The apolipoprotein A-IV-360His polymorphism determines the
dietary fat clearance in normal subjects
Maria A. Ostos
a, Jose Lopez-Miranda
a,b, Carmen Marin
a, Pedro Castro
a,
Purificacion Gomez
a, Elier Paz
a, Jose´ A. Jime´nez Perepe´rez
a, Jose M. Ordovas
c,
Francisco Perez-Jimenez
a,*
aUnidad de Lı´pidos y Arteriosclerosis,Hospital Uni6ersitario‘Reina Sofı´a’,A6da Mene´ndez Pidal,s/n.14004Co´rdoba,Spain bSer6icio de Medicina Interna,Hospital Alto Guadalqui6ir,Andujar,Spain
cLipid Metabolism Laboratory,USDA Human Nutrition Research Center on Aging at Tufts Uni6ersity,Boston,MA,USA
Received 2 August 1999; received in revised form 13 December 1999; accepted 14 January 2000
Abstract
Apolipoprotein IV (apo A-IV) has been related to fat absorption and to the activation of some of the enzymes involved in lipid metabolism. Several polymorphic sites within the gene locus for apo A-IV have been detected. Previous studies have shown that the A-IV-2 isoform produces a different plasma lipid response after the consumption of diets with different fat and cholesterol content. The present study was designed to evaluate whether the apo A-IV 360His polymorphism could explain, at least in part, the interindividual variability observed during postprandial lipemia. Fifty-one healthy male volunteers (42 homozygous for the apo A-IV 360Gln allele (Gln/Gln) and nine carriers of the A-IV-360His allele), homozygous for the apo E3 allele, were subjected to a vitamin A-fat load test consisting of 1 g of fat/kg body weight and 60 000 IU of vitamin A. Blood was drawn at time 0 and every hour for 11 h. Plasma cholesterol (C), triacylglycerol (TG), and C, TG, apo B-100, apo B-48, apo A-IV and retinyl palmitate (RP) were determined in lipoprotein fractions. Data of postprandial lipemia revealed that subjects with the apo A-IV 360His allele had significantly greater postprandial levels in small triacylglycerol rich lipoproteins (TRL)-C (PB0.02), small TRL-TG (PB0.01) and large TRL-TG (PB0.05) than apo A-IV 360Gln/Gln subjects. In conclusion, the modifications observed in postprandial lipoprotein metabolism in subjects with the A-IV 360His allele could be involved in the different low density lipoprotein (LDL)-C responses observed in these subjects following a diet rich in cholesterol and saturated fats. © 2000 Elsevier Science Ireland Ltd. All rights reserved.
Keywords:Postprandial lipemia; Apolipoprotein A-IV; Apo IV-360His polymorphism; Triacylglycerol; Retinyl palmitate; Cholesterol
www.elsevier.com/locate/atherosclerosis
1. Introduction
Apolipoprotein (apo) A-IV is a plasma glycoprotein with a molecular mass of 46 000 Da consisting of 376 amino acid residues. It is synthesized primarily in the enterocytes of the small intestine during fat absorption. Several roles have been assigned to this apolipoprotein. It has been shown to participate in the absorption of dietary fat [1,2], in triacylglycerol transport [3] and in reverse cholesterol transport [4]. Moreover, apo A-IV seems to modulate the activity of lecithin cholesterol
acyl transferase (LCAT) [5] and of cholesteryl ester transfer protein (CETP) [6]. Apo A-IV is secreted into mesenteric lymph in the chylomicrons [7,8], where it is exchanged for the apo C-II from high density lipo-protein (HDL) [9]. Apo C-II is a cofactor required for lipoprotein lipase (LPL) activity [10,11], which is neces-sary for the hydrolysis of triacylglycerol contained in chylomicrons. Thus, apo A-IV may regulate the clear-ance of triacylglycerol-rich lipoproteins of intestinal origin.
The gene coding for apo A-IV is located in the long arm of chromosome 11 [12,13]. Several polymorphisms at this gene locus have been described and different associations with plasma lipid levels have been re-ported. One of the most frequent mutations is a G to T * Corresponding author. Tel.: +34-57-217239; fax: +
34-57-218229.
E-mail address:mdipejif@cod.servicom.es (F. Perez-Jimenez).
substitution that changes the glutamine (CAG) residue at position 360 of the mature apo A-IV to histidine (CAT). The frequency of this allele has been studied in several populations and it ranges from 0.05 to 0.117 [14,15]. Several authors have reported an association between this mutation and changes in fast-ing plasma lipid levels, but these results are controver-sial. These variations are dependent on the sex [16], insulin levels and degree of obesity of the subjects [17]. Individuals with the apo A-IV 360His mutation have also been shown to present a different response in dietary intervention studies with a de-creased response of low density lipoprotein (LDL)-C to cholesterol-enriched diets [18] and to diets with a high fat and cholesterol content [19]. Moreover, in a recent study it was demonstrated how the re-placement of saturated fats by carbohydrates in the diet produced a greater decrease in HDL-C and apo A-I plasma levels in carriers of the apo A-IV 360His muta-tion [20]. In addimuta-tion, it has been shown that this polymorphism interacts with body mass index (BMI) to determine the postprandial lipemia in the EARS study [21].
Since apo A-IV can modulate LPL and postprandial lipid metabolism, it was studied whether the apo A-IV 360His mutation could bring about changes in the postprandial metabolism and if these changes could explain the different lipid responses to dietary fat and cholesterol reported in the cited studies.
2. Materials and methods
2.1. Human subjects
Fifty-one healthy male subjects, 42 homozygous for the most common allele, the apo A-IV 360Gln allele (Gln/Gln), and nine carriers of the apo A-IV 360His allele (His/ +) (two homozygotes and seven heterozygotes) were studied. All subjects were students at the University of Cordoba and all re-sponded to an advertisement. They ranged in age from 18 to 49 years. None of them had liver, renal or thyroid disease or diabetes. All subjects selected had the apo E3/3 genotype to avoid allele effects of this gene locus on postprandial lipemia [22]. They were not taking medication or vitamins known to affect plasma lipids. The fasting plasma lipid, lipo-protein, apolipoprotein levels, age and BMI according to apo A-IV alleles are shown in Table 1. All studies were carried out in the Research Unit of the Reina Sofia University Hospital. The experimental protocol was approved by the Human Investigation Review Committee at the Reina Sofia University Hospital.
2.2. Vitamin A fat-loading test
After a 12 h fast, all subjects were given a fatty meal enriched with 60 000 units of vitamin A per m2of body
surface area. The fatty meal consisted of two cups of whole milk, eggs, bread, bacon, cream, walnuts and butter and it was consumed in 20 min. This meal provided 1 g of fat and 7 mg of cholesterol per kg body weight, and it contained 60% of calories as fat, 15% as protein and 25% as carbohydrates. After the meal, subjects were not allowed to consume any calorie-con-taining food for 11 h. Blood samples were drawn before the meal, every hour until the 6th hour and every 2nd hour and 30 min until the 11th hour.
2.3. Lipoprotein separations
Blood was collected in tubes containing EDTA to give a final concentration of 0.1% EDTA. Plasma was separated from red cells by centrifugation at 1500×g for 15 min at 4°C. The chylomicron fraction of triacyl-glycerol rich lipoproteins (large-TRL) was isolated from 4 ml of plasma overlayered with 0.15 M NaCl, 1 mM EDTA (pH 7.4, d 1.006 g/ml) by a single ultracentrifu-gal spin (28 000×g, 30 min, 4°C) in a 50 type rotor (Beckman Instruments, Fullerton, CA). Chylomicrons, contained in the top layer, were removed by aspiration after cutting the tubes and the infranatant was cen-trifuged at a density of 1.019 g/ml for 24 h at 115 000×g in the same rotor. The non-chylomicron fraction of TRL (also referred to as small-TRL) was removed from the top of the tube. All operations were done in subdued light. Large and small TRL fractions were stored at −70°C until assayed for retinyl palmi-tate (RP).
Table 1
Characteristics of the subjects at baseline according to apolipoprotein (apo) A-IV 360Gln/His polymorphism
360Gln/Gln (42) 360His/+(9) Pvalue*
Triacylglycerol 0.89790.36 1.1490.54 0.106 (mmol/l)
2.4. Lipid analysis
Cholesterol and triacylglycerol in plasma and lipo-protein fractions were assayed by enzymatic procedures [23,24]. Apo A-I and apo B were determined by tur-bidimetry [25]. HDL cholesterol was measured by ana-lyzing the supernatant obtained following precipitation of a plasma aliquot with dextran sulphate-Mg2+, as described by Warnick et al. [26]. LDL cholesterol was obtained as the difference between the HDL cholesterol and the cholesterol from the bottom part of the tube after ultracentrifugation at 1.019 g/ml.
2.5. RP assay
The RP content of large and small TRL fractions was determined using a method previously described [27]. Peaks of RP and retinyl acetate were identified by comparing its retention time with a purified standard (Sigma, St Louis, MO), and the RP concentration in each sample was expressed in terms of the ratio of the area under the RP peak to the area under the RA peak [28]. Here too, all operations were performed in sub-dued light.
2.6. Determination of apo B-48 and apo B-100
Apo B-48 and apo B-100 were determined by SDS-polyacrylamide gel electrophoresis (PAGE) as described by Karpe et al. [29]. Electrophoretic separation was performed using a 3 – 20% gradient polyacrylamide gel with a vertical Hoefer Mighty Small II electrophore-sis apparatus. Gels were scanned with a videodensito-meter scanner (TDI, Madrid, Spain) connected to a personal computer for integration of the signals. Back-ground intensity was calculated after scanning an empty lane. The coefficient of variation for the SDS-PAGE was 7.3% for apo B-48 and 5.1% for apo B-100.
2.7. DNA amplification and genotyping
DNA was extracted from 10 ml of EDTA-containing blood. Amplification of a region of the apo A-IV gene was done by polymerase chain reaction (PCR) with 250 ng of genomic DNA and 0.2 mmol of each oligonucle-otide primer (P1:5% -GCCCTGGTGCAGCAGATG-GACAGCTCAGG-3% and P2:5% -CATCTGCACCTG-CTCCTGCTGCTGCTCCAG-3%) in 50ml, according to the method previously described [30].
Amplification of a region of 266-bp of the apo E gene was done by PCR with 250 ng of genomic DNA and 0.2 mmol of each oligonucleotide primer (E1, 5%-GACACTGACCCCGGTGGCGGAG-3%, and E2, 5%- TCGCGGGCCCCGGCCTGGTACACTGCCA - 3%) and 10% dimethyl sulfoxide in 50 ml according to the method previously described [20].
2.8. Apo A-IV measurement
Apo A-IV was measured in total plasma and in both large and small TRL, in postprandial samples obtained at 0, 1, 3, 5, 8:30 and 11 h using an ELISA assay. Briefly, polystyrene microtiter plates (Nunc Im-munoplate I) were coated with affinity-purified poly-clonal apo A-IV antibody (10mg/ml) in PBS 0.1 M (pH 7.4), 100 ml/well. The plates were covered with acetate plate sealers (ICN) and incubated overnight at room temperature. The next day the solution containing the unbound Ab was removed and the remaining binding sites in the plate were blocked using 0.5% bovine serum albumin (RIA grade BSA, Sigma) and 0.1% NaN3 in
PBS (1 h incubation). Plates were then washed 3 times with PBS containing 0.5% Tween-20 (PBST).
Control and plasma samples were diluted (1:5000) in PBS-BSA. Large and small TRL samples were diluted, 1/500 and 1/100, respectively. Two-fold serial dilutions were performed for the plasma standard (standard curve 333.3 – 10.4 ng/ml). Controls were prepared in the laboratory by pooling plasma from different individu-als. Multiple aliquots were stored at −70°C. Controls were calibrated against a primary standard determined by amino acid analysis.
Aliquots (100 ml) of standards, controls, and plasma samples were added to designated wells in the microt-iter plate. Aliquots were diluted and thoroughly mixed immediately before addition. Controls and samples were run in duplicate wells in each plate. After 2 h incubation at 37°C, the contents of the plate were discarded and the plate was washed 3 times with PBST. The goat-immunopurified anti apo A-IV Ab conju-gated to peroxidase was diluted in PBS-BSA at 1:5000 and 100ml was added to each well. The plate was sealed and incubated at 37°C for 2 h. Following this incuba-tion, the plate was washed 5 times with PBST. The substrate used for the enzymatic color reaction is ortho-phenylene diamine (OPD) and H2O2 in 0.1 M citrate
buffer. This solution was added to each well (100 ml) and incubated for 30 min at room temperature, then it was read at 410 nm on a microtiter plate reader (Dynat-ech MR 600).
2.9. Statistical analyses
and the peak time, which was the average of the time to peak concentration and the time to the second highest concentration. Data were tested for statistical signifi-cance between genotypes by analysis of variance (ANOVA) and the Kruskal – Wallis test, and between genotypes and time by ANOVA for repeated measures including the BMI and age as co-variants in all analy-ses. A probability value less than 0.05 was considered significant. The maximum peak of triacylglycerol was used in TRL and AUC of triacylglycerol in small-TRL as dependent variables and did stepwise multiple regression to identify other concomitant variables. The independent variables included age, BMI, apo A-IV genotype, basal cholesterol, HDL-C and triacylglycerol values. Discrete variables were divided into two classes for analysis. All data presented in the text and tables are expressed as mean9S.D. adjusted by BMI and age as co-variant.
3. Results
The baseline characteristics of the study subjects are shown in Table 1. No differences were observed in any of the lipid parameters studied or in the percentage of smokers between the A-IV 360His/ + (H/ +, n=9) and A-IV 360Gln/Gln (G/G, n=42) subjects. The group of subjects with the apo A-IV 360His mutation had a slightly greater mean age and also a lower BMI compared with homozygotes for the apo A-IV 360Gln allele. In order to adjust by the effect of these variables BMI and age have been included as covariant in all statistical analyses and all data are presented as ad-justed values by these variables.
Plasma cholesterol and triacylglycerol responses fol-lowing the fat load test are shown in Fig. 1. There was no significant difference in either of these two parame-ters between the two subject groups as was shown by the ANOVA in which p1 indicates the effect of the genotype, p2 the effect of time and p3 the effect of the interaction genotype-time. According to the effect of time, a significant change was observed in triacylglyc-erol indicated by an increase in this parameter in the curves of both subject groups over the postprandial period. Carriers of the apo A-IV 360His allele presented higher plasma triacylglycerol levels at the 11th hour in comparison with those homozygotes for the apo A-IV 360Gln allele.
Triacylglycerol concentrations during the postpran-dial period for large and small-TRL fractions are shown in Fig. 2. In apo A-IV 360Gln/Gln ho-mozygotes, triacylglycerol levels in large-TRL remained significantly higher than baseline levels for the first 8 h and returned to baseline at the 11th hour. However, carriers of the apo A-IV 360His mutation maintained triacylglycerol levels in the large-TRL above baseline
Fig. 1. Line plots of postprandial plasma cholesterol (A) and triacyl-glycerol (B), response in apolipoprotein (apo) A-IV 360 Gln/Gln subjects (solid line,) and apo A-IV 360His/ +subjects (dotted line, ) (His/ +indicates His/His or His/Gln). For each group, the levels at each time point were averaged, adjusted by body mass index (BMI) and age as co-variant and expressed as mean9S.E.M. P1, genotype effect; P2, time effect; P3, genotype by time interaction. MANOVA for repeated measures. * Tukeys test for normally distributed vari-ables or Kruskal – Wallis test for nonparametric varivari-ables.
360Gln allele had already returned to their baseline levels. The AUC of the small-TRL triacylglycerol (Table 2) and the maximum peak of triacylglycerol in the small-TRL (Table 3) were significantly greater in apo A-IV 360His subjects (0.7790.46 mmol/l) com-pared with homozygotes for the apo A-IV 360Gln allele (0.5890.24 mmol/l) but these differences disappeared when one adjusted by the baseline values (0.2590.18 vs. 0.2590.16; PB0.965).
The distribution of plasma cholesterol within the different TRL fractions was examined. In apo A-IV 360Gln/Gln subjects cholesterol in large-TRL was sig-nificantly higher than baseline values during the first 8 h and returned to baseline by the 11th hour. However, in apo A-IV 360His/ + subjects, it was only signifi-cantly higher between hours 2 and 8 (Fig. 3A). No significant differences were observed in the levels of cholesterol transported in the large-TRL between both
Table 2
Area under curve (AUC) for the different lipid parameters examined according to apolipoprotein (apo) A-IV 360Gln/His polymorphism adjusted by body mass index (BMI) and age as co-varianta
Pvalue* 360Gln/Gln (42) 360His/+(9)
26019423
Total cholesterol 26549612 0.835 Triacylglycerol 10969445 13079587 0.242 0.960 LDL cholesterol 15099440 15009559
HDL cholesterol 7909184 7739249 0.832 0.862 Apo B 434.49125.7 426.09181.3
632.3991.5
Apo A-I 649.19136.9 0.684
4289212
Large TRL-TG 5139352 0.381
0.040 Small TRL-TG 2829125 3849237
2.3092.39
Large TRL-B48 41.2933.2
14.2914.4
36.0937.3 0.120
Small TRL-B48
70.9972.8
Large TRL-B100 55.7931.5 0.668 Small TRL-B100 266891913 19099985 0.410 0.480 Large TRL-A-IV 13.995.1 12.992.5
2.091.6 1.791.9 0.560 Small TRL-A-IV
aTG, triacylglycerol; RP, retinyl palmitate; TRL, triacylglycerol
rich lipoprotein; 360His/+indicates apo A-IV 360His/Gln or His/His genotypes. Cholesterol and triacylglycerol are in mmol/l min, apo B, apo A-I, apo A-IV and RP are in g/l min, B-48 and B-100 in arbitrary units/l min.
* One-way analysis of variance (ANOVA).
Fig. 2. Line plots of postprandial triacylglycerol response in large triacylglycerol rich lipoproteins (TRL) (A) and small TRL (B), re-sponse in apolipoprotein (apo) A-IV 360 Gln/Gln subjects (solid line,
) and apo A-IV 360His/ + subjects (dotted line, ) (His/ +
indicates His/His or His/Gln). For each group, the levels at each time point were averaged, adjusted by body mass index (BMI) and age as co-variant and expressed as mean9S.E.M. P1, genotype effect; P2, time effect; P3, genotype by time interaction. MANOVA for repeated measures. * Tukeys test for normally distributed variables or Kruskal – Wallis test for nonparametric variables.
groups of subjects. Carriers of the apo A-IV 360His mutation presented a greater postprandial cholesterol levels in the small-TRL than apo A-IV 360Gln/Gln subjects (genotype effect, PB0.011;6 ANOVA) (Fig. 3B). Moreover, when the differences between both groups were studied at each time point in the postpran-dial lipemia study, subjects with the apo A-IV 360His mutation were found to present higher cholesterol levels
Table 3
Maximal postprandial triacylglycerol and RP increase and peak time according to apo A-IV 360 His polymorphism adjusted by BMI and age as co-varianta
360 360His/+ Pvalue* (9)
Normalized 0.2590.16 0.2590.18 0.965 peak
aTG, triacylglycerol; TRL, triglyceride rich lipoprotein; 360His/+
Fig. 3. Line plots of postprandial cholesterol response in large triacylglycerol rich lipoproteins (TRL) (A) and small TRL (B), re-sponse in apolipoprotein (apo) A-IV 360 Gln/Gln subjects (solid line,
) and apo A-IV 360His/ + subjects (dotted line, ) (His/ +
indicates His/His or His/Gln). For each group, the levels at each time point were averaged, adjusted by body mass index (BMI) and age as co-variant and expressed as mean9S.E.M. P1, genotype effect; P2, time effect; P3, genotype by time interaction. MANOVA for repeated measures. * Tukeys test for normally distributed variables or Kruskal – Wallis test for nonparametric variables.
and the apo A-IV 360His polymorphism was also a significant predictor of the variability in the maximum peak of small-TRL-TG (P=0.05), accounting for 4.4% of the variance.
4. Discussion
The results demonstrate that carriers of the 360His mutation in the apo IV gene present greater basal and postprandial TRL levels than 360Gln/Gln homo-zygotes.
Interindividual variability in postprandial lipid trans-port after a standard meal exceeds that observed in the fasting state and it is influenced by several environmen-tal and genetic factors affecting the synthesis and catabolism of TRL originating in the liver and intes-tine. Thus, decreased postprandial lipemia has been shown in apo A-I Milano carriers [31]. Other common variants at the apo B [32] and apo E gene loci have also been shown to affect the absorption or clearance of dietary fats [22,33,34], in E2 individuals having delayed clearance and in E4 individuals having faster clearance as shown by RP concentrations in plasma and the non-chylomicron fraction associated with a higher LDL-C response to changes in dietary fat. In order to remove the confounding effect of the variability associ-ated with the apo E gene locus, the study was carried out in subjects homozygous for the apo E3 allele. Moreover, there were no differences in other factors which could influence postprandial lipemic response such as baseline plasma triacylglycerol levels and alco-hol and tobacco consumption between carriers of the apo A-IV 360His allele and homozygotes for the apo A-IV 360Gln allele.
Apo A-IV is a major constituent of triacylglycerol rich particles of intestinal origin. It is involved in the absorption of exogenous fats [35,36] and its synthesis is stimulated by the absorption of dietary triacylglycerol [37,38]. A large number of studies have associated the apo A-IV 360His mutation with a different fasting plasma lipid level although there are no conclusive results to confirm this [39 – 41,44]. No significant differ-ences in the lipid parameters measured in a fasting state were found. The disparity of these results could be due to differences in the study population or the techniques used to identify the mutation, since some studies that used immunoelectrophoresis could have included other mutations of the apo A-IV gene with the same isoelec-tric point as the apo A-IV 360His mutation. However, this could also be due to the fact that the phenotypic expression of this mutation requires the simultaneous presence of other factors, as demonstrated by studies carried out by Campos et al. in which differences associated with this mutation were only found in sub-jects living in urban environments who consumed sig-in the small-TRL at 5, 6 and 11 h than apo A-IV
360Gln/Gln subjects.
There were no significant differences in LDL-C, apo B, HDL-C and apo A-I postprandial response as it was demonstrated by ANOVA between the two groups of subjects. (Table 2). In addition, no significant genotype effect was observed by ANOVA in either large or small-TRL-RP postprandial responses (Table 2).
There were no significant differences in the apo B-48, apo B-100 and apo A-IV postprandial responses in the large and small-TRL between both groups of subjects (Table 2), indicating that there was no difference over the lipemic period in the number of particles of intesti-nal or hepatic origin in both groups of subjects.
nificantly higher levels of saturated fat and tobacco [46]. On the other hand, this mutation has a different effect in men and women [16] and it is also related to insulin levels and obesity, with carriers of the apo A-IV 360His mutation presenting a higher incidence of my-ocardial infarction when the mutation is associated with diabetes and an even greater risk if the subject is also obese [42]. Therefore, all the studies seem to indi-cate that this mutation mainly acts by interacting with other factors to determine a specific lipoprotein pheno-type. The interaction of this polymorphism with BMI has recently been demonstrated, in order to determine the postprandial lipemia in the EARS study [21].
The apo A-IV 360His mutation has also been associ-ated with a different lipid dietary response. Carriers of the apo A-IV 360His mutation present a decreased LDL-C response to dietary cholesterol [18,19] and a different HDL-C response to dietary fat content [20]. It was, therefore, decided to study whether this effect was associated to changes in the postprandial lipoprotein metabolism, as it has already been observed in some mutations of other genes.
Carriers of the apo A-IV 360His mutation present an increased postprandial triacylglycerol levels of small and large-TRL. Subjects with the apo A-IV 360His mutation also experience an increase in cholesterol levels transported by the small-TRL compared with apo A-IV 360Gln/Gln homozygotes. However, there are no significant differences in the apo B-48 and B-100 levels in both, large and small TRL particles, indicating that there is not a significantly greater number of particles of either intestinal or hepatic origin. This increase in postprandial triacylglycerol and cholesterol levels can only be explained by a delayed hydrolysis in the intravascular catabolism of the triacylglycerol trans-ported in the triacylglycerol rich particles. It has been demonstrated that this mutation does not produce a
difference in the cholesterol absorption [43], and it has been shown that there was no difference in the number of particles of intestinal origin, reflected by the apo B-48 levels. Moreover, as was previously mentioned, the effect of the mutation is most clearly observed in the last hour of the lipemia study and in the basal values, indicating an accumulation of triacylglycerol and cholesterol in the particles, probably due to their defective hydrolysis. It can, therefore, be deduced that, in carriers of the apo A-IV 360His mutation, less dietary cholesterol would reach the liver which would result in a reduction of intrahepatic cholesterol. In turn, this fact would result in an upregulation of the hepatic LDL receptors which would explain the lower increase of LDL-C that these subjects present after a choles-terol-enriched diet [18,19], similar to the one described in carriers of the apo E2 allele.
The fact that A-IV affects hydrolysis and uptake of TRL could be due to the effect of this apolipoprotein on the exchange of apo Cs between the HDL and triacylglycerol rich particles. No difference was ob-served in the apo A-IV postprandial levels between the two genotypes studied, measured in total plasma and in each TRL fraction, in accordance with the study by Ehnholm [44], although one study reports an associa-tion between the apo A-IV 360His mutaassocia-tion and higher baseline plasma levels of this apolipoprotein [16]. The apo A-IV 360His molecule is known to have a greater lipoaffinity because it contains more a-helices in its structure [45], which could affect the capacity to ex-change apolipoproteins between HDL and TRL and hence modulate its intravascular catabolism. It can be speculated that subjects with the apo A-IV 360His mutation have a lower transference of apo CII from the HDL to the TRL, which produces a decreased activa-tion of LPL that determines the higher postprandial TRL-TG levels observed in the study. In addition, it is
Table 4
Multiple stepwise regression analysisa
Independent variables Independent variables in the model MultipleR R2change Pvalue
Dependent variables
A-IV 360His/+ TG basal
Small TRL TG AUC 0.610 0.373 0.000004
Age Edad 0.712 0.134 0.0009
A-IV 360His/+
BMI 0.746 0.049 0.030
0.159 HDL basal
TG 0.759 0.019
TC HDL-C
A-IV 360His/+ TG basal
Maximum peak small TRL-TG 0.612 0.375 0.000004
Age Edad 0.681 0.088 0.009
BMI A-IV 360His/+ 0.712 0.044 0.05
0.139 0.025
0.729 HDL basal
TG TC HDL-C
aAUC, area under the curve; TG, triacylglycerol; TRL, triacylglycerol rich lipoprotein. 360His/+indicates apo A-IV 360His/Gln
also possible that if there is an increased exchange of apo CI in subjects with the apo A-IV 360His mutation, this would explain the decreased clearance of remnants by the liver, by inhibition of its uptake. This hypothesis would also explain the greater decrease in HDL-C after a carbohydrate-enriched diet in subjects with the muta-tion [20], since there would be a greater postprandial decrease of apo CI in the HDL which would result in a decreased activation of the LCAT and a decreased inhibition of CETP in these particles, both functions carried out by the apo CI. In conclusion, subjects with the apo A-IV 360His allele present a delayed hydrolysis and catabolism of triacylglycerol rich particles which can bring about a decrease in the amount of dietary cholesterol that reaches the liver. This fact could ex-plain the lower increase in LDL-C levels after the consumption of cholesterol-enriched diets, as described previously [18,19].
Acknowledgements
This work was supported by research grants from the CICYT (SAF96/0060, to FPJ), the Spanish Ministry of Health (FIS 93/0746, 94/1547, 95/1144, 96/1540, 98/ 1531, 99/0949 to JLM), Fundacio´n Cultural ‘Hospital Reina Sofı´a-Cajasur’ (to CM and PG), Consejerı´a de Salud, Servicio Andaluz de Salud (PAI 96/54, 97/58, 98/126, 99/165), Consejerı´a de Agricultura y Pesca de la Junta de Andalucı´a (to FPJ), Agencia Espan˜ola de Cooperacio´n Internacional (to EP) and The National Institute of Health, Bethesda, MD (HL 54776, to JMO). We appreciate the cooperation of Beatriz Pe´rez in the translation of the manuscript.
References
[1] Ordovas JM, Cassidy DK, Civeira F, Bisgaier CL, Schaefer EJ. Familial apolipoprotein A-I, C-III, and A-IV deficiency and premature atherosclerosis due to deletion of a gene complex on chromosome 11. J Biol Chem 1989;264:16339 – 42.
[2] Weinberg RB, Dantzker C, Patton CS. Sensitivity of serum apolipoprotein A-IV levels to changes in dietary fat content. Gastroenterology 1990;98:17 – 24.
[3] Otha T, Fidge NH, Nestel PJ. Studies on the in vivo and in vitro distribution of apolipoprotein A-IV in human plasma and lymph. J Clin Invest 1985;76:1252 – 60.
[4] Duvenger N, Tremp G, Caillaud JM, et al. Protection against atherogenesis in mice mediated by human apolipoprotein A-IV. Science 1996;273:966 – 8.
[5] Steinmetz A, Utermann G. Activation of lecithin:cholesterol acyltransferase by human apolipoprotein A-IV. J Biol Chem 1985;260:2258 – 64.
[6] Gambert P, Lagrost L, Athias A, Bastiras S, Lallemant C. Role of apolipoprotein A-IV in the interconversion of HDL sub-classes. Adv Exp Med Biol 1988;243:263 – 9.
[7] Utermann G, Beisiegel U. Apolipoprotein A-IV, a protein occur-ring in human mesenteric limph chylomicrons and free in
plasma: isolation and quantitation. Eur J Biochem 1979;99:333 – 43.
[8] Green PHR, Glickman RM, Riley JW, Quinet E. Human apolipoprotein A-IV. Intestinal origin and distribution in plasma. J Clin Invest 1980;65:911 – 9.
[9] Weinberg RB, Spector MS. Human apolipoprotein A-IV: dis-placement from the surface of triglyceride-rich particles by HDL2-associated C-apoproteins. J Lipid Res 1985;26:26 – 37. [10] Breckenridge WC, Little JA, Steiner G, Chow A, Poapst M.
Hypertriglyceridemia associated with deficiency of apolipo-protein C-II. N Engl J Med 1978;298:1265 – 73.
[11] Fojo SS, Law SW, Beiseigel U, et al. Analysis of apo C-II in patients with apo C-II deficiency. Arteriosclerosis 1986;6:552 abstr.
[12] Karathanasis SK. Apolipoprotein multigene family: tandem or-ganization of human apolipoprotein A-I, C-III and A-IV genes. Proc Natl Acad Sci USA 1985;82:6374 – 8.
[13] Schamaun O, Olaisen B, Mevag B, Gedde-Dahl T, Jr, Ehnholm C, Teisberg P. The two apolipoprotein loci apo A-I and apo A-IV are closely linked in man. Hum Genet 1984;68:181 – 4. [14] Lohse P, Brewer HB, Jr. Genetic polymorphism of
apolipo-protein A-IV. Curr Opin Lipidol 1991;2:90 – 5.
[15] Menzel HJ, Sigurdsson G, Boerwinkle E, Schrangl-Will S, Dieplinger H, Utermann G. Frequency and effect of human apolipoprotein A-IV polymorphism on lipid and lipoprotein levels in an Icelandic population. Hum Genet 1990;84:344 – 6. [16] Von Eckardstein A, Funke H, Chirazi A, et al. Sex-specific
effects of the glutamine/histidine polymorphism in apo A-IV on HDL metabolism. Arterioscler Thromb 1994;14:1114 – 20. [17] Rewers M, Kamboh I, Hoag S, Shetterly M, Ferrell RE,
Ham-man RF. Apo A-IV polymorphism associated with myocardial infarction in obese NIDDM patients. Diabetes 1994;43:1485 – 9. [18] McCombs RJ, Marcadis DE, Ellis J, Weinberg RB. Attenuated hypercholesterolemic response to a high-cholesterol diet in sub-jects heterozygous for the apolipoprotein A-IV-2 allele. N Engl J Med 1994;331:706 – 10.
[19] Mata P, Ordovas JM, Lopez-Miranda J, et al. Apo A-IV pheno-type affects diet-induced plasma LDL cholesterol lowering. Arte-rioscler Thromb 1994;14:884 – 91.
[20] Jansen S, Lo´pez-Miranda J, Ordova´s JM, et al. Effect of 360His mutation in apolipoprotein A-IV on plasma HDL-cholesterol response to dietary fat. J Lipid Res 1997;38:44 – 51.
[21] Fisher RM, Burke H, Nicaud V, Ehnholm C, Humphries SE. Effect of variation in the apo A-IV gene on body mass index and fasting and postprandial lipid in the European Atherosclerosis Research Study II. J Lipid Res 1999;40:287 – 94.
[22] Boerwinkle E, Brown S, Sharrett AR, Heiss G, Patsch W. Apolipoprotein E polymorphism influences postprandial retinyl palmitate but not triglyceride concentrations. Am J Hum Genet 1994;54(2):341 – 60.
[23] Bucolo G, David H. Quantitative determination of serum triglycerides by use of enzymes. Clin Chem 1973;19:476 – 82. [24] Allain CC, Poon LS, Chang CSG, Richmond W, Fu PC.
Enzy-matic determination of total serum cholesterol. Clin Chem 1974;20:470 – 5.
[25] Riepponen P, Marniemi J, Rautaoja T. Immunoturbidimetric determination of apolipoproteins A-I and B in serum. Scand J Clin Lab Invest 1987;47:739 – 44.
[26] Warnick GR, Benderson J, Albers JJ. Dextran sulfate-Mg++ precipitation procedure for quantitation of high density lipo-protein cholesterol. Clin Chim 1982;28:1379 – 88.
[27] Ruotolo G, Zhang H, Bentsianov V, Le NA. Protocol for the study of the metabolism of retinyl esters in plasma lipoproteins during postprandial lipemia. J Lipid Res 1992;33:1541 – 9. [28] De Ruyter MGM, De Leenheer AP. Simultaneous determination
[29] Karpe F, Hamsten A. Determination of apolipoproteins B-48 and B-100 in triglyceride-rich lipoproteins by analytical SDS-PAGE. J Lipid Res 1994;35:1311 – 7.
[30] Hixson JE, Powers PK. Restriction isotyping of human apolipo-protein A-IV: rapid typing of known isoforms and detection of a new isoform that deletes a conserved repeat. J Lipid Res 1991;32:1529 – 35.
[31] Calabresi L, Cassinotti M, Gianfranceschi G, et al. Increased postprandial lipemia in Apo A-IMilano carriers. Arterioscler Thromb 1993;13(4):521 – 8.
[32] Lopez-Miranda J, Ordovas JM, Ostos MA, et al. Dietary fat clearance in normal subjects is regulated by genetic variation in apolipoprotein B. Arterioscler Thromb Vasc Biol 1997;17:1765 – 73.
[33] Brenninkmeijer BJ, Stuyt PMJ, Demacker PNM, Stalenhoef AFH, Van’t Laar A. Catabolism of chylomicron remnants in normolipidemic subjects in relation to the apoprotein E pheno-type. J Lipid Res 1987;28:361 – 70.
[34] Weintraub MS, Eisenberg S, Breslow JL. Dietary fat clearance in normal subjects is regulated by genetic variation in apolipo-protein E. J Clin Invest 1987;80:1571 – 7.
[35] Green PHR, Glickman RM, Riley JW, Quinet E. Human apolipoprotein A-IV. Intestinal origin and distribution in plasma. J Clin Invest 1980;65:911 – 9.
[36] Bisgaier CL, Sachdev OP, Megna L, Glickman RM. Distribu-tion of apolipoprotein A-IV in human plasma. J Lipid Res 1985;26:11 – 25.
[37] Seishima M, Mori A, Kawade M, Okuno F, Yoshida T, Muto Y. Determination of serum apo A-IV concentration in patients receiving total parenteral nutrition. Gastroenterology 1985;20:558 – 63.
[38] Koga S, Miyata Y, Funakoshi A, Ibayashi H. Plasma apolipo-protein A-IV levels decrease in patients with chronic pancreatitis and malabsorption syndrome. Digestion 1985;32:19 – 24.
[39] Menzel HJ, Boerwinkle E, Schrangl-Will S, Utermann G. Hu-man apolipoprotein A-IV polymorphism: frequency and effect on lipid and lipoprotein levels. Hum Genet 1988;79:368 – 72.
[40] Von Eckardstein A, Funke H, Schulte M, Erren M, Schulte H, Assman G. Nonsynonymous polymorphic sites in the apolipo-protein (apo) A-IV gene are associated with changes in the concentration of apo B- and apo A-I-containing lipoproteins in a normal population. Am J Hum Genet 1992;50:1115 – 28.
[41] Von Eckardstein A, Heinrich J, Funke H, et al. Glutamine/ His-tidine polymorphism in apo A-IV affects plasma concentrations of lipoprotein (a) and fibrin split products in coronary heart disease patients. Arterioscler Thromb 1993;13:240 – 6.
[42] Rewers M, Kamboh I, Hoag S, Shetterly M, Ferrell RE, Ham-man RF. Apo A-IV polymorphism associated with myocardial infarction in obese NIDDM patients. Diabetes 1994;43:1485 – 9. [43] Geissinger BW, Terry JG, Crouse JR, Stegner J, Weinberg RB. Effect of the apo A-IV-2 allele on intestinal cholesterol absorp-tion and plasma lipoprotein response to a high cholesterol/ satu-rated fat diet. Circulation 1996;94(8):266 abstr.
[44] Ehnholm C, Tenkanen H, de Knijff P, et al. Genetic polymor-phism of apolipoprotein A-IV in five different regions of Europe. Relations to plasma lipoproteins and to history of myocardial infarction: the EARS study. Atherosclerosis 1994;107:229 – 38. [45] Weinberg RB, Jordan MK, Steinmetz A. Distinctive structure
and function of human apolipoprotein variant apo A-IV-2. J Biol Chem 1990;265:18372 – 8.
[46] Campos H, Lo´pez-Miranda J, Rodriguez C, Albajar M, Schaefer EJ, Ordova´s JM. Urbanization elicits a more atherogenic lipo-protein profile in carriers of the apolipolipo-protein A-IV-2 allele than in A-IV-1 homozygotes. Arterioscler Thromb Vasc Biol 1997;17:1074 – 81.
