. Murray, W.F. Thompson, Rapid isolation of high molecular weight plant DNA, Nucl. Acids Res. 8 (1980) 4321 – 4325.

[30] F. Sange, S. Nicklen, A.R. Coulson, DNA sequencing with chain-terminating inhibitors, Proc. Natl. Acad. Sci. USA 74 (1977) 5463 – 5467.

[31] R.A. Jefferson, T.A. Kavanagh, M.W. Bevan, GUS fu-sions: –-glucuronidase as a sensitive and versatile gene fusion marker in higher plants, EMBO J. 6 (1987) 3901 – 3907.

[32] R. Nagel, A. Elliott, A. Masel, R.G. Birch, J.M. Man-ners, Electroporation of binary Ti plasmid vector into

Agrobacterium tumefaciens and Agrobacterium rhizoge

-nes, FEMS Microbiol. Lett. 67 (1990) 325 – 328. [33] R.B. Horsch, H.J. Klee, S. Stachel, S.C. Winans, E.W.

Nester, S.G. Rogers, R.T. Fraley, Analysis of Agrobac

-terium tumefaciensvirulence mutants in leaf discs, Proc. Natl. Acad. Sci. USA 83 (1986) 2571 – 2575.

[34] M. Ohshima, H. Itoh, M. Matsuoka, T. Murakami, Y. Ohashi, Analysis of stress-induced or salicylic acid-in-duced expression of the pathogenesis-related 1a protein gene in transgenic tobacco, Plant Cell 2 (1990) 95 – 106. [35] T. Murashige, F. Skoog, A revised medium for rapid

growth and bioassays with tobacco tissue culture, Phys-iol. Plant. 15 (1962) 473 – 497.

[36] Y. Otsuki, A Visual Manual for the Protoplast Culture System of Rice, Food and Agriculture Research Devel-opment Association, Tokyo, 1990.

[37] I. Mitsuhara, M. Ugaki, H. Hirochika, M. Ohshima, T. Murakami, Y. Gotoh, Y. Katayose, S. Nakamura, R. Honkura, S. Nishimiya, K. Ueno, A. Mochizuki, H. Tanimoto, H. Tsugawa, Y. Otsuki, Y. Ohashi, Efficient promoter cassettes for enhanced expression of foreign genes in dicotyledonous and monocotyledonous plants, Plant Cell Physiol. 37 (1996) 49 – 59.

[38] S. Kosugi, Y. Ohashi, K. Nakajima, Y. Arai, An im-proved assay for –-glucuronidase in transformed cells: methanol almost completely suppresses a putative en-dogenous –-glucuronidase activity, Plant Sci. 70 (1990) 133 – 140.

[39] M.M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein – dye binding, Anal. Biochem. 72 (1976) 248 – 254.

[40] G.J. Goodall, W. Filipowicz, The AU-rich sequences present in the introns of plant nuclear pre-mRNAs are required for splicing, Cell 58 (1989) 473 – 483.

[41] S.M. Mount, A catalogue of splice junction sequences, Nucl. Acids Res. 10 (1982) 459 – 472.

[42] Y. Eyal, Y. Meller, S. Lev-Yadun, R. Fluhr, A basic-type PR-1 promoter directs ethylene responsiveness, vas-cular and abscission zone-specific expression, Plant J. 4 (1993) 225 – 234.

[43] M. Ohme-Takagi, H. Shinshi, Ethylene-inducible DNA binding proteins that interact with an ethylene-responsive element, Plant Cell 7 (1995) 173 – 182.

[44] O. da Costa e Silva, L. Klein, E. Schmelzer, G.F. Trezzini, K. Hahlbrock, BPF-1, a pathogen-induced DNA-binding protein involved in the plant defence re-sponse, Plant J. 4 (1993) 125 – 135.

[45] C. Feuillet, V. Lauvergeat, C. Deswarte, G. Pilate, A. Boudet, J. Grima-Pettenati, Tissue- and cell-specific ex-pression of a cinnamyl alcohol dehydrogenase promoter in transgenic poplar plants, Plant Mol. Biol. 27 (1995) 651 – 667.

[46] M.A. Lauton, S.M. Dean, M. Dron, J.M. Kooter, K.M. Kragh, M.J. Harrison, L. Yu, L. Tanguay, R.A. Dixon, C.J. Lamb, Silencer region of a chalcone synthase pro-moter contains multiple binding site for a factor, SBF-1, closely related to GT-1, Plant Mol. Biol. 16 (1991) 235 – 249.

[47] J. Deikman, R.L. Fischer, Interaction of a DNA binding factor with the 5%-flanking region of an ethylene-respon-sive fruit ripening gene from tomato, EMBO J. 7 (1988) 3315 – 3320.

[48] K.G. Raghothama, K.A. Lawton, P.B. Goldbrough, W.R. Woodson, Characterization of an ethylene-regu-lated flower senescence-reethylene-regu-lated gene from carnation, Plant Mol. Biol. 17 (1991) 61 – 71.

[49] L.C. Van Loon, W.S. Pierpoint, T. Boller, V. Conejero, Recommendation for naming plant pathogenesis-related proteins, Plant Mol. Biol. Reporter 12 (1994) 245 – 264. [50] M. Sakamoto, Y. Sanada, A. Tagiri, T. Murakami, Y.

Ohashi, M. Matsuoka, Structure and characterization of a gene for light-harvesting Chl a/b binding protein from rice, Plant Cell Physiol. 32 (1991) 385 – 393.

[51] T. Tsuchiya, K. Toriyama, S. Ejiri, K. Hinata, Molecular characterization of rice genes specifically expressed in the anther tapetum, Plant Mol. Biol. 26 (1994) 1737 – 1746. [52] K.A. Lawton, S.L. Potter, S. Uknes, J. Ryals, Acquired

resistance signal transduction in Arabidopsis is ethylene independent, Plant Cell 6 (1994) 581 – 588.

[53] E. Maeda, Rate of lamina inclination in excised rice leaves, Physiol. Plant. 18 (1965) 813 – 827.

[54] S. Kobayashi, K. Sugioka, H. Nakano, M. Nakano, S. Tero-Kubota, Analysis of the stable end products and intermediates of oxidative decarboxylation of indole-3-acetic acid by horseradish peroxidase, Biochemistry 23 (1984) 4589 – 4597.

(16)

oxidation of indole-3-acetic acid catalyzed by two cyto-solic isoperoxidases from Lupinus, Planta 181 (1990) 448 – 450.

[56] I.G. Gazarian, L.M. Lagrimini, F.A. Mellon, M.J. Nal-drett, G.A. Ashby, R.N.F. Thorneley, Identification of skatolyl hydroperoxide and its role in the peroxidase-catalysed oxidation of indol-3-yl acetic acid, Biochem. J. 333 (1998) 223 – 232.

[57] P.A. Savitsky, I.G. gazaryan, V.I. Tishkov, L.M. Lagri-mini, T. Ruzgas, L. Gorton, Oxidation of indole-3-acetic acid by dioxygen catalysed by plant peroxidases: specific-ity for the enzyme structure, Biochem. J. 340 (1999) 579 – 583.

[58] K.D. Hauffe, S.P. Lee, R. Subramaniam, C.J. Douglas, Combinatorial interactions between positive and negative cis-acting elements control spatial patterns of 4CL-1 expression in transgenic tobacco, Plant J. 4 (1993) 235 – 253.

[59] E. Grotewold, B. Drummond, B. Bowen, T. Peterson, The myb-homologous P gene controls phlobene pigmen-tation in maize floral organs by directly activating a flavonoid biosynthetic gene subunit, Cell 76 (1994) 543 – 553.

[60] L. Tamagnone, A. Merida, A. Parr, S. Mackay, F.A. Coulianez-Macia, K. Roberts, C. Martin, The Am-MYB308 and AmMYB330 transcriptional factors from Antirrhinum regulate phenylpropanoid and lignin biosynthesis in transgenic tobacco, Plant Cell 10 (1998) 135 – 154.

[61] M. Bevan, D. Shufflebottom, K. Edwards, R. Jefferson, W. Schuch, Tissue- and cell-specific activity of a pheny-lalanine ammonia-lyase promoter in transgenic plants, EMBO J. 8 (1989) 1899 – 1906.

[62] Z.-H. Ye, J.E. Varner, Differencial expression of two O-methyltransferases in lignin biosynthesis inZinnia ele

-gans, Plant Physiol. 108 (1995) 459 – 467.

Gambar

Fig. 1. Restriction maps of poxA gene in lpoxA clone and poxN genes. The shaded boxes denote exon regions for each gene
Fig. 3. Southern hybridization of AAn and NBn transgenic rice plants. Total DNA from the AAn – T1 or NBn – T1 rice plants was digested with EcoRI or XbaI/SacI, respectively, and processed for Southern blotting using standard techniques
Fig. 4. Induction of GUS activity in transgenic rice plants. Leaf blades from each transgenic rice plant were treated with 0.4 mM ABA (A), 0.1 M ethephon (E), UV irradiation (U), or wounding (W)
Fig. 5. GUS activity, peroxidase activity, and lignification of transgenic rice plants

Referensi

Dokumen terkait

remains mostly insoluble. However, in soils with.. Root-exuded citrate increases substrate acidification and improves aluminum tolerance in transgenic tobacco plants. A) Control

Total activities of catalase and peroxidase specific to guaiacol in the leaves of cucumber plants subjected to chilling stress (A).. One unit of catalase is defined as the amount

Similarly as in the case of tobacco plants, trans- formation with appropriate vectors resulted in the viable transgenic BY-2 cell lines that overex- pressed the major variants of H1

Antisense expression of OsLRK 1 in rice plants resulted in increased numbers of flower organs, suggesting that the OsLRK 1 gene is involved in floral meristem activity.. © 2000

This strategy requires the expression of two genes in transgenic plants: the gene encoding the protein responsible for the regu- lation (transcriptional repressor or activator) and

Mizukami Y, Ma H: Ectopic expression of the floral homeotic gene AGAMOUS in transgenic Arabidopsis plants alters floral organ identity. Bowman JL, Smyth DR, Meyerowitz EM:

For example, expression of the Aspergillus glucose oxidase (AGO) gene in transgenic potato plants increased disease resistance in growth chamber experiments [47] but

An example is the conditional expression of the bacterial avrRpt2 avirulence gene under the control of the GVG sys- tem in transgenic Arabidopsis plants carrying the