Journal of
Indonesian Natural History
July 2014 Vol.2 No.1
Dr. Wilson Novarino
Associate Professor for Biology Department of Biology
University of Andalas, Indonesia
Email: editorjinh@jinh.org
Journal of Indonesian Natural History
Dr. Carl Traeholt
Programme Director, Southeast Asia Research and Conservation Division Copenhagen Zoo, Denmark
Email: ctraeholt@pd.jaring.my
Dr. Ardinis Arbain
University of Andalas, Indonesia
Indra Arinal
National Park Management, Department of Forestry Indonesia
Dr. Ahimsa Campos-Arceiz
Nottingham University Malaysia Campus, Malaysia
Dr. Mads Frost Bertelsen
Research and Conservation Division, Copenhagen Zoo, Denmark
Dr. Susan Cheyne
Oxford University, Wildlife Research Unit, United Kingdom
Bjorn Dahlen
Green Harvest Environmental Sdn. Bhd, Malaysia
Dr. Niel Furey
Centre for Biodiversity Conservation, Royal University of Phnom Penh, Cambodia
Dr. Benoit Goossens
Cardiff University, United Kingdom
Dr. Djoko Iskandar
Bandung Institute of Technology, Indonesia
Dr. Matthew Linkie
Fauna & Flora International, Singapore
Dr. Erik Meijaard
People and Nature Consulting International, Indonesia
Dr. John Payne
Borneo Rhino Alliance, Malaysia
Dr. Ramadhanil Pitopang
Tadulako University, Indonesia
Dr. Lilik Budi Prasetyo
Bogor Institute of Agriculture, Indonesia
Dr. Dewi Malia Prawiradilaga
Indonesia Institute of Science, Indonesia
Dr. Rizaldi
University of Andalas, Indonesia
Dr. Dewi Imelda Roesma
University of Andalas, Indonesia
Dr. Jeffrine Rovie Ryan
Wildlife Forensics Lab, Dept. of Wildlife and National Parks, Malaysia
Boyd Simpson
Research and Conservation Division, Copenhagen Zoo, Denmark
Robert B. Stuebing
Herpetology and Conservation Biology, Indonesia
Dr. Sunarto
WWF-Indonesia
Dr. Jatna Supriatna
University of Indonesia
Dr. Campbell O. Webb
The Arnold Aboretum, Harvard University, USA
Dr. Zainal Z. Zainuddin
Borneo Rhino Alliance, Malaysia
Editorial board
The Journal of Indonesian Natural History is published biannually by the Department of Biology at the University of Andalas, Padang, Sumatra Barat, Indonesia, in collaboration with Copenhagen Zoo, Denmark. The Department of Biology at University of Andalas is dedicated to educating Indonesian biologists in the study and conservation of Indonesia’s biodiversity and natural history. Copenhagen Zoo, through its Research and Conservation Division, supports in-situ conservation in Southeast Asia by assisting local organizations and individuals who undertake research, capacity building and the implementation of conservation programmes and projects.
The Journal of Indonesian Natural History is published by the Department of Biology, University of Andalas, Indonesia in collaboration with Copenhagen Zoo, Denmark. It is available for free from www.jinh.net
Cover photo: The beautiful Javan black-winged starling, Acridotheres melanopterus, known locally as Jalak Putih is almost extinct in the wild. It is listed as Critically Endangered on the IUCN red-list © Anaïs Tritto
Editors
E
ditorialWhen the “Convention on BiologiCal Diversity” (CBD) was launched in 1992, it was an important milestone for the World’s conservation community and for the Global community as a whole. It was the first comprehensive far-reaching international agreement that attracted support from most nations across the Globe. For the first time in history, a majority of the World’s nations acknowledged the value of biological diversity and the impending crisis if nothing was done to prevent the onslaught on the World’s natural resources. Since then, the human population passed 7.15 billion in July, 2013 (Worldometer, 2014), the total excretion of CO2 has grown more than predicted and reached 34.5 billion tons in 2012 (Boden et al., 2011;
Oliver et al., 2013; Peters et al., 2012. Raupach et al., 2007), the dependency on fossil fuel is at its highest ever, the Earth’s seas are getting increasingly polluted and overfished (FAO, 2011; Olden et al., 2007; Pham et al., 2014) and the destruction of tropical rainforests takes place at an unprecendent rate at all continents with tropical rainforests (Hansen et al., 2013; Hansen et al., 2010; Margono et al., 2014, 2012). In light of this, it is tempting to claim that the Rio Convention merely sputters on, and many have questioned its relevance in the 21st Century.
Whilst the adoption of the Rio Convention is a straight forwards process, the operationalization of it requires far more commitment at national and international levels. The task for each nation and the international community is monumental. For the ideas behind the Rio Convention to have real effect on the ground it requires that relevant national policies are formulated, mainstreamed and implemented. This process requires most sectors of society and governance to collaborate constructively. A policy needs a supporting legislative framework, and a responsible agency must be appointment with the mandate to implement the policy cross-sectorally. The implementation of the policy must
also be supported by enforcement agencies and penal codes formulated for law-breakers. It needs to be adopted at provincial and district level too, and mainstreamed into local governance. Finally, it requires local citizens to embrace the idea and voluntarily make a concerted attempt to manage their lives accordingly. Whereas policy formulation, legal framework development and enforcement may seem daunting tasks, the biggest challenges often remain with the local citizens and transforming the current economic structure into a system that incorporates environmental and social values into overall budget evaluations. The value of, for example, “clean air” or the cost of “polluted water” is inherently difficult parameters to incorporate into the current economic system.
In a Global perspective, biodiversity conservation is an enormous task that most nations are not yet willing to commit to --- at least not at a scale that makes real positive differences. The cost of managing, for example, the World’s terrestrial biodiversity sustainably is estimated at approximately US$ 80 billion annually, and only 12%
is currently being committed to this task (McCarthy et al., 2012; CBD, 2012). Despite the Global community’s pledged support and commitment to CBD’s 2020 Aichi targets there is a huge financial shortfall if all types of habitats (e.g terrestrial, freshwater, marine) should be sustainably managed. Some of the World’s largest economies continue to pursue wealth creation through extraction based economic development despite the launch of many international policy intitiatives (e.g.
REDD, Climate Change, UNEP Fi).
Indonesia ratified the CBD on the 23rd of August, 1994, exactly 20 years ago. So where does Indonesia rank in a conservation conext? Has there been any meaningful commitment to the CBD and conservation progress?
Indonesia has 566 national parks, nature reserves and wildlife sanctuaries covering 360,693 km2, which consist of 490 terrestrial protected areas (225,401
Indonesia 20-years after ratifying the Convention on Biological Diversity - a status check
Carl Traeholt1 and Wilson Novarino2
1Copenhagen Zoo, Southeast Asia Programme, Malaysia
2University of Andalas, Padang, Sumatra
Corresponding authors: email: editorjinh@jinh.org
km2) and 76 marine protected areas (135,291 km2). The terrestrial protected areas include 43 National Parks, 239 Nature Reserves, 70 Game Reserves, 13 Hunting Parks, 22 Grand Forest Parks, and 103 Nature Tourism Parks. Yet, after Brazil, Indonesia has the second highest rate of primary forest loss in the World (Hansen et al., 2013; Stibig et al., 2014; Wilcove et al., 2014). Even with the Indonesian forest moratorium in place since 2011 new licenses covering approximately 5.5 million hectares have been issued by the Ministry of Forestry for various development purposes. Critics claim that 4.5 million hectares of it have been excised from areas that were originally classified for conservation and that data unavailability undermines confidence in the moratorium, highlighting transparency issues (Sloan, 2014).
The implementation and mainstreaming of the CBD concepts does not always progress optimally in Indonesia.
However, serious actions are being taken to meet the 2020 Aichi Biodiversity Targets. In situ conservation is carried out through the establishment of conservation areas, such as biosphere reserves, wildlife sanctuaries, national parks, ecotourism parks, forest parks and hunting parks. Coverage of these areas increased from 7.628 million ha in 1981 to 27.968 million ha in 2007 (MoE, 2009). Community-based forestry projects, covering 2 million ha, have also been established, and despite vast tracts of land being developed into palm oil estates, a significant portion of these are also being set aside as “high conservation value” areas. Furthermore, ex-situ conservation activities have increased the number of species of flora and fauna being successfully bred in captivity from 171 species in 2006 to 416 species in 2008 (MoE, 2009).
Breeding species in captivity is in itself a poor measurement for conservation success, however. Instead, the Ecosystem Approach is being used to develop a programme for the conservation and management of marine and fish resources. Management plans have also been approved for more than 100 conservation areas, while others are still being developed. Several regencies have been designated as conservation areas realising that these play a vital role in regional development.
Many conservation initiatives are based in the 2003
“Indonesian Biodiversity Strategy and Action Plan (IBSAP)” that was developed with a focus on achieving five goals: 1) to encourage changes in attitude and behavior of Indonesian individuals and society, as well as in existing institutions and legal instruments, 2) to apply scientific and technological inputs, and local wisdom, 3) to implement balanced conservation and sustainable use of biodiversity, 4) to strengthen institutions and law enforcement, and 5) to resolve conflicts over natural resources. Currently, Indonesia is
in the process of updating the IBSAP (2003) to 2020. The intention is for the updated IBSAP to be mainstreamed into sectoral policies, plans and programmes through its integration in the Medium-term National Development Plan (2014-2019). The updated IBSAP will also include elements for monitoring and evaluating implementation at the national and local levels. The one issue that has received criticism is that the IBSAP remains a voluntary concept that provinces and districts can chose to accept or reject.
Considering Indonesia’s diverse cultural heritage, economic challenges and vast territory, it is not surprising that conservation progress has been slow. Policy implementation lacks behind, too many management plans collect dust on shelves in offices and the majority of Indonesia’s national parks and protected areas are considered “paper parks”. Yet, important policies are being institutionalised to guide sustainable development processes, and an increasing amount of resources is being allocated for environmental and biodiversity management. “Green” technology and innovation is encouraged and supported, and economic initiatives are set in motion that aim to transform Indonesia’s economic framework from classic “extraction based”
into a “resource-based” system. Indonesia has also seen a surge in international education being offered for its citizens. One of the most visionary developments is the establishment of the Indonesia Learning Center (ILC) by American conglomerate General Electric in collaboration with three Indonesian state enterprises:
Pertamina (state oil & natural gas mining company), PLN (government-owned electricity company), and Garuda Indonesia (the national airline of Indonesia).
The ILC intends to provide leadership-training courses both for internal employees and external customers according to World famous Crotonville’s curriculum and learning experience. Senior faculty members at Crotonville, New York, are brought to Indonesia to deliver leadership training to the nation’s current and future talents. Since good leadership is essential to good governance, Crotonville’s entering into Indonesian education and corporate governance promises very positive development prospsects for the nation.
One of the major challenges for the incoming President will be to continue to support the processes of economic change and transformation. His cabinet and advisers must be able to set aside conventional economic approaches that continue to propose economic deficiencies are best fixed with the same problems that created them. At the current Global economic slowdown, Governments across the World institute various conventional economic mechanisms (e.g. lower interest rates; public bail-outs) to encourage public and
coporate spending. In reality, it is like pretending there is consumer demand for various goods even if there is none. At the onset of the 21st century the incoming Government must be steadfast and refrain from the temptation to follow conventional economics and not attempt to combat budget deficiency by creating more depth.
With a population of 230 million citizens, urban planning plays a significant role in biodiversity conservation too. It is tempting to solve urban housing deficiency by setting up standardised concrete buildings, because these can be erected rapidly and rationally.
This approach, however, remains rooted in an utopian belief that “livability” can be calculated according to mathematical and economic models. At a planning level, it is easy to subscribe to mapping urban development according to functionality, vis-a-vis separate housing estates, working areas and recreational areas from each other. Whilst it may have economic merrits, it creates a one-dimensional environment that rarely meets modern urban citizens’ demands for livelihood diversity and experience.
There remain substantial biodiversity challenges for Indonesia in the immediate and long-term future.
However, the nation has made a commendable beginning and, despite many challenges, Indonesia lives up to its CBD-responsibilities to a much larger degree than most of its peers.
r
EfErEncEsBAPPENAS (2003). Indonesian Biodiversity Strategy and Action Plan. The National Development Planning Agency (BAPPENAS).
140pp.
Boden, T.A., Marland, G. and R.J. Andres (2011). Global, Regional, and National Fossil-Fuel CO2 Emissions. Carbon Dioxide Information Analysis Center, Oak Ridge National Laboratory, U.S.
Department of Energy, Oak Ridge, Tenn., U.S.A. doi 10.3334/
CDIAC/00001_V2011.
FAO (2011). Review of the state of world marine fishery resources.
FAO Fisheries and Aquaculture Technical Paper 569. Rome, Italy.
354pp.
Hansen, M.C., Potapov, P.V., Moore, R., Hancher, M. et al. (2013).
High-Resolution Global Maps of 21st-Century Forest Cover Change.
Science 342(6160): 850-853. [DOI:10.1126/science.1244693].
Hansen, M.C., Stehman, S.V. and P.V. Potapov (2010). Quantification of global gross forest cover loss. Proc. Natl. Acad. Sci. 107: 8650–
8655.
McCarthy et al. (2012) Financial Costs of Meeting Two Global Biodiversity Conservation Targets: Current Spending and Unmet Needs. Science 338(6109): 946-949. DOI: 10.1126/science.1229803.
Ministry of Environment (2009). The 4th National Report for CBD.
Biodiversity Conservation Unit, Ministry of Environment. Jakarta, Indonesia.
Margono, B.A., Potapov, P.V., Turubanova, S., Stolle, F. and M.C. Hansen. (2014). Primary forest cover loss in Indonesia over 2000–2012. Nature Climate Change 4: 730–735. doi:10.1038/
nclimate2277.
Margono, B. A., Turubanova, S., Zhuravleva, I., Potapov, P., Tyukavina, A., Baccini, A., Goetz, S. and M.C. Hansen (2012).
Mapping and monitoring deforestation and forest degradation in Sumatra (Indonesia) using Landsat time series data sets from 1990 to 2010. Environ. Res. Lett. 7: 034010.
Olden, J. D., Hogan, Z. S. and Zanden, M. J. V. (2007). Small fish, big fish, red fish, blue fish: size-biased extinction risk of the world’s freshwater and marine fishes. Global Ecology and Biogeography, 16: 694–701. doi: 10.1111/j.1466-8238.2007.00337.x.
Oliver, J.G.J., Janssens-Maenhout, G., Muntean, M. and J.A.H.W.
Peters (2013). Trends in global CO2 emissions, 2013-Report, The Hague: PBL Netherlands Environmental Assessment Agency; Ispra:
Joint Research Centre.
Peters, G., Marland, C., Le Quere, T., Boden, J., Canadell, G. and M.R. Raupach (2012). Rapid growth in CO2 emissions after the 2008-2009 global financial crisis. Nature Climate Change 2: 2–4.
Pham C.K., Ramirez-Llodra E., Alt C.H.S., Amaro T., Bergmann M., et al. (2014). Marine Litter Distribution and Density in European Seas, from the Shelves to Deep Basins. PLoS ONE 9(4): e95839.
doi:10.1371/journal.pone.0095839.
Raupach, M.R., Marland, G., Ciais, P., Le Quere, C., Canadell, J., Klepper, G. and C. Field (2007). Global and regional drivers of accelerating CO2 emissions. Proceedings of the National Academy of Sciences 104(24): 10288–10293.
Sloan, S. (2014). Indonesia’s moratorium on new forest licenses: An update. Land Use Policy 38: 37–40.
Stibig, H. J., Achard, F., Carboni, S., Rasi, R. and J. Miettinen ((2014). Change in tropical forest cover of Southeast Asia from 1990 to 2010. Biogeosciences 11: 247–258.
UNEP/CBD/COP (2012). Resourcing the Aichi Biodiversity Targets: A first assement of the resources required for implementing the Strategic Plan for Biodiversity 2011-2020. UNEP/CBD/COP. 83 pp.
Wilcove, D.S., Giam, X., Edwards, D.P., Fisher, B. and Koh, L.
P. (2014). Navjot’s nightmare revisited: Logging, agriculture, and biodiversity in Southeast Asia. Trends Ecol. Evol. 28: 531–540.
Worldometer (2013). http://www.worldometers.info/world- population, accessed 3 April, 2014.
f
atwaagainstillEgalwildlifE traffickingini
ndonEsiaIn March 2014, the Indonesian Council of Ulama --- Indonesia's top Muslim clerical body --- issued a fatwa (Fatwa No. 04, 2014) on Conservation of Threatened Wildlife to maintain Ecosystem balance. In a religious context, it effectively requires Indonesia’s 200 million Muslims to take an active role in protecting and conserving endangered species, including tigers, rhinos, elephants, and orangutans. At the same time, it declares illegal hunting or illegal trading of endangered species to be haram (forbidden). The fatwa is believed to be the first of its kind in the World and is a welcome example of a religious body engaging proactively and responsibly in an area usally covered by existing civil laws.
The fatwa is not “implementable” per se, but is issued to give an explanation, as well as guidance, to all Muslims in Indonesia on the sharia law perspective on issues related to animal conservation. It will supplement existing Indonesian law and it is hoped that this proactive initiative by the Indonesian Council of Ulama will have positive impact on the current exscallating illegal wildlife trade in the country.
f
EmalEs
umatranrhinorEscuEdins
abah, m
alaysiaOn the 21st of March, 2014, a critically endangered female Sumatran rhino (Dicerorhinus sumatrensis) was successfully rescued from a very remote area in Danum Valley and translocated to join male (Tam) and a female (Puntung) rhinos at the Borneo Rhino Sanctuary (BRS) Facilities in Tabin Wildlife Reserve. Due to the remote capture area, she had to be flown in a Sikorsky S-64 Helicopter that was made available by Erickson Air- Crane Inc. She was named “Iman” (Fig. 1), after a small river near where she was caught, and her rescue was a result of a year of intense efforts to make every last rhino in Malaysia count towards efforts to prevent the extinction of one of the world’s most critically endangered species. The Sabah State Cabinet had previously heeded advice from local and international
n Ews and n otEs
rhino experts and agreed that the only way to ensure that every Sumatran rhino in Sabah plays a role in saving the species is to bring all of them into a managed, fenced facility, with the necessary local and global expertise and collaboration to breed them.
Once Iman is settled into Tabin, the Sabah Wildlife Department and Borneo Rhino Alliance (BORA) will review all the potential options on how she can best contribute to her species. But it is expected that Iman will be given a reasonable time to mate with the male, Tam, at the BRS. Ealier Tam had been slotted to be loaned to Cincinnati Zoo as part of a breeding collaboration, where there is already a fertile female. If Iman proves to be fertile and the pair compatible, it might not be necessary for Tam to fly to Cincinnati to mate.
d
rasticmEasurEsnEEdEdtosavEs
umatranrhinosfromExtinctionThe successful capture of a female Sumatran rhino in Danum Valley, Sabah, in March 2014 renewed hope of establishing a local breeding population in Sabah. After capture Iman, as the rhino was named, exhibited various indications similar to pregnancy but a detailed ultrasound examination under anesthesia by specialists from the Leibniz Institute for Zoo and Wildlife Research Berlin (IZW) with local counterparts revealed that what had been suspected to be a fetus was in fact a collection of tumors in the uterus. A thorough examination revealed that some of the tumors were as Figure 1. A female Sumatran rhino a day after capture, March 2014, from Danum Valley, Sabah. The rhino named
“Iman” was in poor reproductive health © John Payne
big as footballs. This indicates that Iman has not been sexually active for 5-10 years, most likely because there are too few males left, if any at all, in the wild.
The discovery of the poor reproductive condition of Iman is simmilar to that of Puntung, a female captured in 2011, and a young poached female from 2001. It is a big blow to the Global Sumatran Rhino Breeding program and it reiterates the critical need for assisted reproduction techniques such as in vitro fertilisation.
It is evident that Sabah’s rhino population is far too small to recover without human intervention. While Sumatran populations appear to reproduce naturally in the wild the threat of poaching continues to push Sumatra’s remaining small wild populations into a similar irreversible extinction vortex as is undeniably happening to the rhinos in Sabah.
BORA executive director, Dr. Junaidi Payne, stated that
“everyone concerned with preventing the extinction of this magnificent species really ought to work collaboratively to share knowledge, ideas, experience, gametes and rhinos. That includes Indonesia and Malaysia, and the various specialists, notably IZW”.
m
orEplansmadEtosavEJ
avanlEopard Recently the Indonesian Forestry Ministry held a two day“National Conference on Javan Leopard” workshop at the Indonesia Safari Park in Cisarua, Bogor, West Java, to develop a Javan leopard conservation strategy and action plan aimed at saving the species from extinction.
Dozens of participants from insitutions including the Indonesian Wild Animals Conservation Forum (FOKSI), the Indonsian Zoo and Aquarium Association (PKBSI), Indonesia Safari Park, the Harimau Kita Forum, Java Carnivore Awareness, the Indonesian Institute of Sciences (LIPI), Bogor Agricultural Institute and research institutions provided the ministry with four key recommendations: a) conservation of Javan leopard in its natural habitat, b) the need to include conservation institutions (e.g. zoos and wildlife refuges), c) public awareness tasks, and d) financing conservation and research activities. An important addition to the stategic approach was the inclusion of ex-situ conservation actions. The participants agreed that it is critical to manage the genetic quality of all captive Javan leopard individuals, and that a studbook keeper should be appointed to oversee this.
Also highlighted was the need to develop standard surveying methods, technical guidelines on the protection of the animals victimized in conflicts and the establishment of the Javan Leopard Forum.
There is still no accurate population estimate for Javan leopard, although it is expected to number in the range of 400-500 indviduals. The main reason for the general decline of the species is believed to be associated with habitat loss, due to expanding production forests and agricultural land. A Javan Leopard Forum was declared by 10 representatives of various stakeholders from state-run forestry enterprise PT Perhutani, Foksi, Java Carnivore Awareness, the Indonesia Institute of Sciences (LIPI), the Bogor Agricultural Institute, the Conservation Breeding Specialist Group Indonesia and the Zoological Society of London. The Javan leopard conservation strategy and action plan is expected to be approved by the Forestry Ministry in the near future, and it will provide a much needed guidance to ensuring the long-term survival of Java’s top predator.
g
lobalforEstwatch tracks whErE trEEs fallIt is well knowned that forests across the world are vanishing at an astonishing rate, and with it biodivesity.
Sometimes it is hard to visualise just how serious the problem is. The World Resources Institute (WRI) recently released a new online mapping tool that aims to put all the eyes of the world on forests everywhere in the World, with near-real time monitoring. The system combines satellite pictures, computer algorithms and crowd-sourced data to provide an up-to-date look at the health of forests across the World. The system named
“Global Foresty Watch” is developed in collaboration with dozens of partners and will allow users with a computer and internet access to zoom into a forest anywhere in the world and see where trees are being lost as well as how fast it is being lost. The system has a resolution of 30 meters and will be able to detect if a stand of trees is felled by logging or fire, or wasted away by disease. A very important fact is that WRI provides the Global Forest Watch as an “open source”
platform that any person can use for free. Hopefully, the system will contribute to ending the procrastinated denial and secrecy of forest clearings across the Globe and begin a more factual and progressive debate about how to manage, protect and replace forested areas.
n
EpalcElEbratEs‘
zEropoachingyEar’
forrhino
,
tigEr andElEphantNepal recently celebrated a monumental conservation achievement: 365 days without a single incident of rhino, tiger or elephant poaching record in any of the country’s protected areas. The achievement has to be seen in contrast to the huge increases in elephant and rhino poaching worldwide, and is testament to the collective commitment of Nepal’s Department of National Parks and Wildlife Conservation (DNPWC) and its national and international collaboraters. The last reported incident of rhino poaching in the country occured on February 16, 2013. In recent years, the Nepalese Government have focused increasingly on its conservation plight, aomng others by establishing the Wildlife Crime Control Coordination Committee at the national level and the Wildlife Crime Control Bureau at the district level and increased law-enforcement. In 2013 alone, law enforcement officials arrested more than 700 wildlife criminals in the country. This has resulted in a significant decrease in poaching and illegal wildlife trade, and a rise in the rhino population.The success is a good example of combined efforts in protected area and species management IUCN’s country representative pledged continued support to the DNPWC in the future.
Despite this recent success, the large number of arrests in 2013 indicate that Nepal is still a major transit point for trade and the smuggling of body parts of endangered animals. Between February 2013 and February 2014 authorities seized 1,200 grams of tiger bone, two rhino horns, a rhino toe, six leopard hides, and 11 red panda hides.
A 2011 rhino census revealed that 534 Greater One- horned rhinos still persist in Nepal; 503 of these occur in Chitwan National Park, 24 in Bardiya National Park and seven in Shuklaphanta Wildlife Reserve.
t
hEworld’
s firstnEt-
zEroEnErgy skyscrapErrisEsini
ndonEsiaThe Pertamina Energy Tower will soon become the world’s first net-zero energy skyscraper. It will be built in the center of Indonesia’s capital, Jakarta, and expected to be complited by 2019. It will consists of 99 stories and serve as the headquarters of Pertamina, the national energy company. Up to 20,000 people will
work there, where there will also be a campus that has a mosque, a sports center and a 2,000-seat auditorium for the performing arts. The design appears like a funnel, the top of the tower opens at the top, capturing wind and sucking it inside to run a series of vertical wind turbines that provide 25 percent of the building’s electricity.
The façade will be calibrated for Jakarta’s proximity to the equator to mitigate solar heat gain throughout the day as well as year. The sides of the building will be made as sun-shading “leaves” that allow daylight to enter while shielding the building from glare and heat from the sun, and airconditioners will be replaced with radiant cooling systems. The power will be supplied by thousands of solar panels and geothermal facilities.
In the past decade, Indonesia has developed a long range of policies aimed at guiding the Nation into a path of sustainable development. The Pertamina Energy Tower will reflect Indonesia’s sustained commitment to sustainable development, and possible propell the nation into a small group of elite nations taking a big step towards a resource based economy.
n
EwEu
initiativEtoprotEctbiodivErsity andfightwildlifE crimEOn the International Day for Biological Diversity today, the Commission is launching a major new initiative to halt biodiversity loss and eradicate poverty in developing countries. The EU Biodiversity for Life (B4Life) initiative is designed to assist needy countries protect their national ecosystems, combat wildlife crime and develop green economies. B4Life will operate with an estimated budget of up to €800 million for the period 2014-2020 and will focus on Least Developed Countries and countries containing “biodiversity hotspots”, the places where ecosystems and their services are the richest but also the most threatened.
The past two decades have manifested that biodiversity and development are closely linked and mutually reinforcing --- that is, healthy ecosystems sustain development while development impacts on habitats.
Therefore, the B4Life focus on ecosystem conservation and restoration as an opportunity to generate growth, create jobs and reduce poverty through developing new strategic frameworks for green economy. B4Life will operate in three priority areas:
• Promoting good governance of natural resources.
• Securing healthy ecosystems for food security.
• Developing nature-based solutions towards a green economy.
In addition to the three priority areas, B4Life will include a special ‘Wildlife Crisis Window’ (WCW), dedicated to combating the increase in the illegal trade of endangered species, particularly in Africa. As well as threatening species, wildlife poaching and trafficking harm local and national security. There are mounting evidence that rebel militias and possibly terrorist groups are involved in elephant and rhino poaching as a means of financing their actions. The WCW aims at tackling poaching and trafficking at all levels --- at a local level by securing the management of priority protected areas;
at a national level by reinforcing the rule of law by tackling corruption and improving investigation; at a regional level by promoting anti-criminal networks and the creation of cross-border protected areas, and by improving species monitoring; and internationally by supporting organisations specialised in the fight against wildlife crime, illegal trade and smuggling.
a
ssociation fort
ropicalb
iology andc
onsErvation mEEting, c
airnsThe Association for Tropical Biology and Conservation (ATBC) held its 51st annual meeting in Cairns, Australia.
The event also included the Asia-Pacific Chapter (AP) meeting and was co-hosted by James Cook University.
The 2014 annual meeting became the largest congregation of tropical biologists ever in Australia, with 589 registered scientists and conservationists from 55 nations participating. The event theme was The Future of Tropical Biology and Conservation and almost 200 oral presentations were delivered in five concurrent sessions along with almost 100 posters.
In lieu of the recent plans for port development and associated dredging in the Abbott Point area near Bowen, Queensland, the meeting produced the ATBC 2014 Cairns Declaration in Support of Stronger Protection of the Great Barrier Reef. The declaration focus particularly on the feasibility of the offset requirement for reducing net sediment input into the Great Barrier Reef Marine Park, and the cumulative effect of this development to the marine ecosystem. The ATBC Cainrs Declaration can be downloaded at: http://
tropicalbiology.org/atbc-2014-cairns-declaration/.
The Asia-Pacific Chapter meeting reconstituted the chapter board and decided that the 2015 AP-meeting will take place in Cambodia. The team will be preparing for this event.
f
orEstsa
sias
ummit, J
akartaOne of the most important and largest events in the region took place in Jakarta from 5-6th of May, 2014.
The Forests Asia Summit: Sustainable Landscapes for Green Growth in Southeast Asia was organised by the Center for International Forestry Research (CIFOR) and co-hosted by the Indonesian Ministry of Forestry.
The event was the largest in Asia in recent years and attracted more than 1,000 leading stakeholders from Southeast Asia and across the world. It saw ministers from across Southeast Asia join CEOs, civil society leaders, development experts and the world’s top scientists, to share knowledge on how the region can accelerate the shift toward a green economy by better managing its forests and landscapes. Thousands more participated online or through nationwide broadcasts, and there were special learning events with leading global experts on the Green Economy, the Southeast Asian haze crisis, climate change negotiations and the Sustainable Development Goals.
As a testament to the importance of the occasion H.E.
President of Indonesia Susilo Bambang Yudhoyono delivered the opening address, with ministers and high ranking Government officials and corporate players from most of SE Asia also making presentations.
One notable absentee from this important event was Malaysia.
The aim of the Forests Asia Summit was to lay the foundations for continued dialogue, transitions toward sustainable investments, and further research to support evidence-based policymaking, all directed toward achieving equitable green growth and more sustainable management of landscapes across Southeast Asia.
Following the event, an outcome statement was compiled from reporting from the sessions at the Forests Asia Summit to provide an overview of messages throughout the conference. In summary, the reporting concludes that:
• To achieve equitable and sustainable green growth in Southeast Asia, all stakeholder groups must strive to overcome communication barriers, engage in continued, participatory dialogue, and act together within a landscape and multilevel governance framework.
• Government, the corporate sector and the finance sector must work together to create enabling conditions to unlock private capital and support investments in sustainable landscapes and smallholders.
• The scientific community, with support from the public and private sectors, must engage in integrated and targeted research aimed at increasing understanding of the dynamics that shape landscapes and communicate findings to government and business in a way that supports evidence-based changes in policy and practice toward a sustainable future and action on the ground. sustainable landscapes and smallholders.
• The scientific community, with support from the public and private sectors, must engage in integrated and targeted research aimed at increasing understanding of the dynamics that shape landscapes and communicate findings to government and business in a way that supports evidence-based changes in policy and practice toward a sustainable future and action on the ground.
The detailed Outcome statement with associated explanation can be found at: http://www.cifor.org/
forestsasia/about/outcome-statement/.
t
igErsinpErilThe annual Global Tiger Day took place worldwide on 29 July 2014. Unfortunately, there is still very little cause to celebrate with tiger populations continueing to decline across its ranges. Poaching and habitat destruction remain the primary causes of decline, along with an increasing loss of prey base. These are some of ther concerns that were highlighted in a comprehensive report co-authored by TRAFFIC into the progress made by the countries implementing measures to protect Asia’s four big cat species. The report states that in the period from 2000-2014 a minimum of 1590 tigers have been seized - an average of two animals per week - with most recorded from India (536) (Fig.1). Despite formulating policies, high level meetings, pledges and plans the number of tigers represented in seizures has increased from less than 100 in 2000 to 150 per year in 2014. While this can also be a result of improved law enforcement, it is a trend that concerns many conservation biologists across the region.
Indonesia reportedly lost 103 tigers in the 2000-2014 period. While this figure is small in comparison to India’s loss of tigers, the report warns that Indonesia must improve its law enforcement if tigers are to survive in Sumatra. In the period 2010-2012 Indonesia contributed with 20% of all tiger parts seizures despite only having less than 10% of the global tiger population.
Figure 1. Number of killed and traded tigers in range countries suggest that the illegal trade florishes as much as ever. From TRAFFIC (2014).
a large theftofenDangereDCaptiveBreDBirDsfrom the Cikananga Wildlife Centre in West Java has seriously ruffled the feathers of the Indonesian conservation community. Burglars succeeded in stealing a total of 156 rare birds from the centre, likely to feed Indonesia’s burgeoning bird trade. Enough is enough, say bird conservationists.
Indonesia’s national emblem is a large mythical bird or bird-like creature, Garuda. The Garuda is a reference to both Indonesia’s Hindu and Buddhist past, as well as to the cultural importance of birds in the country. The speed at which Indonesians are consuming and trading local wild bird species, however, suggests that the only birds left will soon live in cages, or are exotics like the ubiquitous tree sparrow introduced from Europe. Forest areas that used to resonate with bird calls are now silent. The Yellow-vented Bulbul, Pycnonotus goiavier, previously very common in Bogor and Jakarta, is now rare, because its pretty song makes it a popular cage bird.
Once one of the most common birds in Indonesia’s rice fields, the beautiful Java Sparrow, Lonchura oryzivora, was hunted extensively for keeping in cages too, but also shot and poisoned because it fed on rice. This species roamed in flocks of thousands but has almost disappeared from the wild.
Bird collectors and traders are finding ever more devious (and often illegal) ways to obtain birds that are increasingly hard to find in the wild. A recent victim of this conniving approach was the Cikananga Wildlife Centre, near Sukabumi, West Java. After five years of painstaking captive breeding efforts the centre succeeded in breeding over 500 individuals of the Black- winged Starling, Acridotheres melanopterus, known locally as Jalak Putih (Fig.1). Due to its popularity as a cage bird thousands were captured and sold, and today it has become close to extinct in the wild and
listed as “critically endangered” on the IUCN Red-list.
Cikananga does not breed them for markets though, but release them back into the Javan countryside at secret
d
EbatEf
orumBird thieves in Java show that Indonesian wildlife crime knows no boundaries
Anais Tritto1 and Resit Sozer1
1Cikananga Conservation Breeding Centre, West Java, Indonesia
Corresponding authors: Anais Tritto, email: anais.tritto@hotmail.fr
Figure 1. The Javan Black-winged starling, Acridotheres melanopterus, is listed as “Critically endangered” on the IUCN-redlist. For the past five years Cikananga Wildlife Centre, West Java, successfully bred more than 500 individuals of the species to help save it from extinction.
Many pairs have been reintroduced back to its natural habitat on Java. Recently, several hundreds were stolen by professional thieves, aledgely to supply Indonesia’s rampant illegal bird trade. © Roland Wirth
locations for local villagers to enjoy their splendid songs again and benefit from the starlings as biological pest controllers of insects in rice fields. In the past few months 10 attempts of theft have been recorded of which three were successful. The audacious thieves trespassed into Cikananga, avoided a range of security measures and stole 156 birds. The total loss at Cikananga amounted to: one Bali Starling (near extinction in the wild; listed as Critically Endangered on the IUCN red- list), two Black-winged Starlings of the Bali subspecies, three Sumatran Laughing-Thrushes, 149 Black-winged Starlings from Java (listed as Critically Endangered on the IUCN red-list) and one Javan green magpie. This also is a big blow to the centre’s staff who, supported by meagre salaries, have worked for years to breed these birds in an attempt to save them from extinction and to the benefit of all Indonesians.
These were not some local dudes out on a cash run.
Locks were picked with chemicals, they brought wire cutters, knew exactly where to go, and had clearly studied security operations. Rumours suggested that all birds were sold at Jakarta’s bird markets the same morning, a tell-tale sign that the birds had been pre- ordered. Although the thieves hit several times, and with the increased security measures, including extra security guards patrolling the aviaries, they always managed to escape.
Theft was also reported at the release site for Black- winged starlings. On the the 22nd of July, three chicks were stolen from a “secure” nest box after removing the padlock. Whereas the pair rearing the chicks was not caught the theft is a big setback for the Cikanganga’s reintroduction programme. Of an initial 40 released individuals only seven birds remain in the area at present, and therefore each hatching is of critical value to the effort of reestablishing a wild population of the species.
A few days before this theft, one juvenile approx three months old was stolen but local people forced the thief to release it. Consequently, the security at the release site will be improved with the employment of two local security guards.
The efforts in Cikananga to save endangered Indonesian birds from extinction through captive breeding and re-introduction has been funded by generous donations from many philanthropic people in Germany, Switzerland, England, the Czech Republic, Poland and the USA. Naturally, these people are frustrated about the greed of bird thieves, traders and buyers in Indonesia, and the limited success of the
Indonesian authorities in preventing such thefts from occurring and prosecute the culprits. A reward of 15,000,000 Rupiahs has been offered by one of the donors to anyone who can give information that leads to the recovery of at least some of the stolen birds and identification of the thieves. Unfortunately, the Cikananga theft is one of many indications of a growing biodiversity conservation challenge in Indonesia. To date, the Indonesian conservation authorities continue to struggle with mainstreaming conservation related policies and enforcing relevant laws. The occasional raids on bird markets constitute merely inadequate authoritative signals that usually do not have any deterring effect illegal bird poaching and other illegal wildlife trade in the country.
Does anyone care? Many Indonesians will probably never see an undisturbed forest in their life – after all, such forests are now rare on Java where most people live. Would it bother anyone if the last of Indonesia’s hornbills were caught for their beaks to be used in Chinese medicine? Or that no more eagles would soar overhead? Perhaps not now, but one day in the future many will likely bemoan the loss of a whole range of incredible species that makes this country one of the most biodiversity rich in the World. By then, it is a little too late.
What is needed are major efforts by both governmental and non-government organizations to crack down hard on illegal bird trade and poaching, and provide the public with good and informative education and awareness about wild birds. Without such efforts, there is a real risk that many of Indonesia’s wild birds will disappear over the next decade. If that happens, Indonesia’s birds will become mythical creatures just like Garuda and people might ponder about the days when wild birds still roamed the countryside and bless gardens, fields and forests with intricate songs and calls.
the rufforD founDation helD its “Grant Recipient Conference” in Sabang, Sumatra in January 2014. The conference was organised jointly by Fauna & Flora International and the Rufford Foundation with the main objectives to,
• Provide a forum for grant recipients to discuss ideas, problems, issues and create invaluable networking opportunities; and,
• Increase communication and information between Rufford and its grant recipients.
The participants consisted of 16 Nature award winners from Indonesia ranging from first-time grantees to Booster recipients. The first day was allocated for project presentations, which were designed to highlight the logical progression in project implementation and evolution of project design from the first Rufford Small Grant (RSG) to a second RSG to Booster. The second day involved a field trip to an FFI marine project site, including visiting a mangrove forest rehabilitation site with the local customary marine leader.
The RSG is a relatively small contributor to conservation projects. Nevertheless, RSG have resulted in significant and tangible conservation impacts.
Rufford has also enabled early career conservationists to get that all important first start and mobilized sooner than they would have done otherwise. Grant recipients include what is now widely acknowledged conservation officers in Indonesia, many which were participating in the conference, including the co-editor of the Journal of Indonesian Natural History, Wilson Novarino. The grantees were engaged in subjects varying from local policy and legislation support, to protecting Malay tapirs and Sumatran tigers, and using gibbons as a flagship species to support income generating activities for local coffee farmers on Java. It also allowed grantees to pursue and test creative and innovative initiatives and disseminate results widely. Finally, one of the most important results of RSG support is that it has enabled grantees to train up a future generation of conservationists, and often focus on critically important species or ecosystems that would otherwise have received little attention.
The conference also aimed at forging new collaborations in Indonesia. It set out to identify and establish areas for collaboration between grantees and increase further
opportunities for collaboration through their own local networks. After two days of information sharing, discussions and deliberations the participants arrived at the following recommendations:
• A future Rufford conference should include grantees from eastern Indonesia and also those focussing on marine issues.
• Indonesia holds the second highest number of RSG project awards but not a single RSG recipient has advanced to the Continuation stage. This was because they had progressed in their career and felt that they were no longer suitable.
• Rufford should include a sub-section or set of guidelines as part of the RSG proposal format to enable project information and dissemination to a wider audience (e.g. IUCN, national parks).
• Rufford should create an alumni network with regional meetings and opportunities for wider peer learning. Also, an electronic Rufford mail-list would enable a global alumni network to connect.
• Conduct a gap analysis to identify locations (e.g. eastern Indonesia) and issues (e.g. marine biodiversity conservation) that are under- represented in RSG.
• Consider setting up a small grants scheme, whereby a pool of student projects (e.g. £1000 each) could be funded under a single RSG capacity building grant of £6000 that is award to the supervisor. This could increase the number of projects and opportunities for early career conservations who will benefit from the experience of initially managing a smaller grant.
The Editors
The Rufford Foundation: Grant Recipient Conference
i
ntroductionthe long-taileD maCaque, Macaca fascicularis, also known as the cynomolgus macaques, are widely distributed in nature and occupies vast areas of mainland
southeast Asia (Thailand, Cambodia, Vietnam, Laos, Myanmar, Peninsular Malaysia and Singapore) and the Greater and Lesser Sunda Islands (Indonesia, Brunei, and the Malaysian Borneo) and the Philippines (Eudey, 2008; Fooden, 1995). They can be found almost everywhere especially at low elevations preferring the mangrove and swampy forests, river banks, and
Genetic diversity of Macaca fascicularis (Cercopithecidae) from Penang, Malaysia as inferred from mitochondrial control region segment
J.J. Rovie-Ryan1, M. T. Abdullah2,3, F. T. Sitam1, S. G. Tan4, Z. Z. Zainuddin5, M. M. Basir1,6, Z. Z. Abidin1,6, C. Keliang1, A. Denel1, E. Joeneh1 and F. M. Ali1
1Outbreak Response Team, Wildlife Genetic Resource Bank Laboratory, Ex-Situ Conservation Division, Department of Wildlife and National Parks Peninsular Malaysia, Kuala Lumpur, Malaysia.
2Kenyir Ecosystem Research Centre, Universiti Malaysia Terengganu, 21030 Kuala Terengganu, Terengganu, Malaysia..
3Department of Zoology, Faculty of Resource Science and Technology, Universiti Malaysia Sarawak, Malaysia.
4Dept. of Cell and Molecular Biology, Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia, Malaysia.
5Borneo Rhino Alliance, Sabah, Malaysia.
6Deputy Director General I and II Office, DWNP, KM 10 Cheras Road, 56100 Kuala Lumpur.
Corresponding author: J.J. Rovie-Ryan, email: jeffrine@wildlife.gov.my
Received 26th February 2014; Revision accepted 2nd May, 2014 Abstrak
Keanekaragaman genetic kera ekor panjang (Macaca fascicularis) dari Penang, termasuk Pulau Jerejak dan daratan utama Negeri Penang Malaysia telah dianalisis dengan menggunakan 1.042 bp control region (CR) segment DNA mitochondria (mtDNA). Dua puluh haplotipe menunjukkan adanya satu haplotipe tunggal yang sama antara daratan utama dan pulau, hal ini menandakan bahwa ini merupakan genetic yang diterima dari daratan. Dibandingkan dengan penelitian sebelumnya yang dilakukan berdasarkan CR, semua haplotipe dari Penang merupakan gambaran baru dan tidak ada yang sama dengan populasi M. fascicularis lainnya di wilayah ini. Adanya satu deletion mutasi unik pada contoh dari penang (Kelompok I dan II) bisa menjadi indicator yang baik untuk upaya konservasi keunikan genetic dan mungkin bisa dikelola sebagai satu unit pengelolaan. Sebuah ringkasan pohon filogenetik (NJ, MP, ML dan Bayesian) mendukung pengelompokan monofiletik dari M. fascicularis seperti digambarkan pada penelitian penelitian sebelumnya. Pemisahan topologi dari haplotype Penang kedalam tiga kelompok utama secara umum berhubungan dengan distribusi geografis mereka. Penelitian ini juga mencatat bahawa haplotipe Penang memiliki garis keturunan dari wilayah continental yang telah terpisah dari garis keturunan insular sekitar 1.04 juta tahun yang lalu. Penelitian ini juga menunjukkan bahwa CR dari mtDNA sangat baik digunakan untuk mengkuantifikasi keanekaragaman genetic intraspesifik pada M. fascicularis.
Abtract
The genetic diversity of the long-tailed macaques (Macaca fascicularis) from Penang, Malaysia, including Jerejak Island and the mainland area of the state of Penang, Seberang Perai were examined using 1,042 bp control region (CR) segment of the mitochondrial DNA (mtDNA). Twenty haplotypes were described with a single haplotype sharing between the mainland and the island which suggests that it is a remnant of the genetic makeup from the mainland. Compared to previous studies based on the CR, all the Penang haplotypes are newly described with none shared with the other regional populations of M. fascicularis.
A single deletion mutation unique to the Penang samples (Groups I and II) could be a good indicator for the conservation of the genetic uniqueness and possibly should be managed as a management unit (MU). A summarised phylogenetic tree (NJ, MP, ML and Bayesian) supports the monophyletic clustering of the M. fascicularis as described in previous studies. The topology separates the Penang haplotypes into three major groups, which generally corresponds to their geographical distribution. We also noted that the Penang haplotypes are of the continental lineage which separated from the insular lineage at around 1.04 mya. Finally, we showed that the CR of the mtDNA is powerful and suitable for the quantification of intraspecific diversity in M. fascicularis.
Keywords: Macaca fascicularis, Penang Island, phylogenetics, hypervariable segments I and II
seashores (Eudey, 2008). In Peninsular Malaysia they are very common and populate areas in sympatry with the human settlements [Department of Wildlife and National Parks (DWNP), 2006]. In Penang particularly, M. fascicularis is distributed throughout the islands (Penang Island and smaller adjacent islands including Jerejak Island) and the mainland portion of Seberang Perai (DWNP, 2006; Karimullah & Shahrul, 2011).
Historically, Peninsular Malaysia was part of the Sundaland which was heavily influenced by events during the Quaternary Period (Pliocene and Pleistocene) (Voris, 2000). During the Pleistocene, periods of intermittent glacial caused the fluctuation of sea levels and at its maximum fell by 120 m below present-day levels and landmasses (Malay Peninsula, Borneo, Sumatra, Java, Bali, Palawan, the Mentawai Islands, and the smaller intervening islands), which are currently separated were joined and formed Sundaland (Bird et al., 2005; Harrison et al., 2006; Sathimurthy
& Voris, 2006; Voris, 2000). Consequently, Penang Island which is currently situated about four km off the coast of Seberang Perai and separated by the narrow Penang Straits at a maximum depth of 20 m (Asadpour et al., 2011) would experience repeated connection to the mainland during Pleistocene, thus limiting faunal interchanges.
In Malaysia, very few genetic studies had been conducted on M. fascicularis. Most studies were conducted to investigate their conflict with humans (DWNP, 2006), association with zoonotic diseases (Cox-Singh & Singh, 2008; Thayaparan et al., 2013, 2014), distribution (DWNP, 2006; DWNP, unpublished data; Karimullah & Shahrul, 2011), and behaviour (Ling, 2006; Ping, 2003; Shuan, 2006). In other regional populations of M. fascicularis (Indochinese, Indonesian, Philippines, Singapore, and Mauritius) however, numerous genetic studies have been conducted using mitochondrial DNA (mtDNA) markers (Blancher et al., 2008; Harihara et al., 1988; Kawamoto et al., 2008; Lawler et al., 1995; Perwitasari-Farajallah et al., 1999; Perwitasari-Farajallah et al., 2001; Schillaci et al., 2011; Shiina et al., 2010; Smith et al., 2007; Tosi &
Coke, 2007; Tosi et al., 2002). In this study, we employ the mtDNA control region (CR) as part of a major research initiative by the DWNP to comprehensively examine the population genetics, phylogeography, and the diseases associated with M. fascicularis in Malaysia (both from Peninsular Malaysia and from Sarawak and Sabah states on Borneo Island). In summary, this pilot study is designed to achieve these objectives;
(1) to examine the genetic diversity of the Penang M.
fascicularis and (2) to investigate the efficiency of the mtDNA control region in assessing the genetic diversity of M. fascicularis in Malaysia.
m
Ethods Sample CollectionSampling was conducted by the Outbreak Response Team (ORT) of the DWNP on conflict long-tailed macaques as part of a Wildlife Disease Surveillance Programme (WDSP) launched by DWNP in 2011 to monitor the emergence of zoonotic diseases in wildlife species. Figure 1 shows the sampling sites (A-L) while Table 1 provides the details of each of the samples used in this study. All samples were kept at the Wildlife Genetic Resource Bank (WGRB) Laboratory, DWNP.
DNA Extraction, PCR Amplification and Sequencing Total genomic DNA was extracted from 46 samples either from blood (preserved in lysis buffer) or from liver samples (see Table 1) using the QIAamp DNeasy Blood and Tissue Kit (QIAGEN Ag., Germany) protocol for blood and tissue samples as provided by the manufacturer.
A pair of oligonucleotides; WGRB/MFCR/F15978 (5’–
ACCACCAACACCCAAAGCTGGC–3’) and WGRB/
MFCR/R580 (5’-TCAGTGTCTTGCTTTGGGTGGGT-3’), were designed using the program Primer3 (Rozen & Skaletsky, 2000) as a plug-in in the Geneious v5.6 (Drummond et al., 2012) to cover the complete length of the CR segment.
Amplifications were carried out in an Arktik Thermal Cycler (Thermo Scientific, USA), using a 15 µl reaction volume consisting of 0.5 µl of DNA template (~15–20 ng), 0.2 µl (0.13 µM) of each primer and 14.5 µl of GoTaq® Colorless Master Mix (Promega, USA).
Amplification was done using the following PCR profile: a preliminary denaturation at 98oC for 2 min followed by 30 cycles of 95oC for 30 sec, 69oC for 30 sec and 72oC for 40 sec. This was followed by a final extension period of 72oC for 3 min before the samples were cooled to 4oC. Cycle sequencing on both primers were done on an ABI PRISM®377 DNA Sequencer by a sequencing service provider (1st Base Laboratories Sdn. Bhd., Malaysia).
Sequence Analysis
Multiple alignments of the sequences were done and ambiguous flanking regions were identified and removed
Genetic diversity of M. fascicularis
